UNIVERSIDADE ESTADUAL DO CEARÁ PRÓ-REITORIA DE...
Transcript of UNIVERSIDADE ESTADUAL DO CEARÁ PRÓ-REITORIA DE...
UNIVERSIDADE ESTADUAL DO CEARÁ
PRÓ-REITORIA DE PÓS-GRADUAÇÃO E PESQUISA
FACULDADE DE VETERINÁRIA
PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS VETERINÁRIAS
ALINE LOBÃO DA SILVA
CARACTERIZAÇÃO DE BACTÉRIAS E LEVEDURAS ASSOCIADAS A GUARÁS
(Eudocimus ruber), MANTIDOS EM CATIVEIRO NO PARQUE MANGAL DAS
GARÇAS EM BELÉM DO PARÁ
FORTALEZA - CEARÁ
2015
ALINE LOBÃO DA SILVA
CARACTERIZAÇÃO DE BACTÉRIAS E LEVEDURAS ASSOCIADAS A GUARÁS
(Eudocimus ruber), MANTIDOS EM CATIVEIRO NO PARQUE MANGAL DAS
GARÇAS EM BELÉM DO PARÁ
Dissertação apresentada ao Curso de Mestrado
Acadêmico em Ciências Veterinárias do
Programa de Pós-Graduação em Ciências
Veterinárias da Faculdade de Veterinária da
Universidade Estadual do Ceará, como
requisito parcial para obtenção do título de
mestre em Ciências Veterinárias.
Área de Concentração: Reprodução e Sanidade
Animal.
Orientador: Prof. Dr. Marcos Fábio Gadelha
Rocha
FORTALEZA - CEARÁ
2015
ALINE LOBÃO DA SILVA
CARACTERIZAÇÃO DE BACTÉRIAS E LEVEDURAS ASSOCIADAS A GUARÁS
(Eudocimus ruber), MANTIDOS EM CATIVEIRO NO PARQUE MANGAL DAS
GARÇAS EM BELÉM DO PARÁ
Dissertação apresentada ao Curso de Mestrado
Acadêmico em Ciências Veterinárias do
Programa de Pós-Graduação em Ciências
Veterinárias da Faculdade de Veterinária da
Universidade Estadual do Ceará, como
requisito parcial para obtenção do título de
mestre em Ciências Veterinárias.
Aprovada em: 15/12/2015
Às minhas queridas avós, Donata Lobão (in
memoriam) e Nazareth Silva (in memoriam),
pelo exemplo de garra, fé, bondade,
generosidade e amor.
Dedico.
AGRADECIMENTOS
Ao Programa de Pós-Graduação em Ciências Veterinárias, da Faculdade de Veterinária,
da Universidade Estadual do Ceará.
Ao Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), pelo apoio
financeiro.
À Coordenação de Aperfeiçoamento Pessoal de Nível Superior (CAPES) pelo apoio
financeiro à pesquisa.
Ao Projeto Procad Casadinho UFRA-UECE, pela oportunidade de realização desse
mestrado.
Ao Centro Especializado em Micologia Médica (CEMM), da Universidade Federal do
Ceará, pela infrainstrutura para realização de toda a pesquisa.
Ao Parque Mangal das Garças, por abrir as portas e permitir que as coletas fossem
realizadas.
Ao professor Marcos Fábio Gadelha Rocha, pelo voto de confiança ao aceitar ser meu
orientador, pela atenção, seriedade e compromisso, e por ser um grande exemplo como
pesquisador e orientador.
Ao professor Frederico Ozanan Barros Monteiro, por intermediar o contato com o
professor Marcos Fábio antes da seleção de mestrado e por aceitar participar desta banca.
À professora Raimunda Sâmia Nogueira Brilhante, por todo carinho e por sua
disponibilidade em ajudar e supervisionar as minhas atividades desenvolvidas no laboratório.
À professora Tereza de Jesus Pinheiro Gomes Pereira pelos ensinamentos, atenção e
paciência durante o mestrado e por aceitar participar desta banca.
Ao professor José Júlio Costa Sidrim, pela dedicação e empenho pelo crescimento do
CEMM, fazendo do mesmo, um laboratório de excelência para realização deste trabalho e de
muitos outros.
À professora Rossana de Aguiar Cordeiro, pelo apoio intelectual dedicado aos alunos.
À professora Débora Castelo Branco de Souza Collares Maia, por sempre estar disposta a
ajudar e pelas valiosas considerações para o desenvolvimento desta pesquisa.
Ao Professor Waldemiro de Aquino Pereira Neto, pelas análises estatísticas desse estudo.
À Terezinha de Jesus por todo suporte proporcionado para a realização de nossas
pesquisas e pelo carinho e amizade.
À Glaucia Morgana de Melo Guedes, pela grandiosa ajuda em todas as etapas desta
pesquisa, por sempre compartilhar seus conhecimentos, pelo exemplo de profissional, pela
convivência maravilhosa e pela amizade construida.
Ao Jonathas Sales de Oliveira, por toda ajuda durante os experimentos, pelos
conhecimentos, pela enorme contribuição durante a tradução dos artigos, pela parceria e
incrível amizade.
À Jamille Alencar Sales, pela ajuda intelectual e prática durante o desenvolvimento deste
estudo, pelo exemplo de determinação e organização e pelo carinho e amizade construída.
Ao José Erisvaldo Maia Junior, pela ajuda durante os experimentos, pela parceria e
amizade desenvolvida.
Aos colegas do CEMM: Rosana, Tony, Lucas, David, Giovanna, Paula, Ewerton, Felipe,
Edmilson, Lucilene, Patricia, Yago, Raquel, Jonatas, Thalita, Janaina e Isis, pela convivência
divertida e prazerosa, e pelo companheirismo.
A equipe do Parque Mangal das Garças, pela ajuda essencial durante as coletas. Em
especial a Médica Veterinária Stefânia Araújo Miranda, por facilitar essa parceria e pela
amizade construída.
Aos meus queridos pais, Socorro e Roberto, e irmãos, Fábio e Bruno, por todo suporte e
incentivo durante toda a minha formação profissional e pelos ensinamentos e amor
incondicional.
As tias, tios, primos e avó, por todo incentivo, pelas palavras de encorajamento e por toda
compreensão dos meus momentos de ausência.
Ao meu companheiro e melhor amigo, Caio Amorim, por ser meu principal incentivador,
por ter sido meu assistente pessoal e fotógrafo durante as coletas e principalmente, por todo
amor e companheirismo.
Aos meus amigos-irmãos Gustavo, Carol e Felipe, por dividirem essa experiência de
cursar mestrado longe de nossa cidade natal, e por tornarem tudo isso muito mais fácil e
divertido.
Aos animais, razão da minha profissão, em especial aos meus amores peludos Kachi,
Yara e Sherlock que tornam minha vida muito mais leve e alegre.
A Deus, por sempre guiar meu caminho e por permitir que mais esse sonho se torne
realidade.
“Seja você quem for, seja qual for a posição social
que você tenha na vida, a mais alta ou a mais
baixa, tenha sempre como meta muita força,
muita determinação e sempre faça tudo com
muito amor e com muita fé em Deus, que um dia
você chega lá. De alguma maneira você chega lá”.
(Ayrton Senna)
RESUMO
Existem diversos registros relatando a importância das aves como hospedeiras e
disseminadoras de microorganismos capazes de causar zoonoses. Entretanto, há poucos
estudos sobre o papel do guará (Eudocimus ruber) como carreador de bactérias e leveduras
potencialmente patogênicas. Portanto, este trabalho objetivou isolar bacilos Gram-negativos,
não fermentadores de lactose em ágar MacConkey e produtores de oxidase a partir de
amostras de fezes e de material biológico da cloaca de guarás mantidos em cativeiro e de 30
amostras de água do ambiente em que vivem. Em seguida, buscou-se determinar a
sensibilidade de cepas de Aeromonas spp. e de Plesiomonas shigelloides e avaliar a virulência
das cepas de Aeromonas spp. por meio da detecção dos genes que codificam enterotoxina
(act), hemolisina (asa1) e sistema de secreção tipo III (ascV) por PCR simples. Ademais,
objetivou-se também identificar leveduras presentes no trato gastrointestinal dessas aves, bem
como de material vegetal do ambiente em que estão inseridos. Por fim, determinou-se o perfil
de sensibilidade das cepas de Candida famata frente aos antifúngicos. Para isso, foi realizada
coleta de material biológico da cloaca de 30 guarás oriundos do Parque Mangal das Garças
(Belém, PA), de pool fecal dos recintos onde as aves estavam agrupadas, de amostras de água
dos lagos artificiais e de troncos e ocos das árvores. O material foi processado e semeado nos
meios: ágar MacConkey, ágar TCBS (tiossulfato, citrato, bílis e sacarose), ágar Sabouraud
com cloranfenicol e ágar Semente de Níger. A identificação das espécies baseou-se nas
características micromorfólogicas e bioquímicas e por sistema automatizado Vitek 2. Foram
isoladas 22 bactérias, sendo 10 Aeromonas veronii bv. sobria, 2 Aeromonas hydrophila e 10
Plesiomonas shigelloides. As cepas foram submetidas a testes de sensibilidade antimicrobiana
in vitro pelo método de microdiluição em caldo e pelo método automatizado Vitek 2,
utilizando os seguintes antibióticos: piperacilina-tazobactam, cefepime, ceftazidima,
meropenem, gentamicina e ciprofloxacina. Foi observada resistência à gentamicina em 4
cepas de P. shigelloides e perfil intermediário a piperacilina-tazobactam e cefepime em 2 A.
veronii bv. sobria e 1 P. shigelloides, respectivamente. Quanto os fatores de virulência das
cepas de Aeromonas spp., observou-se que os genes de virulência asa1 e ascV foram os mais
detectados. Com relação à identificação de leveduras, foram isoladas 50 leveduras, sendo 18
Candida famata, 13 Candida catenulata, 2 Candida intermedia, 1 Candida lusitaniae, 1
Candida guilliermondii, 1 Candida kefyr, 1 Candida amapae, 1 Candida krusei, 8
Trichosporon spp. e 4 Rhodotorula spp. Teste de sensibilidade foi realizado com as cepas de
C. famata aos antifungicos anfotericina B, caspofungina, fluconazol e voriconazol. Fenômeno
de resistência ao fluconazol e voriconazol foi observado em uma cepa isolada de fezes, bem
como CIMs elevados foram encontrados para anfotericina B. Finalmente, conclui-se que os
guarás e o ambiente onde estão inseridos podem albergar bactérias e leveduras potencialmente
patogênicas, havendo a necessidade de estabelecer estratégias de monitoramento e de
prevenção de infecções em humanos e outros animais.
Palavras-chave: Eudocimus ruber. Microbiota. Aeromonas spp.. Plesiomonas shigelloides.
Leveduras. Candida famata. Sensibilidade antimicrobiana. Fatores de virulência.
ABSTRACT
There are several reports describing the importance of birds as hosts and disseminators of
microorganisms able to cause zoonoses. However, there are few studies on the role of scarlet
ibis (Eudocimus ruber) as a carrier of bacteria and potentially pathogenic yeasts. Therefore,
this study aimed to isolate non-lactose fermenting, oxidase positive Gram-negative bacilli
from stool and cloacal samples from scarlet ibises kept in captivity and 30 environmental
water samples in which live. Next, we sought to determine the susceptibility of Aeromonas
spp and Plesiomonas shigelloides and assess the virulence of Aeromonas spp. by detecting the
genes encoding enterotoxin (act), haemolysin (asa1) and type III secretion system (ascV) by
conventional PCR. Moreover, yeasts present in the gastrointestinal tract of scarlet ibises and
from plant material present in the environment in which they live were recovered. Finally, we
determined the susceptibility profile of Candida famata against antifungal drugs. For this
purpose, we collected cloacal material from 30 scarlet ibises found at Parque Mangal das
Garças (Belém, PA), pool of the feces found in places where the birds grouping, water
samples from ponds and samples of trunks and hollow of trees. The material was processed
and seeded in the media: MacConkey agar, TCBS (thiosulfate, citrate, bile and sucrose agar),
Sabouraud agar with chloramphenicol and Niger seed agar. The species identification was
based on micromorphological and biochemical characteristics and using automated system
Vitek 2. Overall, 10 Aeromonas veronii bv. sobria, 2 Aeromonas hydrophila and 10
Plesiomonas shigelloides were recovered. The strains were tested for in vitro antimicrobial
susceptibility by microdilution broth method and the Vitek 2 automated method, using the
following antibiotics: piperacillin-tazobactam, cefepime, ceftazidime, meropenem, gentamicin
and ciprofloxacin. Resistance to gentamicin was observed in 4 strains of P. shigelloides and
intermediate susceptibility to piperacillin-tazobactam and cefepime was observed in 2 strains
of A. veroniibv. sobria and 1 strain of P. shigelloides, respectively. The most prevalent
virulence genes were asa1 and ascV, which were detected in 8/12 and 9/12 strains of
Aeromonas spp., respectively. Rearding te identification of yeasts, 50 yeasts were isolated and
identified: 18 Candida famata, 13 Candida catenulata, 2 Candida intermedia, 1 Candida
lusitaniae, 1 Candida guilliermondii, 1 Candida kefyr, 1 Candida amapae, 1 Candida krusei,
8 Trichosporon spp. and 4 Rhodotorula spp. Susceptibility testing was performed with strains
of C. famata against amphotericin B, caspofungin, fluconazole and voriconazole. Resistance
to fluconazole and voriconazole was observed in a strain isolated from stool and high MICs
were found for amphotericin B. Finally, it is concluded that the scarlet ibis and the
environment in which they live may harbor potentially pathogenic bacteria and yeast, with the
need for monitoring and measures to prevent infections of humans and other animals.
Keywords: Eudocimus ruber. Microbiota. Aeromonas spp. Plesiomonas shigelloides. Yeasts.
Candida famata. Antimicrobial susceptibility. Virulence factors.
LISTA DE FIGURAS
Página
Figura 1- Guarás do Parque Mangal das Garças. Observar coloração vermelha
intensa e o aspecto alongado do bico e pescoço, que auxilia na
alimentação. Fonte: Arquivo pessoal, 2014.................................................. 16
Figura 2- Isolamento primário: Colônias com 24h de crescimento em ágar
MacConkey (Seta indicando colônia lactose-negativa. Colônias rosadas,
possivelmente de E. coli, são lactose-positivas). LAPERE, 2015................
24
Figura 3- (A): Fita teste reativo para Oxidase. (B): Provas bioquímicas para triagem
de Aeromonas spp, Vibrio spp. e P. shigelloides (Da esquerda para direita:
Indol positivo, urease negativa e fermentação de glicose). LAPERE,
2015..............................................................................................................
25
Figura 4- Prova de Voges-Proskauer: as cepas de A. hydrophila apresentam resultado
positivo indicado pelo aparecimento do anel de cor vermelha, enquanto A.
caviae não apresentam. Cepas de Klebsiella pneumoniae e Escherichia coli
foram usadas como controle positivo e negativo, respectivamente.
LAPERE, 2015..............................................................................................
26
Figura 5- (A): Blastoconidios em preparação com lactofenol azul de algodão. (B):
Crescimento de Candida spp. em meio cromogênico. CEMM, 2013..........
29
Figura 6- (A): Prova de assimilação de carboidratos (observa-se crescimento no
meio onde a levedura assimilou o carboidrato). (B): Prova de assimilação
de nitrogênio (a cepa estudada não utilizou o nitrato como fonte de
nitrogênio, tendo crescimento apenas onde foi assimilado a peptona).
CEMM, 2013................................................................................................
30
Figura 7- (A): Prova de fermentação de carboidratos de Candida spp. Observa-se a
formação de bolha no interior do tubo de Durham (produção de gás),
indicativo de fermentação positiva (seta). (B): Prova da urease (o tubo da
esquerda representa resultado positivo com mudança de coloração do
meio, enquanto o da esquerda é negativo). CEMM, 2013...........................
30
Figura 8- (A): Placa de Microcultivo (B): Leitura de microcultivo de Candida
famata, visualização apenas de blastoconídios. CEMM, 2015.................... 31
LISTA DE TABELAS
CAPITULO 1 Página
Tabela 1- Isolation and identification of Aeromonas spp. and Plesiomonas
shigelloides………………………………………………………………
52
Tabela 2- In vitro antimicrobial susceptibility of Aeromonas spp. and
Plesiomonas shigelloides using broth microdilution and Vitek 2
system……………………………………………………………………
53
Tabela 3- Frequency distribution of virulence genes in Aeromonas spp……........... 54
CAPITULO 2
Tabela 1- Isolation and identification of yeasts……………………………………. 70
Tabela 2- In vitro antifungal susceptibility of Candida famata by microdilution
broth method and automated method Vitek 2…………………………... 71
LISTA DE ABREVIATURAS E SIGLAS
act Enterotoxina
AMB Anfotericina B
asa1 Hemolisina
ascV Sistema de secreção tipo III
CAPES Coordenação de Aperfeiçoamento de Pessoal de Nível Superior
CAS Caspofungina
CAZ Ceftazidima
CEMM Centro Especializado em Micologia Médica
CIM Concentração inibitória mínima
CIP Ciprofloxacina
CLSI Clinical Laboratory Standards Institute
CNPq Conselho Nacional de Desenvolvimento Científico e Tecnológico
FEP Cefepime
FLC Fluconazol
GEN Gentamicina
IBAMA Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis
L Litro
LAPERE Laboratório de Patógenos Emergentes e Re-emergentes
MEM Meropenem
mg Miligrama
μg Micrograma
MIC Minimum inhibitory concentration
mL Mililitro
PCR Polymerase Chain Reaction
PTZ Piperacilina-tazobactam
rpm Rotações por minuto
SISBIO Sistema de Autorização e Informação em Biodiversidade
UECE Universidade Estadual do Ceará
UFC Unidade formadora de colônia
UFC Universidade Federal do Ceará
VRC Voriconazol
SUMÁRIO
1 INTRODUÇÃO....................................................................................................... 15
2 REVISÃO DE LITERATURA.............................................................................. 16
2.1 BIOLOGIA DO EUDOCIMUS RUBER.................................................................. 16
2.1.1 Classificação e características gerais da espécie.................................................. 16
2.1.2 Distribuição geográfica........................................................................................... 17
2.1.3 Estado de conservação............................................................................................ 17
2.1.4 Alimentação.............................................................................................................. 18
2.1.5 Reprodução............................................................................................................... 18
2.1.6 Filhotes...................................................................................................................... 19
2.2 MICRORGANISMOS............................................................................................... 19
2.2.1 Bactérias.................................................................................................................... 19
2.2.1.1 Aeromonas spp.......................................................................................................... 19
2.2.1.2 Vibrio spp.................................................................................................................. 21
2.2.1.3 Plesiomonas shigelloides.......................................................................................... 22
2.2.1.4 Identificação bacteriana: Aeromonas spp., Vibrio spp. e Plesiomonas shigelloides 24
2.2.2 Leveduras.................................................................................................................. 26
2.2.2.1 Candida spp. ............................................................................................................ 26
2.2.2.2 Trichosporon spp...................................................................................................... 28
2.2.2.3 Rhodotorula spp........................................................................................................ 28
2.2.2.4 Identificação de leveduras........................................................................................ 29
3 JUSTIFICATIVAS................................................................................................. 32
4 HIPÓTESES CIENTÍFICAS............................................................................... 32
5 OBJETIVOS............................................................................................................ 33
5.1 OBJETIVO GERAL................................................................................................. 33
5.2 OBJETIVOS ESPECÍFICOS................................................................................... 33
6 CAPITULO 1.......................................................................................................... 34
7 CAPITULO 2.......................................................................................................... 58
8 CONCLUSÕES....................................................................................................... 75
9 PERSPECTIVAS................................................................................................... 76
REFERÊNCIAS...................................................................................................... 77
APÊNDICES........................................................................................................... 87
15
1. INTRODUÇÃO
O guará (Eudocimus ruber), também denominado “scarlet ibis", guará-vermelho,
guará-rubro e guará-piranga, é uma ave vadeadora, colonial e forrageadora tátil, que se
reproduz em regiões costeiras e manguezais. Apesar de ser uma espécie protegida pela
legislação brasileira, o E. ruber já é considerado extinto em diversas regiões onde antes eram
avistados, principalmente no sul e sudeste do Brasil (IUCN, 2016).
Estudos sobre essa espécie ainda são escassos e abordam principalmente seus
hábitos comportamentais e reprodutivos, havendo uma carência de trabalhos sobre a sanidade
destes animais. Sabe-se que o estudo da microbiota bacteriana e de leveduras de aves
silvestres clinicamente saudáveis é um passo importante para a compreensão da
epidemiologia das doenças causadas por bactérias e fungos que podem afetar não só as
próprias aves, mas também outros animais e o homem. As aves albergam em suas cloacas
microrganismos potencialmente patogênicos, sendo capazes de dissemina-los no ambiente, o
que representa um problema, principalmente, quando as aves são criadas em confinamento
(CAFARCHIA et al., 2006a; KIM et al., 2015).
Dentre as bactérias de importância zoonótica, destacam-se Aeromonas spp., Vibrio
spp. e Plesiomonas shigelloides, encontradas em uma grande diversidade de habitats,
descritas como componentes da microbiota de animais ectotérmicos e de aves aquáticas. Além
disso, são relatados como patógenos de peixes e de seres humanos, causando enfermidades de
veiculação hídrica (KROVACEK et al., 2000, HIRSCH et al., 2006; JANDA e ABBOTT,
2010; KIM et al., 2015).
Em relação aos fungos, destaca-se o gênero Candida, composto por leveduras que são
comumente encontradas como comensais na microbiota de homens e animais. Em situações
de distúrbios nas proteções física, química e imunológica do hospedeiro, esses
microrganismos podem se tornar patogênicos e causar enfermidades, chamadas de candidíases
(SIDRIM & ROCHA, 2004; BRITO et al., 2009).
Baseado no exposto faz-se necessária a identificação de bactérias e leveduras da
microbiota do trato gastrintestinal e de fezes de guarás, além do ambiente que o circunda, com
vistas a contribuir para o conhecimento acerca dessa espécie ainda tão pouco estudada, bem
como para prevenções de potencias riscos a saúde humana e de outros animais.
16
FIGURA 1- Guarás do Parque Mangal das Garças. Observar coloração vermelha
intensa e o aspecto alongado do bico e pescoço, que auxilia na alimentação. Fonte:
Arquivo pessoal, 2014.
2. REVISÃO DE LITERATURA
2.1. BIOLOGIA DO EUDOCIMUS RUBER
2.1.1. Classificação e características gerais
A espécie foi classificada por Linneus (1758), inicialmente chamada de Scolopax
rubra, sendo mais tarde designada por E. ruber. O E. ruber é uma ave da ordem dos
Ciconiiformes da família Threskiornithidae (CUBAS, SILVA e DIAS, 2007). Os
Ciconiiformes são aves pernaltas com pescoços longos, destacando-se o guará por sua
plumagem vermelha (Figura 1) (SICK, 2001). Não há dimorfismo sexual aparente entre o
macho e a fêmea, no entanto, eles são semelhantes na aparência física, com comprimento
variando de 55 a 76 cm da ponta da cauda para a ponta do bico, e envergadura de 52 a 56 cm,
sendo os machos ligeiramente maiores que as fêmeas (HANCOCK, et al., 1992).
O bico curvado para baixo é fino e longo semelhante a uma pinça (Figura 1). Seu
longo pescoço auxilia o bico nos movimentos da cabeça durante a busca e caça de presas em
águas rasas. Além disso, usam o bico para espremer a glândula uropigial e aplicar o óleo nas
penas e impermeabiliza-las (ADAMS e CARROL, 2008).
Vivem cerca de 16 anos em vida livre, podendo chegar em média 20 anos em
cativeiro (HANCOCK, et al., 1992; RICKLEFS, 2000; NOVAES, 2009). Seus hábitos
alimentares e comportamentos de nidificação são muito influenciados pela qualidade do
habitat, o que, consequentemente, acabou rotulando-os como indicadores biológicos para
prever boas condições de habitat (POWELL e POWELL, 1986).
17
2.1.2. Distribuição Geográfica
Habitam áreas pantanosas, manguezais, lagos e rios de curso lento, vivendo em
bandos que procuram vegetação densa para dormir e nidificar, como os mangues-vermelho
(Rhizophora sp.), aturizais (Drepanocarpus sp.) e siriubais (Avicennia sp.) (HANCOCK, et
al., 1992; RICKLEFS, 2000; NOVAES, 2009).
A distribuição geográfica do guará estende-se pelas áreas costeiras de países, tais
como a Colômbia, Venezuela, Equador, Guiana, Guiana Francesa, Suriname e Brasil. São
encontrados também na América Central e em Trinidad e Tobago são considerados símbolos
nacionais (OLMOS, 2000; SICK, 2001; NOGUCHI, 2011).
Segundo Antas, Roth e Morrison et. al. (1990), até o século XIX o Brasil abrigava
grupos populacionais de E. ruber espalhados por uma grande extensão do litoral brasileiro
desde o Amapá ao Ceará, e do Rio de Janeiro a São Paulo, Paraná e Santa Catarina (SICK,
2001). As populações do sul e sudeste sofreram grande declínio, estando esse fato relacionado
à alteração do seu habitat pelo homem. Atualmente, as populações de guarás no Brasil estão
praticamente restritas as regiões litorâneas dos estados do Amapá, Pará e Maranhão, tendo
algumas raras aparições em manguezais no estado de São Paulo, no município de Cubatão e
Ilha Comprida (SANTOS et al, 2006).
2.1.3. Estado de conservação
O guará é protegido pela legislação brasileira por ser uma espécie ameaçada de
extinção (portaria IBDF n º 3.481-DN, 31 de maio 1973 e portaria IBAMA nº 1.522, de 19 de
dezembro de 1989). Embora a caça de guarás seja proibida em qualquer época do ano, a
execução da lei é fraca, principalmente ao longo do litoral norte. (ANTAS, ROTH e
MORRISON, 1990).
Baseado na lista vermelha de espécies ameaçadas da União Internacional para
Conservação da Natureza (IUCN), esta espécie possue populações elevadas. Portanto, não se
aproxima dos limiares para ser considerada espécie vulnerável. Apesar da população mostrar
uma tendência de diminuição, esta não é considerada suficientemente baixa para se aproximar
dos limiares de vulnerabilidade sob o critério tendência da população (maior que 30% de
diminuição ao longo de dez anos ou três gerações). Por essas razões, a espécie é avaliada
como pouco preocupante segundo a IUCN (2012). Porém no Brasil, o E. ruber já é
considerado extinto em diversas regiões, onde antes eram avistados, principalmente na região
sul e sudeste (SICK, 2001).
18
2.1.4. Alimentação
Constatou-se por meio de exames de conteúdos estomacais realizados por Sick
(2001) que os guarás se alimentam essencialmente de peixes a exemplo do “muré” (Gobius
oceanicus Pallas), de camarões, de pequenos caranguejos como o “chama-maré” (Uca sp.) e
“aratu” (Aratus pisonii) e de insetos (Dysticidae spp.). Hass, Matos e Machado (1999) citam
ainda a ingestão de aranhas, gastrópodes e matéria vegetal.
Sabe-se que a composição química dos crustáceos, presentes na alimentação de
guarás adultos, contém um pigmento carotenoide responsável pela coloração de suas penas,
tingindo suas plumas de um vermelho intenso (SICK, 2001). Os guarás têm a capacidade de
sequestrar os carotenoides acidogênicos do alimento e manufaturar cataxantina (β-caroteno
neutro), pela facilitação bioquímica e/ou por ação da microbiota intestinal (HASS, MATOS e
MACHADO, 1999). Em cativeiro, com a deficiência de carotenoides, os guarás tendem a
ficar mais cor-de-rosa do que vermelhos, mas essa coloração pode ser recuperada
adicionando-se cataxantinas no alimento que é oferecido (SICK, 2001).
Atualmente já existem no mercado rações especializadas para aves como os
guáras e flamingos, que necessitam de suplementação de carotenóides quando em cativeiro.
Um exemplo é a ração extrusada FL 32 que contém os pigmentos cataxantina (80,00 mg/kg),
beta caroteno (50,00 mg/kg) e xantofila (80,00 mg/kg). Além do fator nutricional, a ração
proporciona maior facilidade no manejo alimentar desses animais em cativeiro, de forma mais
higiênica e mantendo integridade física e química por mais tempo, quando comparada aos
alimentos naturais.
2.1.5. Reprodução
O período reprodutivo dos guarás ainda é pouco elucidado, sendo alvo de
discussão entre especialistas. No Brasil, tem sido encontrado grupos em período de
reprodução ativa em maio (MORRISON, ANTAS e ROSS, 1987), junho e setembro
(TEIXEIRA e BEST, 1981). No Pará, na ilha dos Pássaros, um ninhal foi encontrado ainda
ativo reprodutivamente no mês de agosto (ANTAS, ROTH e MORRISON, 1990;
FERNANDES e RODRIGUES, 1994).
A fêmea põe de 1 a 3 ovos de coloração verde-claro com manchas marrons, sendo
que o primeiro ovo é posto 5 a 6 dias após o coito e o período de incubação dura cerca de 23
dias (HANCOCK, et al., 1992; SICK, 2001; OLMOS e SILVA, 2001).
19
Os ninhos são plataformas irregulares, geralmente côncavas, sendo construídos
sobre ramificações ou ao longo dos galhos, com ramos finos e às vezes com folhas,
entrelaçadas frouxamente. O material utilizado na base dos ninhos é, geralmente, formado por
gravetos secos, podendo ser substituídos por ramos verdes com folhas, retirados das árvores
de mangue próximas aos ninhos (HASS, MATOS e MACHADO, 1999).
2.1.6. Filhotes
Após o nascimento, os filhotes são incapazes de fazer tarefas simples, como
levantar suas próprias cabeças e tendem a emitir um grito estridente para indicar quando eles
estão com fome (HANCOCK et al., 1992).
Os recém-nascidos são cobertos por plumagem negra, que muda gradualmente
para cinza fosca e seu bico é mais retilíneo, de coloração clara com a ponta enegrecida
(HANCOCK, et al., 1992). Emplumam totalmente a partir de 35 dias e com 75 dias já são
independentes. Os imaturos são pardo-escuro apresentando a região do baixo-dorso e
coberteiras superiores da cauda brancos e as penas de seu abdômen branco-amareladas (SICK,
2001). A mudança de coloração das penas tem inicio quando os animais começam a voar, o
que ocorre depois da segunda muda. Por volta da terceira muda a cor escarlate aparece pela
primeira vez levemente em seu dorso e se espalha gradualmente ao longo do pescoço, laterais
e asas, aumentando em intensidade ao longo de dois anos (FREDERICK e BILDSTEIN,
1992).
Machos e fêmeas de guarás incubam os ovos, alimentam os filhotes e os protegem
contra predadores (HANCOCK et al., 1992; SICK, 2001; OLMOS e SILVA, 2001). A
alimentação do recém-nascido exige que o adulto segure seu bico, fazendo com que o filhote
levante a cabeça, para que o adulto possa regurgitar em sua boca (SICK, 2001).
2.2. MICRORGANISMOS ABORDADOS NO ESTUDO
2.2.1. Bactérias
2.2.1.1. Aeromonas spp.
Inicialmente, as bactérias desse gênero eram classificadas como pertencentes à
família Vibrionaceae, na qual também estão incluídos os gêneros Vibrio, Photobacterium e
Plesiomas. No entanto, esse grupo não se enquadrava exatamente nesse gênero e, com base
em evidências genéticas e moleculares, sugeriram a criação de uma nova família, chamada de
Aeromonadaceae, sendo essa classificação muito bem aceita atualmente (ABBOTT,
CHEUNG e JANDA, 2003; RODRIGUES e RIBEIRO, 2004; JANDA e ABBOT, 2010). A
20
maioria dos trabalhos baseados em estudos moleculares sugere a existência de 14 diferentes
espécies já confirmadas: A. hydrophila, A. caviae, A. media, A. bestiarum, A. popofii, A.
eucrenophila, A. sobria, A. veronii, A. jandaei, A. allosaccharophila, A. schubertii, A.
encheleia, A. trota, A. salmonicida (KOZINSKA et al., 2002).
Aeromonas spp. são encontradas em uma grande diversidade de habitats, tais
como, solo, rios, lagos, viveiros, águas estuarinas, água potável (clorada e não clorada), água
do solo, água de esgoto em vários estágios de tratamento e fezes de animais. Possui ampla
distribuição em meios aquáticos, principalmente dulcícolas. Por essa razão, são descritas
como componentes da microbiota de animais pecilotérmicos, mas também podem ser
patógenos de peixes e do ser humano em enfermidades de veiculação hídrica (HIRSCH et al.,
2006; JANDA e ABBOTT, 2010).
A patogênese de Aeromonas sp. é complexa e ainda não foi muito bem elucidada.
A capacidade de produzir diversos fatores de virulência contribui para a patogênese da doença
ocasionada por esse grupo bacteriano. Dentre os fatores de virulência produzidos pelas
Aeromonas, têm-se: hemolisinas (aerolisinas), citotoxinas, enterotoxinas, proteases,
leucocidinas, fosfolipases, elastases, DNAses, adesinas e, ainda, colinesterases e endotoxinas
(TRABULSI e ALTERTHUM, 2005).
Em estudo realizado com 1226 aves selvagens, A. hydrophila foi isolada em 135
aves. A taxa de isolamento em aves aquáticas (18,5%) foi significativamente maior, quando
comparada às aves terrestres (3,4%). A infecção pode também depender de hábitos
alimentares, pois: 7,0% das espécies infectadas eram granívoras e herbívoras, 8,4% eram
onívoras e 12,0% eram carnívoras e insetívoras. Por fim, A. hydrophila foi isolada com maior
frequência durante o verão (12,9%) que no inverno (8,9%) (GLUNDER e SIEGMANN,
1989).
Em estudo no México, esfregaços de material coletado de cloaca de 110 marrecas-
cabocla (Dendrocygna autumnalis) adultas foram cultivados para caracterizar a microbiota e
detectar a presença de bactérias potencialmente patogénicas. Vinte e cinco enterobactérias
Gram-negativas e quatro cocos Gram-positivos foram isolados, sendo que A. hydrophila
representou 15% das amostras. Este estudo sugere que aves aquáticas são possíveis
reservatórios de bactérias patogênicas. (AGUIRRE et al. 1992).
Em trabalho realizado por Ocholi e Kalejaiye (1990), A. hydrophila foi isolada de
pulmões, fígado, rins e intestinos, de um Calau-grande cativo (Bucorvus abyssinicus)
diagnosticado com sepse hemorrágica aguda, principalmente nos órgãos internos.
Microscopicamente, foram observadas lesões necróticas no fígado, pulmões e rins. García et
21
al (1992) também descreveram ter isolado A. hydrophila dos olhos de um papagaio (Amazona
versicolor) que apresentava conjuntivite bilateral, demonstrando o papel deste gênero como
um patógeno oportunista.
Ainda, foi relatado por França et al. (2009), um caso em que um avestruz macho,
de 10 anos de idade, foi diagnosticado com enterite necrosante grave e sepse. O animal não se
alimentava havia três semanas e apresentava sinais neurológicos dois dias antes da morte.
Macroscopicamente, foram observadas lesões como congestão do fígado, rins e baço. A
histopatologia revelou enterite fibrinonecrótica grave, associada a grande número de bactérias
Gram-negativas, necrose fibrinóide multifocal nas artérias portal, acumulação de fibrina em
sinusóides hepáticos, degeneração do miocárdio e necrose. Ao fazer cultura de
microrganismos a partir do intestino, fígado, pulmões e traqueia, identificou-se presença de
bactérias do gênero Aeromonas. Os autores sugeriram então que estas bactérias foram a causa
da enterite necrosante, sepse e morte da avestruz, podendo ter sido predisposta pelo quadro de
deficiência de vitamina A, em que o animal se encontrava.
A gastroenterite é a forma mais comum de infecção humana causada por
Aeromonas sp. Entretanto, essas bactérias já foram descritas como agentes causais de outras
infecções, tais como: sepse, endocardites, meningites, pneumonias, infecções de pele, do trato
urinário, oculares, síndrome hemolítica urêmica. (KO et al., 2000; JANDA e ABBOTT,
2010).
2.2.1.2. Vibrio spp.
As espécies pertencentes ao gênero Vibrio são típicas de ambientes marinhos e
estuarinos, pois necessitam de NaCl (2 a 3%) para o crescimento. À medida que o ambiente
marinho é seu nicho natural, os Vibrios são facilmente isolados de peixes e crustáceos. A
maioria das espécies é mesófila com tendência a proliferação em estações mais quentes.
Fatores como temperatura, salinidade e densidade algal influenciam a presença de Vibrios no
ambiente, não havendo correlação entre patógenos entéricos humanos e/ou indicadores de
poluição fecal (HUSS et al., 2004).
Entre todas as espécies do gênero, V. cholerae se destaca, uma vez que ele é o
responsável pela cólera, uma doença endêmica em extensas áreas do globo terrestre. As cepas
de V. cholerae sofrem aglutinação no denominado anti-soro O1. As cepas que não sofrem
aglutinação com esse anti-soro são denominadas V. cholerae não-O1 ou designadas com uma
variedade de nomes de outras espécies do gênero: V. alginolyticus, V. carchariae, V.
22
cincinnatiensis, V. damsela, V. fluvialis, V. furnissii, V. hollisae, V. metschnikovii, V. mimicus,
V. parahaemolyticus, V. vulnificus, etc. (KONEMAN et al., 2012).
Vibrio cholerae foi isolado de swabs cloacais e de fezes coletadas de 20 espécies
de aves aquáticas no Colorado e Utah, durante 1986 e 1987. Cerca de 17% das amostras
fecais coletadas continham o microrganismo. Os resultados deste estudo sugerem que as aves
aquáticas atuam como portadores e podem disseminar V. cholerae em uma ampla área (OGG
et al, 1989).
Outra espécie que tem papel importante e vem sendo reconhecida de maneira
crescente nos últimos anos é V. parahaemolyticus, a qual está relacionada à toxinfecções
alimentares. As demais espécies são encontradas mais raramente em associações com diarréia
e outras infecções (TRABULSI e ALTERTHUM, 2005).
Em trabalho realizado no Japão, V. parahaemolyticus e V. vulnificus foram
isolados a partir de amostras de fezes de aves aquáticas selvagens durante o inverno. Apesar
dessas bactérias estarem presentes em número reduzido na água do mar da área onde foram
coletadas as amostras, os patógenos foram isolados das fezes, o que demonstrou que aves
aquáticas selvagens são vetores de transmissão para Vibrio spp. (MIYASAKA et al., 2006).
As espécies V. alginolyticus, V. cholerae V. parahaemolyticus, V. damsela e V.
fluvialis foram recuperados a partir de fezes de seis tipos de aves aquáticas (gaivotas,
pelicanos, gansos canadenses, cisnes, garças e biguás) de Connecticut e da costa da Flórida,
EUA. Esses resultados mostraram que Vibrio spp. são comumente encontradas em aves
marinhas ao longo do litoral do nordeste e do sudeste dos Estados Unidos, indicando que
esses animais podem servir como vetores ou reservatórios desses patógenos (BUCK, 1990).
As infecções em humanos comumente apresentam quadros clínicos como diarreia,
sepse, otites, infecções de pele e tecidos moles. São geralmente adquiridas por consumo de
alimento e água contaminados ou mais raramente, por contaminação direta de feridas cutâneas
ocorrida durante o contato com a água do mar ou estuarinas (RODRIGUES et al., 2001).
2.2.1.3. Plesiomonas shigelloides
Plesiomonas shigelloides é uma bactéria Gram-negativa, anaeróbia facultativa,
que não forma esporos ou cápsula, recentemente classificada na família Enterobacteriaceae.
São bacilos retos, arredondados, curtos e móveis, com flagelos polares, geralmente
lofotríquios. Essa bacteria cresce bem em ágar sangue de carneiro e na maioria dos meios
entéricos. Os isolados não são hemolíticos em ágar sangue de carneiro; e crescem em 24h a 30
a 35°C; as colônias tem o diâmetro médio de 1,5 mm e são acinzentadas, brilhantes, lisas e
23
opacas, podendo ser ligeiramente elevadas no centro. Colônias dessa bactéria são facilmente
isoladas em ágares entéricos, como ágar MacConkey, desoxicolato, Hektoen e xilose-lisina-
desoxicolato. Aparece como não-fermentadora de lactose em ágar MacConkey e fermentam
glicose em tubos de ágar tríplice açúcar-ferro apresentando na base uma cor amarela. A
reação de citocromo oxidase é positiva e ocorre produção de indol (GARRITY et al., 2001;
JANDA, 2005; KONEMAN et al., 2012).
Plesiomonas shigelloides é ubíqua em águas superficiais e no solo e é encontrada
em uma ampla gama de hospedeiros como animais ectotérmicos, aves, gatos, vacas, cães,
porcos e macacos (KROVACEK et al., 2000; JANDA, 2005).
Em estudo realizado no Texas, com urubus-de-cabeça-vermelha (Cathartes aura),
observou-se que P. shigelloides foi encontrada em 30% dos 20 animais estudados,
demonstrando que essas aves atuam como reservatórios de patógenos entéricos, sendo essa
condição possivelmente relacionada a sua alimentação a base de peixes principalmente
(DONALD, 1981).
A maioria das cepas patogênicas parece ser de origem aquática e a infecção
humana ocorre pelo consumo de água não tratada e contaminada. O homem também pode ser
infectado após ingestão de alimentos contaminados e não lavados. (KONEMAN et al., 2012).
Está relacionado tanto a infecções instestinais, quanto a infeções extra-intestinais em humanos
podendo causar bacteremia, septicemia, meningite, pneumonia, osteomielite, ceratite e outras
doenças não-diarreicas (VANDEPITTE et al.1980; RAUTELIN et al, 1995; LEE et al. 1996).
Existem relatos de diarreia associada ao microrganismo em epidemias e casos
isolados descritos após ingestão de mariscos crus. A incidência de gastrenterites provocadas
pelo microrganismo é maior na época do verão (ROLSTON e HOPFER, 1984; SANYAL et
al., 1980).
Os sintomas da gastrenterite causada por P. shigelloides caracterizam-se por
diarreia aquosa leve, sem presença de sangue e muco. Pode, porém, apresentar-se na forma de
colite grave ou síndrome semelhante à cólera, em particular em pacientes imunodeprimidos
ou portadores de tumor maligno localizado na região gastrintestinal. Os indivíduos mais
suscetíveis são crianças e idosos e as apresentações extra-intestinais septicêmicas podem
ocorrer em pessoas imunodeprimidas ou portadoras de doenças crônico-degenerativas,
podendo levar ao óbito. Também há relatos de alguns casos de celulite ou infecção de feridas
em manipuladores de alimentos ou profissionais de sistemas de aquicultura. A patogenicidade
da espécie P. shigelloides está provavelmente relacionada à produção de uma enterotoxina
enteropatogênica (BRENDEN et al., 1988; YAMADA, et al. 1997).
24
Imunodeprimidos ou portadores de distúrbios hepatobiliares podem sofrer
complicações como septicemia e óbito. Contudo, a maioria dos casos em indivíduos saudáveis
possui evolução autolimitada. O tratamento da infecção é baseado na reparação
hidroeletrolítica e a antibioticoterapia recomendada somente em casos mais severos
(YAMADA, et al. 1997).
2.2.1.4. Identificação bacteriana: Aeromonas spp., Vibrio spp. e Plesiomonas
shigelloides
Para isolamento primário de Aeromonas spp., Vibrio spp. e P. shigelloides vários
meios seletivos e diferencias podem ser utilizados. No ágar MacConkey, um dos mais
empregados, esses três gêneros bacterianos apresentam-se como colônias claras não
fermentadoras de lactose (Figura 2), sendo possível diferencia-las das colônias fermentadoras
de lactose, que se apresentam com coloração e halo rosado (como a espécie Escherichia coli)
(KONEMAN et al., 2012). O ágar TCBS (agar de tiossulfato, citrato, bílis e sacarose) pode
ser utilizado para identificação presuntiva de V. cholerae e V. alginolyticus, que se
apresentam na forma de colônias amareladas, e de V. parahaemolyticus e V. vulnificus, que
produzem colônias verde-azuladas (KONEMAN et al., 2012).
As colônias suspeitas, após verificação por coloração de Gram de que realmente
são bacilos Gram-negativos, devem ser triadas pelo teste do citocromo oxidase. As cepas de
Aeromonas spp., Vibrio spp. e P. shigelloides são oxidase positivas e podem ser rapidamente
FIGURA 2 – Isolamento primário: Colônias com 24h de
crescimento em ágar MacConkey (Seta indicando colônia
lactose-negativa. Colônias rosadas, possivelmente de E. coli,
são lactose-positivas). LAPERE, 2015.
25
diferenciadas das espécies oxidase-negativas, como as Enterobacteriacea (GHENGHESH et
al., 2008). Para identificação das espécies de Aeromonas spp., Vibrio spp. e P. shigelloides
spp. serão realizadas triagens por testes bioquímicos específicos, baseado nas chaves de
identificação estabelecidas para esses gêneros. A fermentação de glicose e produção de indol
são características comuns aos três gêneros bacterianos estudados e ajudam a diferencia-los de
espécies como Pseudomonas spp. que utilazam a glicose de forma oxidativa e são indol-
negativas. Ademais, os testes de uréase e motilidade ajudam a restringir ainda mais a triagem
das cepas dentro de cada gênero (ABBOTT, CHEUNG e JANDA, 2003; KONEMAN et al.,
2012) (Figura 3).
Finalmente, a identificação em nível de espécie, principalmente para o gênero
Aeromonas, apresenta algumas dificuldades de interpretação, sendo recomendada a
identificação através de sistemas automatizados como o sistema Vitek 2 (bioMerieux) pela
utilização dos cartões para identificação de bacilos gram-negativos (PINCUS, 2006;
KONEMAN et al., 2012). Entretanto, o sistema não diferencia A. hydrophila de A. caviae,
havendo necessidade de inclusão da prova de Voges-Proskauer para fechar a identificação,
visto que apresentam resultado positivo e negativo, respectivamente (Figura 4) (KONEMAN
et al., 2012).
FIGURA 3 – (A): Fita teste reativo para Oxidase. (B): Provas bioquímicas para triagem de
Aeromonas spp, Vibrio spp. e P. shigelloides (Da esquerda para direita: Indol positivo, urease e
fermentação de glicose). LAPERE, 2015.
Controle positivo
Controle negativo
Aeromonas sobria
P. shigelloides
A B
26
2.2.2. Leveduras
2.2.2.1. Candida spp.
O gênero Candida é composto por leveduras que vivem como comensais na
microbiota de homens e animais. Normalmente não causam nenhum dano ao hospedeiro,
exceto em situações em que ocorram distúrbios nas proteções física, química e imunológica,
quando esses microrganismos podem se tornar patogênicos e causar enfermidades, chamadas
de candidíases (MUELLER et al., 2002; MORETTI et al., 2004; SIDRIM & ROCHA, 2004).
Nos últimos anos, tem-se evidenciado aumento dos relatos de infecções por essas
leveduras, com diferentes manifestações clinicas e atingindo diversos animais. Dentre as
espécies mais envolvidas em casos de candidíases encontra-se a C. albicans, como a mais
frequentemente citada, além de C. tropicalis e C. parapsilosis (MUELLER et al., 2002;
OZAWA et al., 2005).
As leveduras C. albicans, C. tropicalis, C. inconspicua, C. pelliculosa, C. famata,
C. parapsilosis e C. guilliermondii já foram isoladas de aves saudáveis, sendo encontradas
como parte da microbiota do trato digestivo de diversas espécies, tais como pombos, perus,
aves de rapina, migratórias, industriais, dentre outras (CAFARCHIA et al., 2006a; GARCIA
et al., 2007; CAFARCHIA et al., 2008; BRILHANTE et al, 2010; BRILHANTE et al., 2013).
Cepas de Aeromonas Controles
FIGURA 4 – Prova de Voges-Proskauer: as cepas de A.
hydrophila apresentam resultado positivo indicado pelo
aparecimento do anel de cor vermelha, enquanto A. caviae
não apresentam. Cepas de Klebsiella pneumoniae e
Escherichia coli foram usadas como controle positivo e
negativo, respectivamente. LAPERE, 2015.
27
As aves albergam em suas cloacas leveduras potencialmente patogênicas, sendo
capazes de disseminar esses fungos no ambiente, o que representa um problema
principalmente para aves criadas confinadas (CAFARCHIA et al., 2006a). As candidiases,
frequentemente associadas à morbidade e mortalidade de aves, têm como fatores
predisponentes estresse, idade, antibioticoterapia prolongada e status imunológico do animal
(BALASUBRAMANIAM e SUKUMAR, 2007). A microbiota bacteriana do trato
gastrointestinal das aves tem efeito inibitório sobre o crescimento de Candida spp.. No
entanto, se ocorrer desequilíbrio da microbiota digestiva, pelo uso incorreto de antibióticos
por exemplo, ou por mudanças no pH gastrintestinal, o que pode resultar na proliferação da
microbiota por leveduras (GARCIA et al., 2007; BRILHANTE et al., 2013).
Em aves jovens, Candida sp. está geralmente associada a problemas
gastrointestinais, devido ao sistema imunológico estar imaturo ou ao desenvolvimento
incompleto das defesas gastrointestinais. O principal agente envolvido na candidiase em aves
é a C. albicans, levando ao aparecimento da doença, principalmente no sistema digestivo,
podendo acometer o sistema reprodutivo, os olhos e/ou tornar-se sistêmica. (VELASCO,
2000; BALASUBRAMANIAM e SUKUMAR, 2007; GARCIA et al., 2007).
Os sintomas de candidiase em aves vão desde o aparecimento de placas
esbranquiçadas, localizadas em geral no interior da cavidade bucal e, especialmente, no papo,
pela formação de placas pseudomembranosas necróticas na cavidade oral e no trato digestivo
e pela presença de material caseoso que dificulta a deglutição e respiração. Penas eriçadas,
dificuldades de ingestão de alimentos, diarreia, dispneia, anorexia, prostração, regurgitação,
vômito, perda de peso e esofagite são sinais aparentes. Casos graves podem provocar
deformidades no bico. Em casos de infecções sistêmicas são observados sinais no sistema
nervoso central, bem como lesões típicas de candidiase gastrointestinal (VELASCO, 2000;
BALASUBRAMANIAM e SUKUMAR, 2007).
Em estudo realizado por Silva (2009) com aves de rapina, das 64 amostras
analisadas observou-se que 15 (23,4%) foram positivas para presença de leveduras, tendo sido
identificadas: C. albicans, C. parapsilosis, C. tropicalis e C. magnoliae. Em trabalho sobre a
microbiota de Psitacideos (Nymphicus hollandicus), os autores relataram que as espécies mais
frequentemente encontradas foram C. albicans (32,5%), seguido de C. tropicalis (20%), C.
famata (10%), dentre outras que fazem parte da microbiota do trato gastrointestinal dessas
aves (BRILHANTE et al., 2010).
28
2.2.2.2. Trichosporon spp.
As leveduras do gênero Trichosporon são comumente encontradas no solo e na
microbiota da pele e do trato gastrintestinal de seres humanos. No homem, podem ocasionar o
desenvolvimento de uma micose superficial estrita, denominada de piedra branca (SIDRIM &
ROCHA, 2004). A infecção disseminada é rara, porém potencialmente fatal, estando
associada à imunossupressão, tendo como fatores de risco: doenças hematológicas,
hemocromatose, uso de imunossupresores, corticoterapia, síndrome da imunodeficiência
adquirida, queimaduras extensas, uso de cateteres venosos, entre outros. Dentre as espécies
mais comumente implicadas, em casos de infecções humanas, destacam-se T. inkin e T. asahii
(SIDRIM & ROCHA, 2004; FAGUNDESJÚNIOR et al., 2008).
Em relação as aves, um estudo demonstrou a ocorrência de dermatite eosinofilica
causada por T. asahii em calopsita, caracterizando-se pela presença de crostas e áreas
alopécicas na face, membranas patagiais, superfície ventral das asas e região superior dos
membros inferiores, sendo relacionada a hipovitaminose A, causada pela dieta desequilibrada
do animal (GARTRELL et al., 2005).
2.2.2.3. Rhodotorula spp.
As leveduras do gênero Rhodotorula são saprófitas e ubíquas na natureza.
Anteriormente, consideradas espécies não-patogênicos, nas ultimas décadas emergiram como
patógeno oportunistas, particularmente em pacientes imunossuprimidos (WIRTH e
GOLDANI, 2012).
Em humanos, as infecções mais comumente relatadas na literatura são fungemia
associada a cateteres, endocardite, peritonite, meningite, endoftalmite, onicomicose, e as
infecções de próteses articulares (WIRTH e GOLDANI, 2012). Dentre os fatores
predisponentes detacam-se: tumores sólidos e hematológicos em pacientes que receberam
corticosteróides e drogas citotóxicas, a presença de cateteres venosos centrais, o uso de
antibióticos de largo espectro e transplantes (LUNARDI et al., 2006; TUON e COSTA,
2008). As leveduras do gênero Rhodotorula estão entra as espécies não-Candida mais
comumente isoladas de amostras clínicas, sendo R. mucilaginosa e R. glutinis as mais
encontradas (MICELI et al. 2011; WIRTH e GOLDANI, 2012).
Em aves, há poucos relatos na literatura sobre infecção por esse gênero. Em
estudo com galinhas poedeiras em Uganda, foram relatados dois surtos de dermatite
necrosante causada por Rhodotorula spp. (ARUO, 1980). Beemer et al., 1970, relataram a
ocorrência de uma epidemia de dermatite, atingindo a pele do dorso e dos membros inferiores,
29
de frangos, associada ao isolamento de R. mucilaginosa. Os autores demonstraram que era
possível reproduzir os mesmos sinais clínicos e lesões por meio da colocação de grandes
quantidades do fungo, sobre a pele, previamente depenada, em aves sadias.
2.2.2.4. Identificação de leveduras
As leveduras geralmente crescem dentro de 48 horas, sob temperatura entre 25 e
37 °C, em meios micológicos e bacteriológicos comuns (SIDRIM & ROCHA, 2004). A
maioria das leveduras produz colônias glabras, de coloração branca ou bege, textura cremosa
e superfície lisa (SIDRIM & ROCHA, 2004). Candida spp., no geral, apresentam colônias
lisas, úmidas ou secas, de coloração branca ou creme (DE HOOG et al., 2000). Entretanto, a
identificação das espécies requer a realização de testes fenotípicos, abrangendo características
bioquímicas e micromorfológicas.
Inicialmente, deve-se proceder o exame microscópico da colônia crescida através
de preparações com lactofenol azul de algodão (Figura 5-A) ou coloração de Gram, afim de se
confirmar que o isolado se trata de uma levedura (SIDRIM & ROCHA, 2004). Em seguida, é
preciso certificar-se de que a cultura não está contaminada. Além disso, o crescimento em
meio cromogênico para Candida spp. (Figura 5-B) pode ser realizado, com o objetivo de
identificar colônias mistas e de realizar um diagnóstico presuntivo rápido (QUINDÓS et al.,
2001).
Os critérios bioquímicos são de grande importância para a identificação das
leveduras. As cepas de Candida spp. devem ser submetidas às provas de assimilação de
FIGURA 5 - (A): Blastoconidios em preparação com lactofenol azul de algodão. (B): Crescimento de
Candida spp. em meio cromogênico. CEMM, 2013.
A B
30
carboidratos e de nitrogênio (Auxonograma) (Figura 6) e fermentação de carboidratos
(Zimograma) (Figura 7-A), para investigar a capacidade que as leveduras têm de utilizar
fontes diferentes de carbono e nitrogênio inorgânico e de fermentar carboidratos (BRITO et
al., 2009; SIDRIM & ROCHA, 2004). Além disso, provas enzimática podem ser utilizadas,
como a prova da urease em meio uréia de Christensen, que permite a detecção da enzima
através da mudança de coloração do meio por alteração do PH, indentificando à qual divisão
pertence o microorganismo, sendo a divisão Ascomycota (Candida spp. e Saccharomyces
spp.) urease negativa (sem alteração da cor do meio) e a Basidyomycota (Cryptococcus spp.,
Trichosporon spp., Rhodotorula spp., e Malassezia spp.) urease positiva (meio torna-se
rosado) (DE HOOG et al., 2000; SIDRIM & ROCHA, 2004) (Figura 7-B).
CELOBIOSE
SACAROSE
TREALOSE
XILOSE
DEXTROSE
GALACTOSE
MALTOSE
FIGURA 6 – (A): Prova de assimilação de carboidratos (observa-se crescimento no meio onde
a levedura assimilou o carboidrato). (B): Prova de assimilação de nitrogênio (a cepa estudada
não utilizou o nitrato como fonte de nitrogênio, tendo crescimento apenas onde foi assimilado a
peptona). CEMM, 2013.
A B
A B FIGURA 7- (A): Prova de fermentação de carboidratos de Candida spp.
Observa-se a formação de bolha no interior do tubo de Durham (produção de
gás), indicativo de fermentação positiva (seta). (B): Prova da urease (o tubo da
esquerda representa resultado positivo com mudança de coloração do meio,
enquanto o da esquerda é negativo). CEMM, 2013.
31
Posteriormente, a prova do microcultivo possibilita a avaliação micromorfológica
das leveduras em meio ágar-fubá-Tween 80 ou ágar-arroz-Tween 80, pois a incubação das
leveduras em meio com Tween 80 e sob baixa tensão de oxigênio estimula a produção de
conídios e filamentação (Figura 8). Assim, através do estudo da presença e disposição dos
blastoconídios, artroconídios, hifas verdadeiras e pseudo-hifas, juntamente com os dados dos
outros testes realizados anteriormente, é possível sugerir o gênero, ou até mesmo a espécie da
levedura estudada (DE HOOG et al., 2000; SIDRIM & ROCHA, 2012).
B
FIGURA 8- (A): Placa de Microcultivo (B): Leitura de microcultivo de Candida famata, visualização
apenas de blastoconídios. CEMM, 2015.
A
32
3. JUSTIFICATIVA
O presente trabalho visando ao isolamento e caracterização de bactérias e fungos
do trato gastrintestinal e de fezes de guarás e de seu o ambiente, justifica-se pela necessidade
de obtenção de dados acerca dos microrganismos associados à esta espécie, assim como para
elucidar os potenciais riscos a saúde humana e animal e a necessidade de elaboração de planos
saudáveis para a prevenção de eventuais transmissões de zoonoses, tanto para as pessoas que
manejam esses animais, quanto para os visitantes do Parque Mangal das Garças.
4. HIPÓTESES CIENTÍFICAS
1. Aeromonas spp., Vibrio spp., Plesiomonas shigelloides e Candida spp. são parte
integrante da microbiota do trato gastrintestinal de guarás (Eudocimus ruber);
2. Aeromonas spp., Vibrio spp. e Plesiomonas shigelloides estão presentes no ecossistema
aquático onde os guarás vivem;
3. Leveduras estão presentes nos troncos e ocos das árvores dos recintos dos guarás.
33
5. OBJETIVOS
5.1. OBJETIVO GERAL
Com este estudo, pretendeu-se realizar uma análise investigativa detalhada em
cepas de Aeromonas spp., Vibrio spp., Plesiomonas shigelloides e Candida spp. isoladas de
guarás (Eudocimus ruber) mantidos em cativeiro, bem como do ambiente em que vivem,
visando contribuir para o monitoramento da saúde humana e animal.
5.2 OBJETIVOS ESPECÍFICOS
1. Isolar e identificar cepas de Aeromonas spp., Vibrio spp., Plesiomonas shigelloides e
leveduras presentes no trato digestório e fezes de guarás;
2. Isolar e identificar cepas de leveduras do material vegetal presente nos recintos dos
guarás;
3. Isolar e identificar Aeromonas spp., Vibrio spp. e Plesiomonas shigelloides presentes no
ecossistema aquático aos quais os guarás tem acesso;
4. Determinar o perfil de sensibilidade antimicrobiana in vitro pelo método da microdiluição
e pelo método automatizado Vitek 2 das cepas de Aeromonas spp., Vibrio spp. e
Plesiomonas shigelloides;
5. Avaliar os fatores de virulência das cepas de Aeromonas spp.;
6. Determinar o perfil de sensibilidade antifúngica in vitro pelo método da microdiluição e
pelo método automatizado Vitek 2 das cepas de Candida famata.
34
6. CAPITULO 1
Espécies de Aeromonas e Plesiomonas isoladas de guarás (Eudocimus ruber) e de seu
ambiente: monitoramento de sensibilidade antimicrobiana e virulência em um zoológico
Aeromonas and Plesiomonas species from scarlet ibis (Eudocimus ruber) and their
environment: monitoring antimicrobial susceptibility and virulence in a zoological facility
Periódico: Veterinary Microbiology (Submetido em outubro de 2015).
35
Veterinary Microbiology: Original research paper
Aeromonas and Plesiomonas species from scarlet ibis (Eudocimus ruber) and their
environment: monitoring antimicrobial susceptibility and virulence in a zoological
facility
Débora Souza Collares Maia Castelo-Brancob, Aline Lobão da Silvaa, Frederico Ozanan
Barros Monteiroc, Glaucia Morgana de Melo Guedesb, Jamille Alencar Salesa, Jonathas Sales
de Oliveirab, José Erisvaldo Maia Juniora, Stefânia Araújo Mirandad, José Júlio Costa Sidrimb,
Lucas Pereira de Alencara, Raimunda Sâmia Nogueira Brilhanteb*, Rossana de Aguiar
Cordeirob, Tereza de Jesus Pinheiro Gomes Bandeirab,e, Waldemiro de Aquino Pereira Netob,
Marcos Fábio Gadelha Rochaa,b.
aSchool of Veterinary Medicine, Postgraduate Program in Veterinary Sciences, State
University of Ceará, Fortaleza, Ceará, Brazil; bDepartment of Pathology and Legal Medicine,
Postgraduate Program in Medical Microbiology, Federal University of Ceará, Fortaleza,
Ceará, Brazil; cUniversidade Federal Rural da Amazônia – UFRA, Belém, Pará, Brazil;
dParque Mangal das Garças – Belém, Pará, Brazil; eSchool of Medicine, Christus College –
Unichristus, Fortaleza, Ceará, Brazil.
* Corresponding author: Raimunda Sâmia Nogueira Brilhante. Rua Barão de Canindé, 210;
Montese. CEP: 60.425-540. Fortaleza, CE, Brazil. Tel: +55 85 3366 8319; e-mail:
36
Abstract
The initial aim of this study was to recover non-lactose fermenting, oxidase
positive Gram-negative bacilli from stools (n=30) and cloacal samples (n=30) of scarlet ibises
kept in a conservational facility and from water samples (n=30) collected from the
environment where they are kept. Then, the antimicrobial susceptibility of the recovered
Aeromonas spp. and Plesiomonas shigelloides strains was evaluated through microdilution
broth and the virulence of Aeromonas spp. strains was analyzed through the detection of the
virulence associated genes that encode enterotoxin (act), haemolysin (asa1) and type III
secretion system (ascV). Overall, 10 Aeromonas veronii bv. sobria, 2 Aeromonas hydrophila
and 10 Plesiomonas shigelloides were recovered. Resistance to gentamicin was observed in 4
strains of P. shigelloides and intermediate susceptibility to piperacillin-tazobactam and
cefepime was observed in 2 strains of A. veronii bv. sobria and 1 strain of P. shigelloides,
respectively. The most prevalent virulence genes were asa1 and ascV, which were detected in
8/12 and 9/12 strains of Aeromonas spp., respectively. In conclusion, scarlet ibis and the
environment where they live harbor potentially pathogenic bacteria, thus requiring monitoring
and measures to prevent contamination of humans and other animals.
Keywords: Eudocimus ruber; Scarlet ibis; Aeromonas sp.; Plesiomonas shigelloides;
antimicrobial susceptibility; virulence genes
37
Introduction
The scarlet ibis (Eudocimus ruber) is a tactile foraging, colonial wading bird that
breeds in coastal regions and mangroves. Studies on this species are scarce and mainly focus
on their behavioral and reproductive habits, with a lack of data on the health of these animals.
Considering the importance of birds as host and carriers of potentially pathogenic bacteria,
studying the bacterial microbiota of clinically healthy wild birds is important to understand
the epidemiology of bacterial diseases that can affect not only birds themselves but also other
animals and humans (Kim et al., 2015).
Among the bacteria with zoonotic importance, Aeromonas spp. and Plesiomonas
shigelloides are highlighted, which are found in a wide variety of habitats. These
microorganisms have been described as components of the microbiota of ectothermic animals
and waterfowl and are reported as fish and human pathogens, causing waterborne diseases
(Krovacek et al., 2000; Hirsch et al., 2006; Janda and Abbott, 2010; Kim et al., 2015).
Studies have reported the ability of Aeromonas spp. to cause infections in birds, as
primary or opportunistic pathogens, causing sepsis (França et al., 2009), conjunctivitis
(García et al., 1992), purulent rhinitis (Collarile et al., 2013) and necrotizing enteritis (França
et al., 2009). Likewise, P. shigelloides has been described as the cause of sepsis in waterfowl
(Nimmervoll et al., 2011).
In humans, Aeromonas spp. and P. shigelloides can cause enteric infections
characterized by acute diarrhea, particularly in infants and elderly after the consumption of
contaminated water or food, or extraintestinal infections affecting several internal organs as
well as the skin and soft tissues. These infections are more commonly described in food
handlers and aquaculture professionals (Janda and Abbott, 2010; Parker and Shaw, 2011).
The pathogenesis of Aeromonas infections involves the ability of this pathogen to
produce several virulence factors, such as hemolysin, enterotoxin, and type III secretion
38
system, including strains recovered from animals and water sources (Castelo-Branco et al.,
2015). On the other hand, virulence factors of P. shigelloides have not been fully elucidated,
however the presence of plasmids, cytolysins, hemolysin, and adhesins has been reported
(González-Rey, 2003).
Therefore, initially the present study aimed to isolate non-lactose fermenting,
oxidase positive Gram-negative bacilli, suggestive of Aeromonas spp., Vibrio spp., and
Plesiomonas spp. from stools and cloacal material obtained from captive scarlet ibis
(Eudocimus ruber) and from water samples collected from the environment where they are
kept. Then, the susceptibility of Aeromonas spp. and P. shigelloides was assessed through
broth microdilution and the virulence of Aeromonas spp. was evaluated through conventional
PCR.
Material and Methods
- Ethics
This project was approved by the Authorization and Information System for
Biodiversity (SISBIO) of the Chico Mendes Institute for Conservation of Biodiversity
(ICMBio, Brazil), under the license No. 45009-1. It was also approved by the Ethics
Committee for the Use of Animals (CEUA) of the State University of Ceará, under the
protocol number 4797437/2014.
- Animal handling
For the isolation of microorganisms, cloacal and stool samples were collected
from scarlet ibis (Eudocimus ruber) kept captivity at Parque Mangal das Garças, located in
Belém, State of Pará, Brazil (S: 1°27'51.9" and W: 48°30'19.9"). All animals were clinically
evaluated and their body score was assessed by palpating the pectoral muscles, classifying
them as obese, normal or thin (Ritchie et al., 1994). Animals that were considered ill and/or
39
those that were classified as obese or thin were not sampled for this research. Three sample
collections were carried out with an interval of one month between them. In each collection,
10 animals (30 animals in total) were randomly captured with pole nets to collect biological
material. These animals were kept in three enclosures. In the enclosure of Aningas (Sector 1),
a closed and collective enclosure, scarlet ibises cohabit with other species and are fed with
fish and specific extruded bird ration for ibises and flamingoes. On the island of scarlet ibises
(Sector 2), scarlet ibises live in semi-freedom along with other bird species and they receive
only extruded feed. In the extra sector (Sector 3), where the surplus scarlet ibises of the Park
intended for exchange with other zoos are kept, the birds receive only extruded feed. All three
enclosures had a water tank/ponds and a proper ambiance to provide well-being and stimulate
reproduction and nesting. All animals were daily assisted by a veterinarian and a biologist.
- Collection of biological material
The biological material from the cloaca of scarlet ibises was collected with sterile
cotton swabs, which were inserted and rotated 180 degrees twice (Silva et al., 2004).
Afterwards, the swabs were placed in Cary Blair transport medium, widely used for the
transport and preservation of stool specimens for microbiological processing (Silva et al.,
2004). A pool of dry stool samples found where the birds were grouped was also collected,
through scraping with a sterile scalpel blade and were stored in sterile sample cups (Filiú et
al., 2002).
- Collection of water
There are two artificial lakes at Parque Mangal das Garças, which receive water
from the Guamá River, and the island of scarlet ibises is located in the middle of the lakes.
Water samples were collected from 10 different points of the lakes in each collection moment.
For this purpose, sterile Falcon tubes were used, dipped rapidly from 15 to 30 cm below the
water surface. When removing the filled tube, a small portion of the sample was discarded,
40
leaving an empty space to allow water homogenization for analysis. The tube was
immediately sealed with plastic film around the lid, and kept refrigerated until processing
(Castelo-Branco et al., 2015).
- Sample processing
All cloacal and water samples were kept under refrigeration and transported in a
thermal styrofoam box to the Laboratory of Emerging and Re-emerging Pathogens
(LAPERE) of the Federal University of Ceará for microbiological processing, within 24 hours
after sampling.
Swabs containing cloacal material were transferred to tubes with 1 mL of sterile
saline (0.9% NaCl), homogenized by vortexing for 3 minutes and left to decant for 30 minutes
at room temperature (Filiú et al., 2002).
The dried stool samples were initially weighed and hydrated with sterile saline
(0.9% NaCl), according to the ratio of 1g of feces for 10 mL of saline. Subsequently, the
material was well homogenized through vortexing for 3 minutes and left to decant for 30
minutes at room temperature (Filiú et al., 2002).
The processing of water samples was performed in duplicate distributing 2500 μL
in each tube. Then, these aliquots were subjected to centrifugation at 3000 rpm for 20
minutes. After centrifugation, 2000 μL of supernatant from each tube was discarded and the
remaining volume of the tubes were mixed and sterile saline (0.9% NaCl) was added to reach
a final volume of 2000 μL. The solution was homogenized by vortexing and left to decant for
30 minutes at room temperature (Medeiros, 2008). Subsequently, 10-μL-aliquots of the
supernatant from each cloacal and water samples were seeded in duplicate in Petri dishes
containing the following culture media: MacConkey agar and TCBS (thiosulphate citrate bile
and sucrose). The seeded plates were incubated at 35 ºC for a period of 24-48 h.
41
- Bacterial Isolation and identification
The colonies grown on the agar plates were counted and non-lactose fermenting
colonies on MacConkey medium were selected for screening, as well as the colonies grown
on TCBS medium.
First, a Gram stain of the selected colonies was performed to ensure that they
were Gram negative bacilli. Subsequently, they were submitted to cytochrome oxidase test,
for the selection of the oxidase positive strains, since Aeromonas spp., Vibrio spp. and
Plesiomonas shigelloides are oxidase producers (Koneman et al., 2012). The selected strains
were submitted to biochemical screening tests, such as glucose fermentation, urease
production, indole production and motility. P. aeruginosa ATCC 27853 and E. coli ATCC
25922 were used as quality control for the biochemical tests. Importantly, the screening was
performed based on established identification keys, following specific methodology for
Aeromonas spp., Vibrio spp. and P. shigelloides (Koneman et al., 2012; Castelo-Branco et al.,
2015).
After the biochemical screening, the strains were subjected to automated
biochemical identification using the Vitek 2 system (bioMerieux) with Gram-negative bacilli
identification cards (Koneman et al., 2012).
- Broth microdilution in vitro susceptibility testing
Antimicrobial drugs used for the in vitro susceptibility testing were selected based
on the document M45-A2 (CLSI, 2010), which determines the appropriate drugs to be tested
against Aeromonas spp. and Plesiomonas shigelloides, and the following drugs were used:
piperacillin-tazobactam, cefepime, ceftazidime, meropenem, gentamicin and ciprofloxacin
(Sigma Chemical Corporation, USA).
The minimum inhibitory concentration (MIC) for strains of Aeromonas spp. and
P. shigelloides was determined through broth microdilution, as described by the document
42
M07-A9 of the Clinical Laboratory Standards Institute (CLSI, 2012). The microdilution test
was performed in 96-well polystyrene plates and carried out in Mueller-Hinton broth (Difco,
USA) with a final bacterial inoculum of 5x105 UFC/mL (CLSI, 2010).
Drug-free and bacterium-free wells were used as positive and negative controls,
respectively. The plates were incubated at 35 °C for 18-20 h (CLSI, 2012). The reading of the
results was done by observing the lowest concentration of the drug capable of inhibiting
100% of bacterial growth. The isolates were classified as susceptible (S), intermediate (I) and
resistant (R), according to M45-A2 document (CLSI, 2010). Escherichia coli ATCC 25922
and Escherichia coli ATCC 35218 were included in each test, as quality control (CLSI,
2010).
- Susceptiblity testing using Vitek 2 system
Strains of Aeromonas spp. and P. shigelloides were first subcultured on BHI agar
and incubated at 35 ºC overnight, Then, the cells were transferred to a tube with saline (0.45%
NaCl) to prepare a homogeneous solution with turbidity of 0.50 to 0.63. An aliquot of 145 uL
of the first inoculum was transferred to a tube containing 3 ml of saline (0.45% NaCl).
Finally, the tube was placed beside the antimicrobial susceptibility card N-239 (bioMérieux)
and placed in the equipment (Castelo-Branco et al., 2015). Escherichia coli ATCC 25922 and
Escherichia coli ATCC 35218 were included as quality control (CLSI, 2010).
- Detection of virulence genes of Aeromonas spp. encoding for type III secretion system,
hemolysin and enterotoxin
Strains of Aeromonas spp. were initially cultured on BHI agar at 37 °C for 24 h.
Subsequently, an isolated colony was selected and subcultured on BHI agar, following the
same incubation conditions. DNA extraction was performed using a Wizard Genomic DNA
Purification Kit (Promega, USA), according to the manufacturer's instructions. After DNA
43
extraction, DNA samples were stored at 4 °C (CLSI, 2005). The concentration and purity of
extracted products were measured by optical density at 260 nm and 280 nm by
spectrophotometry and fluorimetry using Qubit® (Invitrogen, Carlsbad, USA).
The detection of virulence factors was performed by conventional PCR using
primers designed for Aeromonas spp. In order to detect the genes encoding enterotoxin (act),
haemolysin (asa1), and type III secretion system (ascV) in strains of Aeromonas spp., the
following primers were used: (5’-3’) act_F - AGAAGGTGACCACCAAGAACA and act_R -
AACTGACATCGGCCTTGAACTC (Kingombe et al., 1999), asa-1_F -.
TAAAGGGAAATAATGACGGCG and asa-1_R - GGCTGTAGGTATCGGTTTTCG
(Wang et al., 2003), and ascV_F-CTCGAACTGGAAGAGCAGAATG and ascV_R -.
GAACATCTGGCTCTCCTTCTCGATG (Martino et al., 2011).
PCR amplification was performed in a final volume of 25 μL containing: 2.95 μL
Mili Q water, 5 μL GoTaq 1X Buffer, 5 μL MgCl2, 2.5 μL of each primer, 5 μL of each
deoxynucleoside triphosphate (dNTP), 0.05 μL GoTaq polymerase (Promega) and 2 μL of
genomic DNA. The PCR conditions were performed according to the protocol described by
Martino et al. (2011), with an initial denaturation of 2 min at 94 ºC followed by 35 cycles of
20 s at 94 ºC, 30 s at 56 °C for the genes asa1 and act and 60 °C for ascV gene, 50 s at 72 °C
and a final extension at 72 ºC for 7 min.
For visualization of the PCR products, agarose gel was prepared in Tris-Borate
EDTA buffer (TBE) 1X at a concentration of 1.8%. In each well a solution containing 10 µL
of the amplicon and 1 µL of the intercalating fluorophore BLU GREEN was added. The
markers were used in a volume of 5 µL added to 1 µL of the fluorophore. The electrophoretic
run was performed at 100V for 1 h. After the run, the gel was visualized under ultraviolet
transilluminator at wavelength of 302 nm (Martino et al. 2011, with modifications). The
products relating to the genes act (enterotoxin), asa1 (hemolysin) and ascV (type III secretion
44
system) generated bands of 232 bp, 249 bp and 577 bp, respectively. The determination of the
molecular weight of the obtained bands was performed by comparison with a molecular
weight marker of 100 bp. As positive control, a strain of A. hydrophila whose genes have
been previously detected was included in the tests, and as negative control PCR Mix without
DNA sample was used.
- Statistical analysis
In order to compare categorical data between species and the presence of
virulence genes, the chi-square test of Pearson and Fisher's exact test were applied. For
summarizing the data of the minimum inhibitory concentration, the geometric mean and 50th
and 90th percentiles were calculated. Mann Whitney test was used for the comparison of the
antimicrobial MIC values against Aeromonas spp. and P. shigelloides strains. In all cases, the
minimum significance level adopted for affirmative findings was 5%.
Results
- Isolation and identification of Aeromonas spp. and Plesiomonas shigelloides
The results regarding isolation and identification are presented in Table 1. Eleven
bacteria of interest were recovered from the first 30 samples (cloacal swab=10; water=10;
stool=10): 4 P. shigelloides, 6 Aeromonas veronii bv. sobria and 1 Aeromonas hydrophila. At
the second collection moment (cloacal swab=10; water=10; stool=10), 7 bacteria of interest
were recovered: 5 P. shigelloides and 2 A. veronii bv. sobria. As for the third collection
(cloacal swab=10; water=10; stool=10), 4 bacteria were isolated: A. veronii bv. sobria (n=2),
A. hydrophila (n=1) and P. shigelloides (n=1). The highest number of isolates was obtained
from water samples (15/22), followed by cloacal samples (7/22). No bacteria of interest, i.e.
lactose fermenting, oxidase positive Gram-negative bacilli, were recovered from stool
45
samples. Aeromonas spp. were more prevalent in water samples, while P. shigelloides was
more frequently recovered from cloacal samples (P=0.0031) than water. Vibrio spp. were not
recovered in this research.
- In vitro susceptibility testing using broth microdilution
The minimum inhibitory concentrations of the drugs against strains of Aeromonas
spp. and P. shigelloides are shown in Table 2. All strains of Aeromonas spp. were susceptible
to ceftazidime, cefepime, meropenem, ciprofloxacin and gentamicin. Most isolates were
susceptible to piperacillin-tazobactam, except for two strains of Aeromonas veronii bv.
sobria, which presented intermediate susceptibility to these drugs (MIC: 32/4 µg/mL).
Concerning P. shigelloides, all strains were susceptible to ceftazidime,
meropenem, ciprofloxacin and piperacillin-tazobactam. Four strains of this species were
resistant to gentamicin (MIC: 16 µg/mL), of which two were from water and two from the
cloaca of scarlet ibis, and two presented intermediate susceptibility (MIC: 8 µg/mL) to this
drug, one strain from water and the other from cloacal samples. Furthermore, it was observed
that a gentamicin resistant strain from water showed intermediate susceptibility to cefepime
(MIC: 16 µg/mL).
Gentamicin showed higher MIC values against P. shigelloides, when compared to
the values obtained against Aeromonas spp. (P=0.001), whereas piperacillin-tazobactam
(P=0.002), ceftazidime (P=0.0188) and meropenem (P=0.0072) showed higher MIC values
against Aeromonas spp. than those obtained against P. shigelloides.
- Susceptibility testing using Vitek 2 system
The results of the susceptibility testing of strains of Aeromonas spp. and P.
shigelloides using Vitek 2 are displayed in Table 2. All strains of Aeromonas spp. (n=12)
were classified as susceptible to ceftazidime, cefepime, ciprofloxacin and gentamicin.
Resistance to piperacillin-tazobactam (MIC: ≥128) was observed in five strains (4 A. veronii
46
bv. sobria and 1 A. hydrophila), while resistance to meropenem (MIC: ≥16) was observed in
six strains (4 A. veronii bv. sobria; 2 A. hydrophila) of this bacterial genus. The other
Aeromonas strains were classified as susceptible to these drugs.
Concerning P. shigelloides, all strains (n=10) were susceptible to piperacillin-
tazobactam, ceftazidime, cefepime, meropenem and ciprofloxacin, while three strains from
water showed intermediate susceptibility to gentamicin.
- Detection of virulence genes of Aeromonas spp. through PCR
The detection of a single virulence gene was observed in three strains of A.
veronii bv. sobria (1/12 act, 1/12 asa1 and 1/12 ascV), while the occurrence of more than one
gene was observed in 8 strains (6 A. veronii bv. sobria and 2 A. hydrophila). The ascV gene
(type III secretion system) was the most detected virulence gene in Aeromonas spp.
(P=0.0391), which was observed in 7 A. veronii bv. sobria and 2 A. hydrophila. As for the
asa1 gene (hemolysin), its presence was confirmed in 7 A. veronii bv. sobria and 1 A.
hydrophila, while the act gene (enterotoxin) was detected in 1 A. veronii bv. sobria and 2 A.
hydrophila (Table 3).
Regarding the detection of more than one virulence gene per strain, the most
frequent combination was ascV and asa1 (P=0.0107), detected in 6 A. veronii bv. sobria. The
combination act and ascV was detected 1 A. hydrophila, while the combination act and asa1
was not observed in the tested strains. Only one strain of A. hydrophila simultaneously
showed the 3 virulence genes, and one strain of A. veronii bv. sobria did not show any of the
tested genes.
47
Discussion
The genera Aeromonas spp., Vibrio spp. and Plesiomonas spp. have been
described as components of the microbiota of ectothermic animals and birds and are
considered potentially pathogenic for these animals and humans, causing waterborne diseases
or infections by traumatic inoculation (Hirsch et al., 2006; Janda and Abbott, 2010; Kim et al.,
2015). These facts reinforce the importance of monitoring different aquatic environments for
the presence of these microorganisms and their pathogenic potential and antimicrobial
susceptibility. Thus, the active search for Aeromonas spp., Vibrio spp. and P. shigelloides in
scarlet ibis and the environment where they live was idealized. In this study, Aeromonas spp.
were isolated from water samples and P. shigelloides was isolated from water and cloacal
samples obtained from scarlet ibis. These bacteria were not recovered from stool samples,
possibly because they were desiccated, since these microorganisms have been recovered from
fresh stools (Kim et al., 2015). Furthermore, Vibrio spp. were not isolated in the present
research.
The isolation of Aeromonas spp. from water samples corroborates the results of
other authors who obtained high recovery rates for this bacterial genus from aquatic samples
(Hirsch et al., 2006; Castelo-Branco et al., 2015). In a previous study of our research group,
for example, A. hydrophila, A. veronii bv. sobria, A. veronii bv. veronii and A. caviae were
isolated from a pond and from shrimp farming water (Castelo-Branco et al., 2015).
P. shigelloides was isolated from seven cloacal samples of scarlet ibis, similar to
what was observed by Donald (1981), who recovered this bacterium from turkey vultures
(Cathartes aura). These results demonstrate that scarlet ibis can act as reservoirs of this
pathogen, which may possibly be associated with their feeding habits, which include fish and
crustaceans. Regarding lake water, P. shigelloides was recovered from three of the collected
48
samples, similar to what was observed by Krovacek et al. (2000) and González-Rey et al.
(2003), demonstrating that this species is easily found in aquatic environments.
It is worth highlighting that water is the major source of contamination with
Aeromonas spp. or P. shigelloides, as demonstrated by Kim et al. (2015), who obtained a
higher recovery rate for these microorganisms from aquatic environments than from stool
samples collected in a zoo. Moreover, a study on wild birds showed that the isolation rate of
A. hydrophila from waterfowl (18.5%) is higher than that from terrestrial birds (3.4%),
supporting the idea that water is a vehicle for the spread of this microorganism (Glunder and
Siegmann, 1989).
Water sources also contribute for the environmental dissemination of
antimicrobial drugs that are indiscriminately used in farming practices, such as aviculture and,
especially, aquaculture, which leads to the widespread development of antimicrobial
resistance among bacteria (Hirsch et al., 2006). The emergence of resistant bacterial strains
represents a public health problem worldwide, hence, the antimicrobial susceptibility of
bacteria should be monitored (Nascimento et al., 2003). Therefore, one of the objectives of
this study was to evaluate the in vitro antimicrobial susceptibility of the recovered strains of
Aeromonas spp. and P. shigelloides through the standardized broth microdilution method. The
results showed resistance to gentamicin and intermediate susceptibility to cefepime in strains
of P. shigelloides and intermediate susceptibility to piperacillin-tazobactam in strains of A.
veronii bv. sobria. These data on intermediate susceptibility serve as a warning to monitor the
emergence of resistant strains (Souza et al., 2010). Resistance to gentamicin and other
aminoglycosides in strains of P. shigelloides has also been reported in other studies (Kain and
Kelly, 1989; Clark et al., 1990; Wiedemann, 2001).
Additionally, the antimicrobial susceptibility was also assessed through the Vitek
2 system, using the same strains tested through broth microdilution. A 100% agreement
49
between microdilution and Vitek 2 was observed for 12 Aeromonas spp. strains that were
susceptible to ceftazidime, cefepime, ciprofloxacin, and gentamicin, as well as 10 strains of P.
shigelloides that were susceptible to piperacillin-tazobactam, ceftazidime, ciprofloxacin, and
meropenem. Disagreements between both methods were observed for piperacillin-tazobactam
and meropenem in 5/12 and 6/12 strains of Aeromonas spp., respectively, with the automated
system classifying these strains as resistant to both drugs, while broth microdilution
characterized two of them as presenting intermediate susceptibility to piperacillin-tazobactam
and the remaining isolates as susceptible to both drugs. For P. shigelloides, discrepancies
were observed in the results obtained for gentamicin against 5/10 strains, of which two that
were identified as having intermediate susceptibility through Vitek 2 system were classified
as resistant through broth microdilution and 3 strains classified as susceptible through Vitek 2
system were classified as intermediate susceptibility (n=1) and resistant (n=2) through broth
microdilution. In addition, 1/10 strain of P. shigelloides was considered susceptible to
cefepime through Vitek 2 system, but presented intermediate susceptibility to this drug when
tested through broth microdilution. Such discrepancies have been described by other authors,
but with different bacterial species (Bulik et al., 2010). Despite these disagreements between
the two techniques, no statistically significant differences were observed between them.
Finally, it is worth emphasizing that broth microdilution is the gold standard method for
antimicrobial susceptibility testing, as recommended by CLSI.
In this research, virulence factors of Aeromonas spp. were also investigated using
conventional PCR. The ascV and asa1 genes were the most frequently detected genes, mainly
in A. veronii bv. sobria, supporting the findings of previous researches (Aravena-Román et
al., 2014; Wang et al., 2003). On the other hand, in this research, act gene had a low
prevalence and was detected alone in 1 strain of A. veronii bv. sobria and in association with
ascV and ascV+asa1 in A. hydrophila. The detection of the act gene in Aeromonas spp. in this
50
study corroborates previous works with environmental strains (Ottaviani et al., 2011; Castelo-
Branco et al., 2015).
Even though, the role of these genes in strains of Aeromonas spp. from
environmental sources has not been fully elucidated, it is known that the type III secretion
system (ascV) acts by injecting effector proteins directly into the cytosol of host cells,
inducing lysis and contributing to tissue degradation (Parker and Shaw, 2011); the haemolysin
(asa1) causes reversible cytotoxic effects and incomplete lysis of erythrocytes and creates
pores on the cell membrane (Galindo et al., 2006); and enterotoxin (act) possesses
enterotoxigenic, haemolytic and cytotoxic activities (Sha et al., 2002).
As for P. shigelloides, to our knowledge, no specific primers have been developed
for the PCR-based detection of virulence genes. Instead, only phenotypical identification and
analyses have been performed (Fariñas et al., 2005). Because of the high similarity between
Aeromonas spp. and P. shigelloides, the same primers used for the detection of the act, asa1
and ascV in Aeromonas spp. were tested with P. shigelloides. However, it was observed that
none of the PCR products had DNA bands compatible with the size expected for the virulence
genes (act 232 bp; asa1 249 bp and ascV 577 bp). Thus, we confirm the identification
performed by the Vitek 2 system and the specificity of these primers to the strains of
Aeromonas spp.
With this work, it is concluded that the scarlet ibises and their environment may
harbor potentially pathogenic bacteria that may pose risks to humans and other animals.
Hence, these birds and their environments should be continuously monitored for the presence
of these microorganisms and measures for the prevention of infections should be implemented
in order to minimize the zoonotic risks for humans who handle these animals and visitors of
zoological facilities.
51
Conflicts of interest: None.
Acknowledgements
This work was supported by the National Council for Scientific and
Technological Development (CNPq; Brazil; process: 445670/2014-2) and Coordination
Office for the Improvement of Higher Education Personnel (CAPES; Brazil,
Procad/Casadinho; process: 552215/2011-2). We thank Parque Mangal das Garças for
allowing the performance of this research in their facility.
52
Table 1: Isolation and identification of Aeromonas spp. and Plesiomonas shigelloides.
Isolation
Collection
Origin and
Site
(n)
Gram
negative /
Non-lactose
fermenting
Oxidase
producer
Screening for
Aeromonas
spp. and P.
shigelloides
Vitek 2 identification
(n)
1st
Cloaca
(n=10)
22
9 4 P. shigelloides (4)
Stool (n=10) 24 2 0 -
Water
(n=10) 13 8 7
A. veronii bv. sobria =6)
A. hydrophila (1)
2nd
Cloaca
(n=10) 50 20 3 P. shigelloides (3)
Stool (n=10) 33 0 0 -
Water
(n=10) 25 5 4
A. veronii bv. sobria (2)
P. shigelloides (2)
3nd
Cloaca
(n=10) 22 2 0
-
Stool (n=10) 27 3 0 -
Water
(n=10) 21 15 4
A. veronii bv. sobria (2)
A. hydrophila (1)
P. shigelloides (1)
Total 22
(-) no isolated strains
53
Table 2 In vitro antimicrobial susceptibility of Aeromonas spp. and Plesiomonas shigelloides using broth microdilution and Vitek 2 system.
MIC
Drugs Profile
A. veronii bv. sobria
(n=10)
A. hydrophila
(n=2)
P. shigelloides
(n=10) Aeromonas spp. (n=12) P. shigelloides (n=10)
Broth
microdilution
(µg/mL)
Vitek 2
Broth
microdilution
(µg/mL)
Vitek 2
Broth
microdilution
(µg/mL)
Vitek 2 Geometric
mean MIC50 MIC90
Geometric
mean MIC50 MIC90
PTZ
S
I
R
0.5/4- 8/4 (8)
32/4 (2)
-
ND (1)
≤4 (5)
-
≥128 (4)
2/4 - 8/4 (2)
-
-
≤4 (1)
-
≥128 (1)
0.03125/4 - 2/4
(10)
-
-
≤4 (10)
-
-
3.0/4 1.5/4 32/4 0.1/4 0.0625
/4 1.9/4
CAZ
S
I
R
0.0625 - 0.25 (10)
-
-
≤1 (10)
-
-
0.25 - 1 (2)
-
-
≤1 (2)
-
-
0.015625 - 4
(10)
-
-
≤1 – 8(10)
-
-
0.15 0.1250 0.7750 0.05 0.0156
3 3.7
FEP
S
I
R
0.0625 - 1 (10)
-
-
≤1 (10)
-
-
0.0625 - 0.125
(2)
-
-
≤1 (2)
-
-
0.00390625 - 4
(9)
16 (1)
-
≤1 – 8(10)
-
-
0.09 0.0625 0.7750 0.05 0.0117
2 14.80
MEM
S
I
R
0.0078125 - 0.5
(10)
-
-
≤0.25 (6)
-
≥16 (4)
0.25 - 1 (2)
-
-
-
-
≥16 (2)
0.015625 (10)
-
-
≤0.25 (10)
-
-
0.09 0.0937
5 0.85 0.02
0.0156
3
0.0156
3
CIP
S
I
R
0.0009765625 -
0.0078125 (10)
-
-
≤0.25 (10)
-
-
0.00390625- 1
(2)
-
-
≤0.25 – 0.5 (2)
-
-
0.001953125 -
0.0078125 (10)
-
-
≤0.25 -0.5 (10)
-
-
0.004 0.0029
30 0.7023 0.002
0.0019
53
0.0074
22
GEN
S
I
R
1 - 2 (10)
-
-
1 – 2 (10)
-
-
2 - 4 (2)
-
-
2 – 4 (2)
-
-
4 (4)
8 (2)
16 (4)
2 – 4 (7)
8 (3)
-
1.6 2 3.4 8 8 16
(-) no strain / ND: no data in the system / PTZ: Piperacillin-tazobactam / CAZ: Ceftazidime / FEP: Cefepime / MEM: Meropenem / CIP: Ciprofloxacin / GEN:
Gentamicin / S: susceptible / I: intermediate / R: resistant / Geometric mean, MIC50, MIC90 were calculated for the MIC values obtained through broth
microdilution.
54
Table 3: Frequency distribution of virulence genes in Aeromonas spp.
Origin Species (n)
Gene frequency
act asa1 ascV
act
+asa
1
act
+asc
V
ascV+as
a1
act+asc
V+asa1
Non
e
Water A. veronii bv. sobria
(10) 1 1 1 - - 6 - 1
Water A. hydrophila (2) - - - - 1 - 1 -
Total 1/12 1/12 1/12 0/12 1/12 6/12 1/12 1/12
(-) No detection / act: cytotoxic enterotoxin / asa1: hemolysin / ascV: type III secretion system.
55
References
Aravena-Román, M., Inglis, T.J.J., Henderson, B., Rilley, T.V., Chang, B.J., 2012.
Antimicrobial susceptibilities of Aeromonas strains isolated from clinical and environmental
sources to 26 antimicrobial agents. Antimicrob. Agents Chemoter. 569, 1110–1112.
Bulik, C.C., Fauntleroy, K.A., Jenkins, S.G., Abuali, M., LaBombardi, V.J., Nicolau, D.P.,
Kuti, J.L., 2010. Comparison of meropenem MICs and susceptibilities for carbapenemase-
producing Klebsiella pneumonia isolates by various testing methods. J. Clin. Microbiol. 48,
2402–2406.
Castelo-Branco, D.S.C.M, Guedes, G.M.M, Brilhante, R.S.N, Rocha, M.F.G, Sidrim, J.J.C,
Moreira, J.L.B., Cordeiro, R.A., Sales, J.A., Riello, G.B., Alencar, L.P., Paiva,
M.A., Vasconcelos, D.C., Menezes, ISIS, Ponte, Y.B., Sampaio, C.M., Monteiro,
A.J., Bandeira, T.J, 2015. Virulence and antimicrobial susceptibility of clinical and
environmental strains of Aeromonas spp. from Northeastern Brazil. Can. J. Microbiol. 61,
597–601.
Clark, R.B., Lister, P.D., Arneson-Rotert, L., Janda, J.M., 1990. In vitro susceptibilities of
Plesiomonas shigelloides to 24 antibiotics and antibiotic-b-lactamase-inhibitor combinations.
Antimicrob. Agents Chemother. 34, 159–160.
CLSI (2005). Collection, Transport, Preparation, and Storage of Specimens for Molecular
Methods. CLSI document MM-13-A. Wayne, PA: Clinical and Laboratory Standards Institute.
CLSI (2010). Clinical and Laboratory Standards Institute, M45-A2 Methods for
Antimicrobial Dilution and Disk Susceptibility Testing of Infrequently Isolated or Fastidious
Bacteria; Approved Guideline-Second Edition. Wayne, PA: Clinical and Laboratory
Standards Institute.
CLSI (2012). Clinical Laboratory Standards Institute. Methods for Dilution Antimicrobial
Susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard - Nineth Edition.
Document M07-A9. Wayne, PA: Clinical and Laboratory Standards Institute.
Collarile, T., Girolamo, N.D., Selleri, P., Melidone, R., 2013. Mucus accumulation and
necrosis of the ventral air pouch in a marabou stork (Leptoptilos crumeniferus) with
productive rhinitis. J. Avian Med. Surg. 27, 222–226.
Donald, K.W., Allan, P.B., John, J.M., 1981. Gram-negative, aerobic, enteric pathogens
among intestinal microflora of wild turkey cultures (Cathartes aura) in West Central Texas.
Appl. Environ. Microbiol. 42, 1123–1124.
Fariñas, L.B., Noblet, D.S., Arce, M.A., García, H., Ramírez, M., Cabrera, L.E., Fernández,
T.A., Castañeda, T.N., 2005. Estudio de factores de virulencia en cepas de Plesiomonas
shigelloides aisladas de animales domésticos y afectivos (Study of virulence factors in
Plesiomonas shigelloides isolated from domestic and affective animals). Rev. Electrónica Vet.
10, 1–12.
56
Filiú, W.F.O.F., Wanke, B., Agüena, S.M., Vilela, V.O., Macedo, R.C.L., Lazera, M., 2002.
Cativeiro de aves como fonte de Crytococcus neoformans na cidade de Campo Grande, Mato
Grosso de Sul, Brasil. Rev. Soc. Bras. Med. Trop. 35, 591–595.
França, M., Walker, R.L., Kokka, R., Shivaprasad, H.L., 2009. Aeromonas species associated
with necrotizing enteritis and septicemia in an adult male ostrich (Struthio camelus). Avian
Dis. 53, 310–316.
Galindo, C.L., Sha, J., Fadl, A.A., Pillai, L.L., Chopra, A.K., 2006. Host immune responses to
Aeromonas virulence factors. Curr. Immunol. Rev. 2, 13–26.
García, M.E., Doménech, A., Domínguez, L., Ramiro, F., Fernández-Garayzábal, J.F., 1992.
Aeromonas hydrophila conjunctivitis in a pet parrot (Amazona versicolor). Avian Dis. 36,
1110–1111.
Glunder, G., Siegmann, O., 1989. Occurrence of Aeromonas hydrophila in wild birds. Avian
Pathol. 18, 685–695.
González-Rey, C., Svenson, S.B., Eriksson, L.M., Ciznar, I., Krocacek, K., 2003.
Unexpected finding of the "tropical" bacterial pathogen Plesiomonas shigelloides
from lake water north of the Polar Circle. Polar Biol. 26, 495–499.
Hirsch, D., Pereira Júnior, D.J., Piccoli, R.H., Logato, P.V.R., Figueiredo, H.C.P., 2006.
Identificação e resistência a antimicrobianos de espécies de Aeromonas móveis isoladas de
peixes e ambientes aquáticos. Ciênc Agrotec. 30, 1211–1217.
Janda, J.M., Abbott, S.L., 2010. The genus Aeromonas: taxonomy, pathogeniticy and
infection. Clin. Microbiol. Rev. 23, 35–73.
Kain, K.C., Kelly, M.T., 1989. Clinical features, epidemiology, and treatment of Plesiomonas
shigelloides diarrhea. J. Clin. Microbiol. 27, 998–1001.
Kim, K., Lee, S., Kwak, D., 2015. Prevalence, biochemical characteristics, and antibiotic
susceptibility of Aeromonas, Vibrio, and Plesiomonas isolated from different sources at a
Zoo. J. Zoo Wildl. Med. 46, 298–305.
Kingombe, C.I.B, D’Aoust, J.Y., Huys, G., Hofmann, L., Rao, M., Kwan, J. 1999. Pcr
cetection, characterization, and distribution of virulence genes in Aeromonas spp. Applied and
Environmental Microbiology. 65, 5293-5302.
Koneman E.W., Winn W.C., Allen S.D., Janda W.M., Procop G.W., Schreckenberger P.C.,
Woods, G.J., 2012. Diagnóstico Microbiológico: texto e atlas colorido. Guanabara Koogan,
Rio de Janeiro, Brazil.
Krovacek, K., Eriksson, L.M., González-Rey, C., Rosinsky, J., Ciznar, I., 2000. Isolation,
biochemical and serological characterisation of Plesiomonas shigelloides from freshwater in
Northern Europe. Comp. Immunol. Microbiol. Infect. Dis. 23, 45–51.
Martino, M.E., Fasolato, L., Montemurro, F., Rosteghin, M., Manfrin, A., Patarnello, T.,
Novelli, E., Cardazzo, B., 2011. Determination of microbial diversity of Aeromonas strains on
57
the basis of multilocus sequence typing, phenotype, and presence of putative virulence genes.
Appl. Environ. Microbiol. 77, 4986–5000.
Medeiros, A.O., Kohler, L.M., Hamdan, J.S., Missagia, B.S., Barbosa, F.A., Rosa, C.A.,
2008. Diversity and antifungal susceptibility of yeasts from tropical freshwater environments
in Southeastern Brazil. Water Res. 42, 3921–3929.
Nascimento, A.M.A., Cursino, L., Gonçalves-Dornelas, H., Reis, A., Chartone-Souza, E.,
Marini, M.A., 2003. Antibiotic-resistant gram-negative bacteria in birds from the Brazilian
Atlantic Forest. The Condor 105, 358–361.
Nimmervoll, H., Wenker, C., Robert, N., Albini, S., 2011. Septicaemia caused by
Edwardsiella tarda and Plesiomonas shigelloides in captive penguin chicks. Schweiz. Arch.
Tierheilkd 153, 117–121.
Ottaviani, D., Parlani, C., Citterio, B., Masini, L., Leoni, F., Canonico, C., Sabatini, L.,
Bruscolini, F., Pianetti, A., 2011. Putative virulence properties of Aeromonas strains isolated
from food, environmental and clinical sources in Italy: A comparative study. Int. J. Food
Microbiol. 144, 538–545.
Parker, J.L., Shaw, J.G., 2011. Aeromonas spp. clinical microbiology and disease. J. Infect.
62, 09–11.
Ritchie, B.W., Harrison, G.J., Harrison, L.R., 1994. Avian Medicine: Principles and
Application. Wingers Publishing, Florida, USA, pp. 168.
Sha, J., Kozlova, E.V., Chopra, A.K., 2002. Role of various enterotoxins in Aeromonas
hydrophila induced gastroenteritis: generation of enterotoxin gene deficient mutants and
evaluation of their enterotoxic activity. Infect. Immun. 70, 1924–1935.
Silva, G.M., Silva, C.M.F., Bruno, S.F., Abreu, D.L.C., 2004. Enterobacteriaceae
identification of the intestinal microbiota in laying hens (Gallus gallus Linnaeus, 1758) from
Lohmann S.L.S. lineage. Rev. Bras. Ciênc. Vet. 11, 153–155.
Souza, C.O., Ramos, F.L.P, Mota, C.M., Santos, L.V.S., Lopes, M.L., 2010. Resistência
antimicrobiana de Salmonella typhi identificadas no Estado do Pará, Brasil. Rev. Pan-Amaz.
Saude 2, 61–65.
Stock, I., Wiedemann, B., 2001. Natural antimicrobial susceptibilities of Plesiomonas
shigelloides strains. J. Antimicrob. Chemother. 48, 803–811.
Wang, G., Clark, C.G., Liu, C., Pucknell, C., Munro, C.K., Kruk, T.M.A.C., Caldeira, R.,
Woodward, D.L., Rodgers, F.G., 2003. Detection and characterization of the hemolysin genes
in Aeromonas hydrophila and Aeromonas sobria by multiplex PCR. J. Clin. Microbiol. 41,
1048–1054.
58
7. CAPITULO 2
Isolamento de leveduras em guarás (Eudocimus ruber): Destaque para o monitoramento de
sensibilidade em Candida famata.
Isolation of yeasts from scarlet ibises (Eudocimus ruber): A focus on monitoring the
antifungal susceptibility of Candida famata.
Periódico: Medical Mycology – Research paper (Submetido em fevereiro de 2016)
59
Medical Mycology – Research paper
Isolation of yeasts from Scarlet ibises (Eudocimus ruber): A focus on monitoring the
antifungal susceptibility of Candida famata.
Raimunda Sâmia Nogueira Brilhante1*, Aline Lobão da Silva2, Frederico Ozanan Barros
Monteiro3, Glaucia Morgana de Melo Guedes1, Jamille Alencar Sales2, Jonathas Sales de
Oliveira1, José Erisvaldo Maia Junior2, Stefânia Araújo Miranda4, José Júlio Costa Sidrim1,
Lucas Pereira de Alencar2, Débora Souza Collares Maia Castelo-Branco1, Rossana de Aguiar
Cordeiro1, Waldemiro de Aquino Pereira Neto1, Marcos Fábio Gadelha Rocha1,2
1 Posgraduate Program in Medical Microbiology; Department of Pathology and Legal
Medicine, Federal University of Ceará, Fortaleza, Ceará, Brazil; 2 Posgraduate Program in
Veterinary Sciences, School of Veterinary Medicine, State University of Ceará, Fortaleza,
Ceará, Brazil; 3Universidade Federal Rural da Amazônia – UFRA, Belém, Pará, Brazil;
4Parque Mangal das Garças – Belém, Pará, Brazil.
*Corresponding author: Raimunda Sâmia Nogueira Brilhante. Rua Barão de Canindé, 210;
Montese. CEP: 60.425-540. Fortaleza, CE, Brazil. Tel: +55 85 3366 8319; e-mail:
Short title: Yeasts from captive Scarlet ibises
Keywords: Eudocimus ruber. Yeasts. Candida famata. Antifungal susceptibility testing
60
Abstract
There are several reports describing the importance of birds as hosts and disseminators of
microorganisms that cause zoonoses. However, there are few studies on the role of scarlet
ibises (Eudocimus ruber) as carriers of potentially pathogenic yeasts. Therefore, this study
aimed to identify yeasts from the gastrointestinal tract of these birds and from plant material
collected from the environment where they live. In addition, the susceptibility of the isolated
strains of Candida famata was assessed. Cloacal swabs from 30 scarlet ibises kept in captivity
at Mangal das Garças Park (Belém, PA), pooled stool samples and samples of trunks and
hollow of trees obtained from their enclosures were collected. The samples were processed
and seeded on Sabouraud agar supplemented with chloramphenicol. The identification of
species was based on micromorphological and biochemical characteristics. In total, 50 yeasts
were isolated and identified: 18 Candida famata, 13 Candida catenulata, 2 Candida
intermedia, 1 Candida lusitaniae, 1 Candida guilliermondii, 1 Candida kefyr, 1 Candida
amapae, 1 Candida krusei, 8 Trichosporon spp. and 4 Rhodotorula spp. Susceptibility testing
to amphotericin B, caspofungin, fluconazole and voriconazole was performed with strains of
C. famata. Resistance to fluconazole and voriconazole was observed in one strain isolated
from stool and high MICs were found for amphotericin B (n=2). Finally, it is concluded that
scarlet ibises and their environment may harbor potentially pathogenic yeasts, emphasizing
the need of developing proper captive management plans in conservational facilities to
promote good sanitary practices and prevent infection of humans and other animals.
61
Introduction
The Scarlet ibis (Eudocimus ruber) is a wading bird that inhabits coastal and mangrove
areas. Few studies on this bird species have been published, mostly approaching behavioral
and reproductive habits, with a lack of knowledge on the sanitary aspects of these animals.
The study of the fungal microbiota of clinically healthy wild birds is an important step to
understanding the epidemiology of fungal diseases. It is important to emphasize that birds
may harbor potentially pathogenic yeasts in their cloaca and are capable of disseminating
these fungi in the environment, which may be a problem, particularly, when these animals are
raised in collective enclosures. Finally, this environmental dissemination of microorganisms
may favor the occurrence of fungal infections in humans and other animals [1, 2].
Several yeast species have been isolated from the gastrointestinal tract and feces of free-
ranging and captive wild birds, with emphasis to the genus Candida [1, 2, 3]. C. albicans, C.
tropicalis, C. famata, C. parapsilosis, C. guilliermondii, among others, have been recovered
from healthy birds, as part of the microbiota of the digestive tract of several species such as
pigeons, turkeys, raptors, migratory birds and poultry [1, 2, 3, 4, 5].
Usually, these microorganisms are not harmful to the host, but they can become
pathogenic, when physical, chemical and immunological barriers are disrupted [6, 7, 8, 9]. In
recent years, an increase in reports of infections caused by these yeasts has been noticed,
compromising several animal species, with different clinical manifestations [3, 6, 10].
The present study aimed to isolate yeasts from cloacal and stool samples of captive
scarlet ibises (Eudocimus ruber), and from plant material obtained from the environment
where they live. Then, the in vitro antifungal susceptibility of the recovered Candida famata
strains to amphotericin B, caspofungin, fluconazole and voriconazole was evaluated through
broth microdilution and the automated method Vitek 2.
62
Material and Methods
- Ethics
This project was approved by the Authorization and Information System for
Biodiversity (SISBIO) of the Chico Mendes Institute for Conservation of Biodiversity
(ICMBio, Brazil), under the license No. 45009-1, and the Ethics Committee for the Use of
Animals (CEUA) of the State University of Ceará, under the protocol number 4797437/2014.
- Animal Handling
For the isolation of microorganisms, cloacal and stool samples were collected from
scarlet ibises (Eudocimus ruber) kept captivity at Mangal das Garças Park, in Belém, State of
Pará, Brazil (S 1°27'51.9"; W 48°30'19.9"). All animals were clinically evaluated and their
body scores were assessed by palpating the pectoral muscle. Then, the animals were classified
as obese, normal or thin [11]. Sick animals or those classified as obese or thin were not
included in this study.
Two sample collections were carried out with an interval of one month between them.
In each collection, 10 animals (20 animals in total) were randomly captured with pole nets.
These animals were kept in three enclosures. In the collective enclosure of Aningas (Sector
1), scarlet ibises cohabit with other species and are fed with fish and specific extruded bird
ration for ibises and flamingoes. On the island of scarlet ibises (Sector 2), scarlet ibises live in
semi-freedom along with other bird species and they receive only extruded feed. In the extra
sector (Sector 3), where the surplus scarlet ibises of the Park intended for exchange with other
zoos are kept, the birds receive only extruded feed. All three enclosures had a water
tank/ponds and a proper ambiance to provide well-being and stimulate reproduction and
nesting. All animals were daily assisted by a veterinarian and a biologist.
63
- Collection of biological material
The biological material from the cloaca of scarlet ibises was collected with sterile cotton
swabs, which were inserted and rotated 180 degrees twice [3]. Afterwards, the swabs were
placed in Cary Blair transport medium, widely used for the transport and preservation of stool
specimens for microbiological processing [12]. A pool of dry stool samples found where the
birds were grouped was also collected, through scraping with a sterile scalpel blade and were
stored in sterile sample cups [13].
- Collection of plant material
Tree hollows and trunks were scraped with a previously disinfected (70% alcohol) metal
spatula and the collected material was stored in sterile Falcon tubes [14].
- Sample processing
Cloacal and fecal samples were kept under refrigeration and transported in a thermal
styrofoam box to the Specialized Medical Mycology Center of the Federal University of
Ceará for microbiological processing, within 24 hours after sampling.
Swabs containing cloacal material were transferred to tubes with 1 mL of sterile saline
(0.9% NaCl), homogenized by vortexing for 3 minutes and left to decant for 30 minutes at
room temperature [13].
The dried stool samples were initially weighed and hydrated with sterile saline (0.9%
NaCl), according to the ratio of 1 g of feces for 10 mL of saline. Subsequently, the material
was vortexed for 3 minutes and left to decant for 30 minutes, at room temperature [13].
For the processing of the plant material, approximately 5 g of each sample was
suspended in 45 mL of saline (0.9% NaCl) containing chloramphenicol (0.05 mg/mL). This
64
suspension was vortexed for 10 minutes and then allowed to decant for 1 hour. Subsequently,
the supernatant was aspirated with a Pasteur pipette and transferred to a sterile Falcon tube.
Then, 0.1 mL aliquots of each sample (cloacal swabs, stool and plant) were seeded in
Petri dishes containing birdseed (Guizotia abyssinica) agar and Sabouraud dextrose agar
supplemented with chloramphenicol and incubated at 28 °C, for 10 days.
- Isolation and identification
The plates were daily evaluated by observing the macroscopic characteristics of the
colony such as aspect, elevation, texture and color, after 48 hours of growth. Colonies
suggestive of Candida spp. were subcultured on chromogenic medium (HiCrome Candida
Differential Agar, HiMedia, Mumbai, India) for the identification of mixed colonies. Each
isolated pure colony was submitted to biochemical tests, including carbohydrate and nitrogen
assimilation and urease production on Christensen’s urea agar, followed by
micromorphological analyses on cornmeal-Tween-80 agar. The tests were interpreted, in
order to identify the recovered yeast species. [15, 16].
- In vitro susceptibility testing through broth microdilution
Isolates identified as Candida famata were subjected to antifungal susceptibility testing
through broth microdilution, according to the document M27-A3 of the Clinical Laboratory
Standards Institute. The strains C. parapsilosis ATCC 22019 and C. krusei ATCC 6258 were
used as a quality control for each performed assay [17]. The following drugs were tested:
amphotericin B, fluconazole, voriconazole and caspofungin. The plates were incubated at 35
°C and they were read after 24 h and 48 h. The MIC for caspofungin, voriconazole and
fluconazole was defined as the lowest concentration able to inhibit 50% of fungal growth,
when compared to drug-free control. For amphotericin B, the MIC was defined as the lowest
65
concentration capable of inhibiting 100% of fungal growth. MIC values were interpreted
according to the document M27-S3 [17].
- Automated Susceptiblity testing through Vitek 2 system
Strains of C. famata were first subcultured on Sabouraud agar and incubated at 35 ºC
overnight, and then transferred to a tube with saline (0.45% NaCl) to prepare a homogeneous
fungal suspension with turbidity ranging from 1.8 to 2.2. Then, 280-µL-aliquots of each
fungal inoculum were transferred to a tube containing 3 mL of saline (0.45% NaCl). Finally,
the tube was attached to the antifungal susceptibility card (AST-YS07) of the Vitek2 system
(Biomeriéux) and placed in the equipment. The strains C. parapsilosis ATCC® 22019 and C.
krusei ATCC® 6258 were used as quality control [18], as recommended by the manufacturer.
- Statistical analysis
Antifungal MICs against strains of Candida famata were summarized as geometric
means and 50th and 90th percentiles. To analyze the concordance between the susceptibility
profiles obtained through microdilution test and the automated system, Pearson's chi-square
test and Fisher's exact test were used. MIC values obtained through broth microdilution and
Vitek2 automated system were compared through Student’s T test and Wilcoxon’s test.
Finally, Kruskal-Wallis’ test and Dunn's post-hoc test were used to compare the antifungal
MICs obtained against C. famata isolates recovered from different anatomical sites. The
maximum significance level adopted for conclusive findings was 5%.
Results
- Isolation and identification of yeasts
The isolation and identification results are shown in Table 1. A total of 50 yeasts were
identified with the largest number of isolates obtained from fecal samples (23/50), followed
66
by samples from plant material (19/50) and cloacal samples (8/50). From the 30 samples of
the first collection (cloaca=10; stool=10; plant=10), 30 yeasts were recovered and identified:
8 Candida famata, 10 Candida catenulata, 2 Candida intermedia, 1 Candida lusitaniae, 6
Trichosporon spp. and 3 Rhodotorula spp. Regarding the second collection, (cloaca=10;
stool=10; plant=10), 20 yeasts were recovered and identified: 10 C. famata, 3 C. catenulata, 1
Candida guilliermondii, 1 Candida kefyr, 1 Candida amapae, 1 Candia krusei, 2
Trichosporon spp. and 1 Rhodotorula spp.
- In vitro susceptibility testing of C. famata
The minimum inhibitory concentrations of drugs against the 18 strains of C. famata are
shown in Table 2. High MICs were observed for amphotericin B against the 5 strains isolated
from the cloaca of scarlet ibises, with 2/5 and 3/5 isolates classified as non-susceptible
through broth microdilution and Vitek 2 automated system, respectively, while resistance to
the other drugs was not observed among these isolates. Concerning the 8 strains isolated from
feces, 2/8 and 5/8 were classified as non-susceptible to amphotericin B through broth
microdilution and Vitek 2, respectively. One of these non-susceptible strains to amphotericin
B was also classified as resistant to fluconazole by both methods, and resistant to
voriconazole only by broth microdilution. Moreover, resistance to caspofungin was not
observed among these strains through any of the tested methods. Finally, the 5 strains
recovered from plant material were susceptible to all tested antifungal agents through both
methods.
Overall, no significant differences were observed between the antifungal MIC values
obtained through broth microdilution and those obtained through Vitek 2 automated system.
However, when each drug was individually analyzed, Vitek 2 showed higher MIC values for
67
amphotericin B (P=0.038) and caspofungin (P=0.006), with no significant differences
observed for fluconazole and voriconazole.
Finally, the overall comparison of the antifungal MICs against strains recovered from
different sites showed no significant differences. However, when each drug was individually
analyzed, higher voriconazole MICs were observed against strains recovered from cloacal
swabs, when compared to the MICs obtained against strains from plant material (P=0.0310).
Discussion
To our knowledge, this is the first study approaching microbiological aspects of captive
scarlet ibises (E. ruber). In this study, yeasts were recovered from cloaca and feces of healthy
individuals and from plant material collected in the environment where they live. The study of
the yeast microbiota of clinically healthy wild birds is important, considering that birds may
harbor potentially pathogenic yeast and contribute to the dissemination of these fungi in the
environment, which may be a sanitary problem, especially for captive birds kept in collective
enclosures [1, 2].
Candida sp. is the most commonly recovered yeast genus from birds, regardless of the
studied avian order. The species C. albicans, C. tropicalis, C. inconspicua, C. pelliculosa, C.
famata, C. parapsilosis and C. guilliermondii have been isolated from several domestic and
wild birds, such as raptors, cockatiels, rheas, parrots, among others [1, 2, 3, 19]. In the present
study, C. famata was the most prevalent yeast species, hence, these isolates received more
attention during the development of this research.
In humans, C. famata has been described in bloodstream infections, associated with the
use of catheters, peritonitis and mediastinitis. However, it is a rare cause of candidiasis,
accounting for 0.2-2% of the isolates collected in studies on antifungal resistance [20, 21]. High
68
antifungal MICs have been described and are a concern, especially, when C. famata is causing
invasive candidiasis [20, 21].
Initially, the isolation and identification of yeast strains from cloaca and stools of scarlet
ibises and environmental plant material were performed. It was observed that the recovery
rate of C. famata from feces was greater (40%; 8/20) than that from cloaca (25%; 5/20) and
plant material (25%; 5/20), suggesting that bird stools provide good nutritional support for
yeast growth and are the major sources of environmental contamination. Similar results have
been described by other authors. In a study with birds of prey, for instance, the recovery rate
of Candida spp. from fecal samples (43.7%) was higher than that from cloacal samples
(9.9%) [19] . Similarly, a study with cockatiels reported a recovery rate of 64.28% from stools
and 23.33% from the cloaca of these animals [2].
Afterwards, the susceptibility to amphotericin B, caspofungin, fluconazole and
voriconazole of the isolated C. famata was evaluated. Some strains recovered from scarlet
ibises showed antifungal resistance, while all strains from plant samples were susceptible to
the tested drugs, demonstrating that this bird species can be a source of environmental
contamination with antifungal resistant strains.
The detection of azole resistance in a strain isolated from fecal samples corroborates the
findings of other studies with Candida spp. from healthy animals [3, 9, 22, 23, 24, 25, 26]. Resistance
to azoles is commonly linked to alterations in gene sequence or expression, such as
overexpression of efflux pumps, and these changes appear to be due to selective pressures
induced by exposure to azoles used in clinical or agricultural practices [3, 22, 24, 25, 26, 27].
Furthermore, high amphotericin B MICs (>1 µg/mL) were observed against strains from
cloaca and feces of scarlet ibises by broth microdilution and automated Vitek 2 system. MICs
for amphotericin B were higher when using Vitek method than those observed in
69
microdilution broth test. A similar result was obtained in the study performed by Kathuria et
al. (2015) [28] where amphotericin B showed MIC≥8 in 99% and 4.4% of the strains when
analyzed by Vitek and microdilution, respectively. According to Shin et al. (2012) [29], Vitek-
2 may be considered a useful screening method for the detection of emerging resistance to
amphotericin B.
The emergence of resistance to amphotericin B in strains of Candida sp. is a rare event
[22, 30], which is usually caused by a decrease in the amount of ergosterol in plasma membrane
or lipid abnormalities, leading to a diminished binding of amphotericin B to the plasma
membrane [22, 26]. However, intrinsically high amphotericin B MICs have been reported
among isolates of C. krusei, C. glabrata and C. lusitaniae [22, 31].
In conclusion, scarlet ibises and their environment may harbor potentially pathogenic
yeasts that may be resistant to antifungals, emphasizing the need of developing proper captive
management plans in conservational facilities to promote good sanitary practices and prevent
infections of humans and other animals.
Conflicts of interest
None.
Acknowledgements
This work was supported by the National Council for Scientific and Technological
Development (CNPq; Brazil; process: 443167/2014-1) and Coordination for the Improvement
of Higher Education Personnel (CAPES; Brazil, Procad/Casadinho; process: 552215/2011-2).
We thank Mangal das Garças Park for allowing the performance of this research in their
facility.
70
Table 1: Isolation and identification of yeasts from scarlet ibises.
Collection Site of isolation
(n of samples)
Screening
Yeast-like colonies Identification
1st
Cloaca (n=10) 1 C. catenulata (n=1)
Feces (n=10) 15
C. famata (n=4)
C. intermedia (n=1)
C.catenulata (n=7)
C. lusitaniae (n=1)
Trichosporon spp. (n=2)
Plant (n=10) 14
C. famata (n=4)
C. intermedia (n=1)
C. catenulata (n=2)
Trichosporon spp. (n=4)
Rhodotorula spp. (n=3)
2nd
Cloaca (n=10) 7
C. famata (n=5)
C. catenulata (n=2)
Feces (n=10) 8
C. famata (n=4)
C. catenulata (n=1)
C. guilliermondii (n=1)
Trichosporon spp. (n=1)
Rhodotorula spp. (n=1)
Plant (n=10) 5
C. famata (n=1)
C. kefyr (n=1)
C. amapae (n=1)
C. krusei (n=1)
Trichosporon spp. (n=1)
TOTAL 50
71
Table 2: In vitro antifungal susceptibility of Candida famata through broth microdilution and automated Vitek 2 system.
Site of
isolation
Antifungal MICs against Candida famata (µg/mL)
Cepa AMB CAS FLC VRC
BM Vitek 2 BM Vitek 2 BM Vitek 2 BM Vitek 2
Vegetal
1 0,5 1 0,03125 0,25 2 2 0,03125 0,12
2 0,5 1 0,0625 0,25 4 2 0,03125 0,12
3 0,5 0,5 0,125 0,25 2 2 0,03125 0,12
4 1 0,5 0,5 0,5 0,5 2 0,03125 0,12
5 0,5 1 0,25 0,5 2 4 0,03125 0,12
Cloaca
6 0,5 0,5 0,03125 0,25 32 16 0,25 0,12
7 1 0,5 0,03125 0,25 8 2 0,125 0,12
8 2a 8
a 0,03125 0,25 8 2 0,125 0,12
9 2a 16
a 0,25 0,5 4 2 0,03125 0,12
10 1 4a 0,125 0,25 8 4 0,125 0,12
Feces
11 2a 16
a 0,03125 0,25 64
b 64
b 4
b 2
b
12 0,5 1 0,5 0,5 2 8 0,0625 0,12
13 0,25 0,25 0,5 0,25 2 4 0,0625 0,12
14 1 16a 0,0625 0,25 4 4 0,0625 0,12
15 1 16a 0,03125 0,25 16 2 0,125 0,12
16 2a 16
a 0,0625 0,25 2 2 0,03125 0,12
17 0,25 0,5 0,03125 0,25 32 32 0,5 0,12
18 0,5 16a 0,0625 0,25 2 2 0,03125 0,12
GM n=18 0.76 2.33 0.09 0.29 4.85 4 0.08 0.14
MIC50 n=18 0.75 - 0.0625 - 4 - 0.0625 -
MIC90 n=18 2.0 - 0.5 - 35.2 - 0.85 -
MIC: minimum inhibitory concentration / BM: broth microdilution / AMB: amphotericin B / CAS: caspofungin / FLC: fluconazole /
VRC: voriconazole / anon-susceptible strain / bresistant strain / GM: geometric mean
72
References
1. Cafarchia C., Camarda A., Romito D., et al. Occurrence of yeasts in cloacae of
migratory birds. Mycopathologia. 2006; 161(4):229-34.
2. Brilhante RS, Castelo-Branco DS., Soares GD, et al. Characterization of the
gastrointestinal yeast microbiota of cockatiels (Nymphicus hollandicus): a potential
hazard to human health. J Med Microbiol. 2010; 59(Pt6):718-23.
3. Brilhante RS., Alencar LP., Cordeiro RA., et al. Detection of Candida species resistant
to azoles in the microbiota of rheas (Rhea americana): possible implications for
human and animal health. J Med Microbiol. 2013; 62(Pt 6):889-95.
4. Garcia ME., Lanzarot P, Rodas VL., Costas E., Blanco JL. Fungal flora in the trachea
of birds from a wildlife rehabilitation centre in Spain. Veterinarni Medicina. 2007;
52(10), 464–470.
5. Cafarchia C, Romito C, Coccioli C, Camarda A, Otranto D. Phospholipase activity of
yeasts from wild birds and possible implications for human disease. Med Mycol. 2008;
46(5), 429-434.
6. Mueller RS, Bettenay SV., Shipstone M. Cutaneous candidiasis in a dog caused by
Candida guilliermondii. Vet Rec. 2002; 150(23), 728-730.
7. Moretti A, Posteraro B, Boncio L, et al. Diffuse cutaneous candidiasis in a dog.
Diagnosis by PCR-REA.Rev Iberoam Micol. 2004; 21(3), 139-142.
8. Sidrim, JJC, Rocha MFG. Micologia Médica à Luz de Autores Contemporâneos. Rio
de Janeiro: Editora Guanabara Koogan S.A, 2004.
9. Brito EH, Brilhante RS, Cordeiro, RA, et al. PCR-AGE, automated and manual
methods to identify Candida strains from veterinary sources: a comparative approach.
Vet Microbiol. 2009; 139 (3-4), 318–22.
10. Ozawa H, Okabayashi K, Kano R, Watari T, Watanabe S, Hasegawa A. Rapid
identification of Candida tropicalis from canine cystitis. Mycopathologia. 2005;
160(2), 159-62.
11. Ritchie BW, Harrison GJ, Harrison LR. Avian Medicine: Principles and Application.
Florida, USA: Wingers Publishing, 1994.
12. Silva GM, Silva CMF, Bruno SF, Abreu DLC. Enterobacteriaceae identification of the
intestinal microbiota in laying hens (Gallus gallus Linnaeus, 1758) from Lohmann
S.L.S. lineage. Rev Bras Ciênc Vet. 2004; 11(3), 153–155.
73
13. Filiú WF, Wanke B, Agüena SM, Vilela VO, Macedo RC, Lazéra M. Avian habitats as
sources of Cryptococcus neoformans in the city of Campo Grande, Mato Grosso do
Sul, Brazil. Rev Soc Bras Med Trop. 2002; 35(6), 591–595. [in portuguese].
14. Randhawa HS, Mussa AY, Khan ZU. Decaying wood in tree trunk hollows as a
natural substrate for Cryptococcus neoformans and other yeast-like fungi of clinical
interest. Mycopathologia. 2001; 151(2), 63-69.
15. De Hoog GS, Guarro J, Gené J, Figueras MJ. Atlas of Clinical Fungi, 2nd edn. Spain:
Centralalbureau voor Schimmelcultures/ Universitat Rovira I Virgili Reus, 2000.
16. Kurtzman C, Fell J W, Boekhout T. (Eds.). The yeasts: a taxonomic study (Vol. 1).
Elsevier, 2011.
17. CLSI. Reference Method for Broth Dilution Antifungal Susceptibility Testing of
Yeasts; Approved Standard—Third Edition. CLSI document M27-A3. Wayne, PA:
Clinical and Laboratory Standards Institute, 2008.
18. CLSI. Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yasts;
Fourth Informational Supplement. CLSI document M27-S4. Wayne, PA: Clinical
Laboratory Standards Institute, 2012.
19. Cafarchia C, Romito D, Iatta R, Camarda A, Montagna MT, Otranto D. Role of birds
of prey as carriers and spreaders of Cryptococcus neoformans and other zoonotic
yeasts. Med Mycol. 2006; 44(6), 485–92.
20. Pfaller MA, Diekema DJ, Messer SA, et al. In vitro activities of voriconazole,
posaconazole, and four licensed systemic antifungal agents against Candida species
infrequently isolated from blood. J Clin Microbiol. 2003; 41(1), 78–83.
21. Beyda ND, Chuang SH, Alam MJ, et al. Treatment of Candida famata bloodstream
infections: case series and review of the literature. J Antimicrob Chemother. 2013;
68(2), 438-43.
22. Kanafani ZA, Perfect JR. Antimicrobial resistance: resistance to antifungal agents:
mechanisms and clinical impact. Clin Infect Dis. 2008; 46(1), 120–8.
23. Sidrim JJC, Maia DC, Brilhante RS, et al. Candida species isolated from the
gastrointestinal tract of cockatiels (Nymphicus hollandicus): In vitro antifungal
susceptibility profile and phospholipase activity. Vet Microbiol. 2010; 145(3-4), 324–
8.
24. Brilhante RS, Paiva MA, Sampaio CM, et al. Yeasts from Macrobrachium
amazonicum: a focus on antifungal susceptibility and virulence factors of Candida
spp. FEMS Microbiol Ecol. 2011; 76(2), 268–77.
74
25. Brilhante RS, Fechine MA, Mesquita JR, et al. Histoplasmosis in HIV-positive
patients in Ceara, Brazil: clinical-laboratory aspects and in vitro antifungal
susceptibility of Histoplasma capsulatum isolates. Trans R Soc Trop Med Hyg. 2012;
106(8), 484–8.
26. Cordeiro RA, Oliveira JS, Castelo-Branco DS, et al. Candida tropicalis isolates
obtained from veterinary sources show resistance to azoles and produce virulence
factors. Med Mycol. 2015; 53(2), 145-52.
27. Pfaller MA, Espinel-Ingroff A, Castanheira M, et al. Wild-type MIC distributions and
epidemiological cutoff values for amphotericin B, flucytosine, and itraconazole and
Candida spp. as determined by CLSI broth microdilution. J Clin Microbiol. 2012;
50(6), 2040–6.
28. Kathuria S, Singh PK, Sharma C, et al. Multidrug-Resistant Candida auris
Misidentified as Candida haemulonii: Characterization by Matrix-Assisted Laser
Desorption Ionization-Time of Flight Mass Spectrometry and DNA Sequencing and
Its Antifungal Susceptibility Profile Variability by Vitek 2, CLSI Broth Microdilution,
and Etest Method. J Clin Microbiol. 2015; 53(6), 1823–30.
29. Shin JH, Kim MN, Jang SJ, et al. Detection of amphotericin B resistance in Candida
haemulonii and closely related species by use of the Etest, Vitek-2 yeast susceptibility
system, and CLSI and EUCAST broth microdilution methods. J Clin Microbiol. 2015;
50(6), 1852–5.
30. Tortorano AM, Prigitano A, Biraghi E, Viviani MA, FIMUA-
ECMM Candidaemia Study Group. The European Confederation of Medical
Mycology (ECMM) survey of candidaemia in Italy: in vitro susceptibility of 375
Candida albicans isolates and biofilm production. J Antimicrob Chemother. 2005;
56(4), 777–9.
31. Pfaller MA, Messer SA, Boyken L, Tendolkar S, Hollis RJ, Diekema DJ. Geographic
variation in the susceptibilities of invasive isolates of Candida glabrata to seven
systemically active antifungal agents: a global assessment from the ARTEMIS
Antifungal Surveillance Program conducted in 2001 and 2002. J Clin Microbiol.
2004; 42(7), 3142-6.
75
8. CONCLUSÕES
1- Plesiomonas shigelloides faz parte da microbiota do trato gastrointestinal de guarás
(Eudocimus ruber);
2- Aeromonas hydrophila, Aeromonas caviae, Plesiomonas shigelloides estão presentes
na água dos lagos que os guarás têm acesso;
3- Há fenômeno de resistência a gentamicina em cepas de P. shigelloides isoladas da
cloaca de guarás e água dos lagos, bem como, perfil intermediário a piperacilina-
tazobactam e cefepime em A. veronii bv. sobria e P. shigelloides, respectivamente;
4- Os genes de virulência asa1 e ascV foram os mais detectados em cepas de Aeromonas
spp., sendo comum a detecção concomitante destes genes em cepas de A. veronii bv.
sobria;
5- As leveduras do gênero Candida (C. famata, C. catenulata, C. intermedia, C.
lusitaniae e C. guilliermondii), Trichosporon spp. e Rhodotorula spp. fazem parte da
microbiota do trato gastrointestinal de guarás, sendo C. famata a mais frequente;
6- Em amostras vegetais do ambiente em que os guarás têm acesso, foram encontradas as
leveduras do gênero Candida (C. famata, C. catenulata, C. intermedia, C. kefyr, C.
amapae e C. krusei), Trichosporon spp. e Rhodotorula spp.;
7- As cepas de C. famata apresentaram elevados CIMs para anfotericina B e houve
fenômeno de resistência ao fluconazol e voriconazol observado em uma cepa
proveniente de amostras de fezes dos guarás.
76
9- PERSPECTIVAS
O conhecimento da flora microbiana associada às aves é de grande importância,
pois auxilia na compreensão da dinâmica microbiana, que é essencial para prevenção de
doenças, na elaboração de dietas adequadas, na otimização da criação em cativeiro e
investigação das condições ambientais onde estes animais estão inseridos. Este trabalho foi
pioneiro para os guarás (Eudocimus ruber) e forneceu dados relevantes sobre a composição da
microbiota bacteriana e de leveduras, que compõe o trato digestório dessa espécie e do
ambiente em que estão mantidos no Parque Mangal das Garças.
O monitoramento do perfil de sensibilidade de cepas de Aeromonas spp.,
Plesiomonas shigelloides e Candida spp. de origem animal e ambiental é bastante escasso,
sendo limitado o número de trabalhos nessa área. Este trabalho constatou a ocorrência do
fenômeno de resistência à gentamicina em P. shigelloides isolada da cloaca de guarás e
resistência ao fluconazol e voriconazol em C. famata isolada de fezes dessas aves.
Considerando que os animais representam possíveis fontes de infecção para seres humanos, é
de grande importância o reforço de medidas preventivas, a exemplo do uso de luvas durante o
manejo desses animais e limpezas diárias dos recintos.
O conhecimento e a compreensão dos fatores de virulência de um
microorganismo contribuem tanto para a prevenção das doenças, quanto para a elaboração de
novas alternativas terapêuticas que visam à supressão desses fatores. Dentre as bactérias
isoladas, apenas as cepas de Aeromonas spp. oriundas da água do ambiente foram avaliadas
quanto aos genes que codificam enterotoxina (act), hemolisina (asa1) e sistema de secreção
tipo III (ascV). Sendo assim, não foi possível a análise dos mesmos genes para as cepas de P.
shigelloides. Portanto, mais estudos são necessários para avaliar os fatores de virulência de P.
shigelloides, seja pela avaliação de forma fenotípica ou até mesmo pelo desenvolvimente de
primers específicos para a espécie.
Ademais, não foram avaliados os fatotes de virulência das cepas de C. famata,
sendo de grande importância o desenvolvimento de mais pesquisas para que se possa
conhecer o risco real que essas leveduras representam tanto para os animais quanto para as
pessoas.
77
REFERÊNCIAS BIBLIOGRAFICAS
ABBOTT, S. L.; CHEUNG, W. K. W.; JANDA, J. M. The genus Aeromonas: Biochemical
characteristics, atypical reactions, and phenotypic identification schemes. Journal of Clinical
Microbiology. v.41, n.6, p.2348-2357, 2003.
ADAMS S., CARROL H. Birds in flight: The Art and science of how birds fly. Minneapolis,
MN, USA: Voyageur Press. p. 89. 2008.
AGUIRRE, A.A; QUAN, T.J; COOK, R.S; MCLEAN, R.G. Cloacal flora isolated from wild
black-bellied whistling ducks (Dendrocygna autumnalis) in Laguna La Nacha, Mexico. Avian
Diseases. 36(2):459-62. 1992.
ANTAS, P.; ROTH, R.; MORRISON, G. Status and conservation of the Scarlet ibis
(Eudocimus ruber) in Brazil. In: The Scarlet Ibis (Eudocimus Ruber): Status, conservation
and Recent Research (Eds Frederick PC, Morales LG, Spaans AL, Luthin CS). International
Waterfowl and Wetlands Research. Bureau, Slimbridge. pp. 130-136. 1990.
ARAVENA-ROMÁN, M.; INGLIS, T.J.J.; HENDERSON, B.; RILLEY, T.V.; CHANG, B.J.
Antimicrobial Susceptibilities of Aeromonas Strains Isolated from Clinical and
Environmental Sources to 26 Antimicrobial Agents. Antimicrob. Agents Chemoter, 569(2):
1110–1112, 2012.
ARUO SK. Necrotizing cutaneous rhodotorulosis in chickens in Uganda. Avian Diseases 24,
1038– 1043, 1980.
BALASUBRAMANIAM, A.; SUKUMAR, S. An overview on outbreaks of candidiasis in
poultry. Tamilnadu Journal Veterinary & Animal Sciences, v.3, n.3, p.121-123, 2007.
BEEMER AM, SCHNEERSON-PORAT S, KUTTIN ES. Rhodotorula mucilaginosa
dermatitis on feathered parts of chickens: an epizootic on a poultry farm. Avian Diseases 14,
234–239, 1970.
BEYDA, N.D.; CHUANG, S.H.; ALAM, M.J. et al. Treatment of Candida famata
bloodstream infections: case series and review of the literature. J Antimicrob Chemother; 68
(2) 438-43, 2013.
BIRDLIFE INTERNATIONAL. 2012. Eudocimus ruber. The IUCN Red List of Threatened
Species 2012: e.T22697415A40226232. http://dx.doi.org/10.2305/IUCN.UK.2012-
1.RLTS.T22697415A40226232.en. Downloaded on 08 February 2016.
BRENDEN, R.A., MILLER, M.A., JANDA, J.M. Clinical disease spectrum and pathogenics
factors associated with Plesiomonas shigelloides infections in humans. Review of Infectious
Diseases, 10:303-16, 1988.
BRILHANTE, R. S.; CASTELO-BRANCO, D. S. C. M.; SOARES, G. D.; ASTETE-
MEDRANO, D. J.; MONTEIRO, A. J.; CORDEIRO, R. A.; SIDRIM, J. J.; ROCHA, M. F.
Characterization of the gastrointestinal yeast microbiota of cockatiels (Nymphicus
78
hollandicus): a potential hazard to human health. Journal of Medical Microbiology, v.59,
p.718-723, 2010.
BRILHANTE, R.S.N.; PAIVA, M.A.N.; SAMPAIO, C.M.S. et al. Yeasts from
Macrobrachium amazonicum: a focus on antifungal susceptibility and virulence factors of
Candida spp. FEMS Microbiol Ecol, 76 (2): 268–277, 2011.
BRILHANTE, R.S.N.; FECHINE, M.A.B.; MESQUITA, J.R.L. Histoplasmosis in HIV-
positive patients in Ceara, Brazil: clinical-laboratory aspects and in vitro antifungal
susceptibility of Histoplasma capsulatum isolates. Trans R Soc Trop Med Hyg, 106: 484–488,
2012.
BRILHANTE, R. S. N. et al. Detectation of Candida species resistant to azoles in the
microbiota of Rheas (Rhea Americana): possible implications for human and animal helth.
Journal of Medical Society General Microbiology, v.62, p.000-000, 2013.
BRITO, E. H. S.; BRILHANTE, R. S. N.; CORDEIRO, R. A.; SIDRIM, J. J. C.;
FONTENELLE, R. O. S.; MELO, L. M; ALBUQUERQUE, E. S.; ROCHA, M. F. G. PCR-
AGE, automated and manual methods to identify Candida strains from veterinary sources: a
comparative approach. Veterinary Microbiology, v. 139, p. 318-322, 2009.
BUCK, JOHN D. Isolation of Candida albicans and Halophilic Vibrio spp. from aquatic birds
in Connecticut and Florida. Applied and Environmental Microbiology. p. 826-828. 1990.
BULIK, C.C.; FAUNTLEROY, K.A.; JENKINS, S.G.; ABUALI, M.; LABOMBARDI, V. J.;
NICOLAU, D. P.; KUTI, J. L. Comparison of Meropenem MICs and Susceptibilities for
Carbapenemase-Producing Klebsiella pneumonia Isolates by Various Testing Methods.
Journal of Clinical Microbiology, p. 2402–2406, 2010.
CAFARCHIA C, CAMARDA A, ROMITO D., et al. Occurrence of yeasts in cloacae of
migratory birds. Mycopathologia, 161 (4): 229–234, 2006a.
CAFARCHIA, C. et al. Role of birds of prey as carriers and spreaders of Cryptococcus
neoformans and other zoonotic yeasts. Medical Mycology, v.44, p.485-492, 2006b.
CAFARCHIA, C. et al. Phospholipase activity of yeasts from wild birds and possible
implications for human disease. Medical Mycology, v.46, p.1-6, 2008.
CASTELO-BRANCO, D.S.C.M; GUEDES, G.M.M; BRILHANTE, R.S.N; ROCHA, M.F.G;
SIDRIM, J.J.C; MOREIRA, J.L.B. et al. Virulence and antimicrobial susceptibility of clinical
and environmental strains of Aeromonas spp. from Northeastern Brazil. Canadian Journal of
Microbiology, vol. 61, 2015.
CLARK, R.B.; LISTER, P.D.; ARNESON-ROTERT, L.; JANDA, J.M. In vitro
susceptibilities of Plesiomonas shigelloides to 24 antibiotics and antibiotic-b-lactamase-
inhibitor combinations. Antimicrob. Agents Chemother. 34, 159-160, 1990.
79
CLSI. Collection, Transport, Preparation, and Storage of Specimens for Molecular Methods.
CLSI document MM-13-A. Wayne, PA, 2005.
CLSI. Clinical and Laboratory Standards Institute. Reference method for broth dilution
antifungal susceptibility testing of yeasts. Approved standard. Document M27-A3, Wayne,
PA, 2008.
CLSI – Clinical and Laboratory Standards Institute, M45-A2 Methods for Antimicrobial
Dilution and Disk Susceptibility Testing of Infrequently Isolated or Fastidious Bacteria;
Approved Guideline-Second Edition. (ISBN 1562387324). CLSI, 940 West Valley Road,
Suite 1400, Wayne, Pennsylvania 19087-1898 USA, 2010.
CLSI. Clinical Laboratory Standards Institute. Methods for Dilution Antimicrobial
Susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard - Nineth Edition.
Document M07-A9. Wayne, PA, 2012.
CLSI. Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yasts;
Fourth Informational Supplement. CLSI document M27-S4. Wayne, PA: Clinical Laboratory
Standards Institute; 2012.
COLLARILE, T.; GIROLAMO, N.D.; SELLERI, P.; MELIDONE, R. Mucus Accumulation
and Necrosis of the Ventral Air Pouch in a Marabou Stork (Leptoptilos crumeniferus) With
Productive Rhinitis. Journal of Avian Medicine and Surgery, 27(3):222–226, 2013.
CORDEIRO, R.A.; OLIVEIRA, J.S.; CASTELO-BRANCO, D.S.C.M. et al. Candida
tropicalis isolates obtained from veterinary sources show resistance to azoles and produce
virulence factors. Med Mycol, 53 (2): 145-152, 2015.
CUBAS, Z.S.; SILVA, J.C.R.; DIAS, J.L.C. Tratado de Animais Selvagens – Medicina
Veterinária. 1. ed. São Paulo: Roca, 2007.
DE HOOG, G. S.; GUARRO, J.; GENÉ, J.; FIGUEIRAS, M. J. Atlas of Clinical Fungi. 2ed.
The Nederlands: Centraalbureau voor Schimmslcultures, Baarn, 2000. 1126p.
DONALD K. WINSOR, ALLAN P. BLOEBAUM, JOHN J. MATHEWSON. Gram-
Negative, Aerobic, Enteric Pathogens Among Intestinal Microflora of Wild Turkey Vultures
(Cathartes aura) in West Central Texas. Applied and Environmental Microbiology, Vol. 42,
No. 6, p. 1123-1124, 1981.
FAGUNDES-JÚNIOR, A. A. P.; CARVALHO, R. T.; FOCACCIA, R.; FERNANDEZ, J. G.;
ARAÚJO, H. B. N.; STRABELLI, T. M. V.; KOPEL, L.; LAGE, S. G. Emergência de
infecção por Trichosporon asahii em pacientes portadores de insuficiência cardíaca em
unidade de terapia intensiva cardiológica: relato de caso e revisão da literatura. Revista
Brasileira de Terapia Intensiva, v. 20, n. 1, jan-mar. 2008.
FARIÑAS L. B.; NOBLET, D. S.; ARCE, M.A. et al. Estudio de factores de virulencia en
cepas de Plesiomonas shigelloides aisladas de animales domésticos y afectivos (Study of
80
virulence factors in Plesiomonas shigelloides isolated from domestic and affective animals).
Revista Electrónica de Veterinaria REDVET, Vol. VI, nº 11, 2005.
FERNANDES, M. e RODRIGUES, A.A.F. Nota sobre um ninhal do Guará, Eudocimus ruber
(Ciconiiformes), no litoral do Pará, Brasil. Boletim do Museu Paraense Emilio Goeldi. Serie
Zoologia. 1994.
FREDERICK P. e BILDSTEIN, K. Foraging ecology of seven species of neotropical ibises
(Threskiornithidae) during the dry season in the Llanos of Venezuela. The Wilson bulletin.
Vol 104 pg 1-21. 1992.
FILIÚ, W. F. O. F.; WANKE, B.; AGÜENA, S. M.; VILELA, V. O.; MACEDO, R. C. L.;
LAZERA, M. Cativeiro de aves como fonte de Crytococcus neoformans na cidade de Campo
Grande, Mato Grosso de Sul, Brasil. Revista da Sociedade Brasileira de Medicina Tropical,
v. 35, p. 591-95, 2002.
FRANÇA, M; WALKER, R.L; KOKKA, R; SHIVAPRASAD, H.L. Aeromonas species
associated with necrotizing enteritis and septicemia in an adult male ostrich (Struthio
camelus). Avian Diseases.53(2):310-6. 2009.
GALINDO, C. L.; SHA, J.; FADL, A.A.; PILLAI, L.L.; CHOPRA, A. K. Host immune
responses to Aeromonas virulence factors. Current Immunology Reviews, v.2, p. 13-26, 2006.
GARCÍA, M.E.; DOMÉNECH, A.; DOMÍNGUEZ, L.; RAMIRO, F.; FERNÁNDEZ-
GARAYZÁBAL, J.F. Aeromonas hydrophila conjunctivitis in a pet parrot (Amazona
versicolor). Avian Diseases. 36(4):1110-1. 1992.
GARCIA, M.E; LANZAROT, P.; RODAS, V.L.; COSTAS, E.; BLANCO, J.L. Fungal flora
in the trachea of birds from a wildlife rehabilitation centre in Spain. Veterinarni Medicina,
52(10): 464–470, 2007.
GHENGHESH K.S.; AHMED S. F.; EL-KHALEK R. A.; AL-GENDY A; KLENA, J.
Aeromonas-Associated Infections in Developing Countries. Journal of Infection in
Developing Countries, Sassari, v. 2, p. 81-98, 2008.
HANCOCK, J.; J. Kushlan; M. Kahl. Storks, Ibises and Spoonbills on the World. San Diego,
CA: Harcourt Brace Jovanovich. 1992.
GARRITY, GM; WINTERS, M; SEARLES, DB. Taxonomic outline of the Archaea and
Bacteria. In: Garrity GM (ed) Bergey’s manual of systematic bacteriology, 2nd edn. Springer,
New York, p 13, 2001.
GARTRELL, B. D.; ROGERS, L.; ALLEY, M. R. Eosinophilic dermatitis associated with
Trichosporon asahii in a cockatiel (Nymphicus hollandicus). Journal of Avian and Surgery, v.
19, n.1, p. 25-29, 2005.
81
GLUNDER, G; SIEGMANN, O. Occurrence of Aeromonas hydrophila in wild birds. Avian
Pathology. 18(4):685-95. 1989.
GONZÁLEZ-REY, C.; SVENSON, S.B.; ERIKSSON, L. M.; CIZNAR, I;
KROCACEK, K. Unexpected finding of the "tropical" bacterial
pathogen Plesiomonas shigelloides from lake water north of the Polar Circle. Polar
Biology , Vol 26, Issue 8, pp 495-499, 2003.
HASS, A.; MATOS, R.H.R.; MACHADO, L.O.M. Ecologia reprodutiva e distribuição
espacial da colônia de Eudocimus ruber (Ciconiiformes: Threskiornithidae) na Ilha do Cajual,
Maranhão. Ararajuba 7(1): 41-44. 1999.
HIRSCH, D.; PEREIRA JÚNIOR, D. J.; PICCOLI, R. H.; LOGATO, P. V. R.;
FIGUEIREDO, H. C. P. Identificação e resistência a antimicrobianos de espécies de
Aeromonas móveis isoladas de peixes e ambientes aquáticos. Ciência e Agrotecnologia,
Lavras, v.30, n.6, p.1211-1217, 2006.
HUSS, H.H.; ABABOUCH L. & GRAM, L. Assessment and management of seafood safety
and quality. Fisheries technical paper Nº44. Food and Agriculture Organization of the United
Nation (FAO), Rome, 2004.
JANDA, JM Family I. Enterobacteriaceae, genus XXVII. Plesiomonas Habs and Schubert
1962, Bergey’s manual of systematic bacteriology, 2nd ed., vol. 2. In: D. J Brenner, N. R
Krieg, J. T Staley, New York: Springer-Verlag. 740–744, 2005.
JANDA, J. M. e ABBOTT, S. L. The genus Aeromonas: taxonomy, pathogeniticy and
infection. Clinical Microbiology Revnews, Washington, v. 23, p. 35–73, 2010.
KAIN, K. C. e KELLY, M. T. Clinical features, epidemiology, and treatment of Plesiomonas
shigelloides diarrhea. J Clin Microbiol 27:998–1001, 1989.
KANAFANI, Z.A. e PERFECT, J.R. Antimicrobial resistance: resistance to antifungal agents:
mechanisms and clinical impact. Clin Infect Dis, 46: 120–128, 2008.
KATHURIA S, SINGH PK, SHARMA C, et al. Multidrug-Resistant Candida auris
Misidentified as Candida haemulonii: Characterization by Matrix-Assisted Laser Desorption
Ionization-Time of Flight Mass Spectrometry and DNA Sequencing and Its Antifungal
Susceptibility Profile Variability by Vitek 2, CLSI Broth Microdilution, and Etest Method. J
Clin Microbiol, 53(6), 1823–30, 2015.
KIM, KYOO-TAE; LEE, SEUNG-HUN e KWAK, DONGMI. Prevalence, biochemical
characteristics, and antibiotic susceptibility of Aeromonads, Vibrios, and Plesiomonads
isolated from different sources at a Zoo. Journal of Zoo and Wildlife Medicine, 46(2): 298–
305, 2015.
KINGOMBE, C.I.B, D’AOUST, J.Y., HUYS, G., HOFMANN, L., RAO, M., KWAN, J. Pcr
cetection, characterization, and distribution of virulence genes in Aeromonas spp. Applied and
Environmental Microbiology. 65, 5293-5302, 1999.
82
KO, W. C., LEE, H. C., CHUANG, Y. C., LIU, C. C., WU, J. J. Clinical features and
therapeutic implications of 104 episodes of monomicrobial Aeromonas bactereamia. Journal
of Infectology. n. 40, p. 267-273, 2000.
KONEMAN E. W.; WINN W. C.; ALLEN S. D.; JANDA W. M.; PROCOP G. W.;
SCHRECKENBERGER P. C.; WOODS G. J.; Diagnóstico Microbiológico: texto e atlas
colorido. Rio de Janeiro: Guanabara Koogan, 2012. 1506p.
KOZINSKA, A.; FIGUERAS, M. J.; CHACON, M. R.; SOLER, L. Phenotipic characteristics
and pathogenicity of Aeromonas genomospecies isolated from common carp (Cyprinus
carpio). Journal of Applied Microbiology, Amsterdam, n. 93, 1034-1041, 2002.
KROVACEK, K; ERIKSSON, LM; GONZÁLEZ-REY, C; ROSINSKY, J; CIZNAR, I.
Isolation, biochemical and serological characterisation of Plesiomonas shigelloides from
freshwater in Northern Europe. Comp Immunol Microbiol Infect Dis 23:45–51, 2000.
KURTZMAN C, FELL J W, BOEKHOUT T. (Eds.). The yeasts: a taxonomic study (Vol. 1).
Elsevier, 2011.
LEE, ACW; YUEN, KY; HÁ, SY; CHIU, DCK; LAU, YL. Plesiomonas shigelloides
septicemia: case report and literature review. Pediatr Hematol Oncol 13:265–269, 1996.
LUNARDI, L.W., AQUINO, V.R., ZIMERMAN, R.A., GOLDANI, L.Z. Epidemiology and
outcome of Rhodotorula fungemia in a tertiary care hospital. Clin. Infect. Dis. 43(6): e60–e63,
2006.
MARTINO, M.E.; FASOLATO, L.; MONTEMURRO, F.; ROSTEGHIN, M.; MANFRIN,
A.; PATARNELLO, T. et al. Determination of Microbial Diversity of Aeromonas Strains on
the Basis of Multilocus Sequence Typing, Phenotype, and Presence of Putative Virulence
Genes. Appl. Environ. Microbiol, 77(14): 4986–5000, 2011.
MEDEIROS, A.O.; KOHLER, L.M.; HAMDAN, J.S.; MISSAGIA, B.S.; BARBOSA, F.A.;
ROSA, C.A. Diversity and antifungal susceptibility of yeasts from tropical freshwater
environments in Southeastern Brazil. Water Res. 42(14): 3921-29, 2008.
MICELI, M.H., DÍAZ, J.A., LEE, S.A. Emerging opportunistic yeast infections. Lancet
Infect. Dis. 11(2): 142–151, 2011.
MIYASAKA, J.; YAH IRO, S.; ARAH IRA, Y.; TOKUNAGA, H.; KATSUK, K.; HARA –
KUDO, Y. Isolation of Vibrio parahaemolyticus and Vibrio vulnificus from wild aquatic birds
in Japan. Epidemiol Infect. 134(4): 780–785. 2006.
MORETTI, A, POSTERARO B, BONCIO L, MECHELLI L, DE GASPERIS E, AGNETTI
F, RASPA M. Diffuse cutaneous candidiasis in a dog. Diagnosis by PCR-REA. Rev Iberoam
Micol., v.21, p.139-142, 2004.
83
MORRISON, R. I. G.; ANTAS, P. T. Z.; ROSS, R. K. Migration routes in the Amazon coast.
In: Carajás..., Rio de Janeiro, Companhia Vale do Rio Doce & Conselho Nacional de
Desenvolvimento Cientifico e Tecnologico. P. 159- 199. 1987.
MUELLER, R.S. et al. Cutaneous candidiasis in a dog caused by Candida guilliermondii.
Veterinary Record, v.150, p.728-730, 2002.
NASCIMENTO, A.M.A.; CURSINO, L.; GONÇALVES-DORNELAS, H.; REIS, A.;
CHARTONE-SOUZA, E.; MARINI, M.A. Antibiotic-resistant gram-negative bacteria in
birds from the Brazilian Atlantic Forest. The Condor, 105(2):358-361, 2003.
NIMMERVOLL, H.; WENKER, C.; ROBERT, N.; ALBINI, S. Septicaemia caused by
Edwardsiella tarda and Plesiomonas shigelloides in captive penguin chicks. Schweizer Archiv
für Tierheilkunde, 153(3):117-21, 2011.
NOGUCHI, Renata Gabriela. Distribuição e abundância dos Guarás, Eudocimus ruber
Linnaeus, 1758 (Ciconiiformes: Threskiornithidae) no complexo estuarino lagunar de
Iguape/Cananéia, Estado de São Paulo. Trabalho de conclusão de curso em Ciências
Biológicas - Universidade Federal do Paraná, Curitiba, 2011.
NOVAES, Fernando C. Aves da grande Belém. Municipios de Belém e Ananindeua, PA. 2.
ed. Rev. Atual. Belém. Museu Paraense Emílio Goeldi, 2009.
OCHOLI, R.A; KALEJAIYE, J.O. Aeromonas hydrophila as cause of hemorrhagic
septicemia in a ground-hornbill (Bucorvus abyssinicus). Avian Diseases. 34(2):495-6. 1990.
OLMOS, Fábio. Dieta e biologia reprodutiva de Eudocimus ruber e Egretta caerulea (Aves:
Ciconiiformes) nos manguezais de Santos-Cubatão. Tese (Doutorado em Zoologia) – Instituto
de Biociências, Universidade Estadual Paulista, SP, 2000.
OLMOS, F. e SILVA, R. Breeding Biology and Nest Site Characteristics of the Scarlet Ibis in
Southeastern, Brazil. Waterbirds, 24(1): 58-67. 2001.
OGG, J. E; RYDER, R. A; SMITH, H. L. JR. Isolation of Vibrio cholerae from aquatic birds
in Colorado and Utah. Appl Environ Microbiol. 55(1): 95–99. 1989.
OTTAVIANI, D.; PARLANI, C.; CITTERIO, B.; MASINI, L.; LEONI, F.; CANONICO, C.;
SABATINI, L.; BRUSCOLINI, F.; PIANETTI, A. Putative virulence properties of
Aeromonas strains isolated from food, environmental and clinical sources in Italy: A
comparative study. Int. J. Food Microbiol, 144(3): 538–545, 2011.
OZAWA, H. et al. Rapid identification of Candida tropicalis from canine cystitis.
Mycopathologia, v.160, p.159-162, 2005.
PARKER, J.L. e SHAW, J.G. Aeromonas spp. Clinical microbiology and disease. J. Infect.
62(8): 09-11, 2011.
84
PFALLER, M.A.; DIEKEMA, D.J.; MESSER, S.A. et al. In vitro activities of voriconazole,
posaconazole, and four licensed systemic antifungal agents against Candida species
infrequently isolated from blood. J Clin Microbiol, 41 (1): 78–83, 2003.
PFALLER, M.A.; MESSER, S.A.; BOYKEN, L.; TENDOLKAR, S.; HOLLIS, R.J.;
DIEKEMA, D.J. Geographic variation in the susceptibilities of invasive isolates of Candida
glabrata to seven systemically active antifungal agents: a global assessment from the
ARTEMIS Antifungal Surveillance Program conducted in 2001 and 2002. J Clin
Microbiol,42:3142–3146, 2004.
PFALLER, M.A.; ESPINEL-INGROFF, A; CASTANHEIRA, M. et al. Wild-type MIC
distributions and epidemiological cutoff values for amphotericin B, flucytosine, and
itraconazole and Candida spp. as determined by CLSI broth microdilution. J Clin Microbiol,
50: 2040–2046, 2012.
PINCUS, D. H. Microbial Identification Using the bioMérieux VITEK 2® System. In.
Encyclopedia of Rapid Microbiological Methods, www.pda.org/bookstore, cap. 1, 468, p. 1-
32, 2006.
POWELL, G. e POWELL, A. Reproduction in Great White Herons Ardea Herodias in Florida
Bay as an indicator of habitat quality. Biological Conservation 36:Pg 101-113. 1986.
QUINDÓS, G.; ALONSO-VARGAS, R.; HELOU, S.; ARECHAVALA, A.;
MARTÍNMAZUELOS, E.; NEGRONI, R. Evaluación micológica de uno nuevo medio de
cultivo cromógeno (Candida ID®) para el aislamiento e identificación presuntiva de Candida
albicans y otras levaduras e interés médico. Revista Iberoamericana de Micología, v. 18, p.
23-28, 2001
RANDHAWA, H. S.; MUSSA, A. Y.; KHAN, Z. U. Decaying wood in tree trunk hollows as
a natural substrate for Cryptococcus neoformans and other yeast-like fungi of clinical interest.
Mycopathologia, v. 151, p. 63–69, 2001.
RAUTELIN, H; SIVONEN, A; KUIKKA, OV; VALTONEN, V; KOSUNEN, TV. Enteric
Plesiomonas shigelloides infections in Finnish patients. Scand J Infect Dis 27:495–498, 1995.
RICKLEFS, R. Intrisic aging-related mortality in birds. Journal of Avian Biology, 31: 103-
111. 2000.
RITCHIE, B. W.; HARRISON, G. J.; HARRISON, L. R. Avian Medicine: Principles and
Application. Florida, USA: Wingers Publishing, 1994.
RODRIGUES, S.M.A.; GONÇALVES, E.G.R.; MELLO, D.M.; OLIVEIRA, E.G. &
HOFER, E. Pesquisa de bactérias do gênero Vibrio em feridas cutâneas de pescadores do
município de Raposa –MA. Revista da Sociedade Brasileira de Medicina Tropical, v. 34, n.
5, p. 407- 411, 2001.
RODRIGUES, D. P.; RIBEIRO, R. V.; Aeromonas. In: VIEIRA, R. H. F. Microbiologia,
higiene e qualidade do pescado- teoria e prática. São Paulo: Varela, 380 p. 2004.
85
ROLSTON, K.V.I., HOPFER, R.L. Diarrhea due to Plesiomonas shigelloides in cancer
patients. Journal of Clinical Microbiology, 20:597-98, 1984.
SANYAL, S.C., SARASWATHI, B., SHARMA, P. Enteropathogenicity of Plesiomonas
shigelloides. Journal of Medicine Microbiology, 13:401-9, 1980.
SANTOS, M., et al. Isolation and characterization of polymorphic microsatellite loci in the
Scarlet íbis (Eudocimus ruber- Threskiornithidae –Aves). Molecular Ecology Notes, 6:307-
309, 2006.
SHA, J.; KOZLOVA, E.V. e CHOPRA, A.K. Role of various enterotoxins in Aeromonas
hydrophila induced gastroenteritis: generation of enterotoxin gene deficient mutants and
evaluation of their enterotoxic activity. Infect. Immun. 70(4): 1924-1935, 2002.
SHIN JH, KIM MN, JANG SJ, et al. Detection of amphotericin B resistance in Candida
haemulonii and closely related species by use of the Etest, Vitek-2 yeast susceptibility system,
and CLSI and EUCAST broth microdilution methods. J Clin Microbiol. 50(6), 1852–5, 2015.
SICK, Helmut. Ornitologia Brasileira. 4. ed. Rio de Janeiro: Nova Fronteira, 2001.
SIDRIM, J.J.C.; ROCHA, M.F.G. Micologia médica à luz de autores contemporâneos. Rio de
Janeiro: Guanabara Koogan, 2004. 338p.
SIDRIM, J.J.C; MAIA, D.C.B.S.C.; BRILHANTE, R.S.N. et al. Candida species isolated
from the gastrointestinal tract of cockatiels (Nymphicus hollandicus): In vitro antifungal
susceptibility profile and phospholipase activity. Vet Microbiol, 145 (3-4): 324–328, 2010.
SILVA, G.M.; SILVA, C.M.F.; BRUNO, S.F.; ABREU, D.L.C. Enterobacteriaceae
identification of the intestinal microbiota in laying hens (Gallus gallus Linnaeus, 1758) from
Lohmann S.L.S. lineage. Rev Bras Ciênc Vet. 2004; 11: 153–155.
SOUZA, C.O.; RAMOS, F.L.P; MOTA, C.M.; SANTOS, L.V.S; LOPES, M.L. Resistência
antimicrobiana de Salmonella Typhi identificadas no Estado do Pará, Brasil. Rev Pan-
Amazônica de Saude., v. 2, p.61-65, 2010.
STOCK, I. e WIEDEMANN. Natural antimicrobial susceptibilities of Plesiomonas
shigelloides strains. J. Antimicrob. Chemother, 48, 803-811, 2001.
TEIXEIRA, D. M. e BEST, R. Adendas à ornitologia do Território Federal do Amapá. Bol.
Mus. Para. Emilio Goeldi. N. sér. (104): 1-25. 1981.
TORTORANO, A.M.; PRIGITANO, A.; BIRAGHI, E.; VIVIANI, M.A. The European
Confederation of Medical Mycology (ECMM) survey of candidaemia in Italy: in vitro
susceptibility of 375 Candida albicans isolates and biofilm production. J Antimicrob
Chemother, 56 (4):777–779, 2005.
TRABULSI, L. R.; ALTERTHUM, F. Microbiologia. 4ª Ed. São Paulo: Atheneu, 718p. 2005.
86
TUON. F.F; COSTA, S.F. Rhodotorula infection: a systematic review of 128 cases from
literature. Revista Iberoamericana de Micologia, v.25, p. 135-140, 2008.
VANDEPITTE, J; VAN DAMME, L; FOFANA, Y; DESMYTER, J. Edwardsiella tarda and
Plesiomonas shigelloides. Their role as diarrhea agents and their epidemiology. Bull Soc
Pathol Exot Fil 73:139–149, 1980.
VELASCO, M.C. Candidiasis and Cryptococcosis in birds. Seminars in Avian and Exotic Pet
Medicine, v.9, n.2, p.75- 81, 2000.
WANG, G.; CLARK, C.G.; LIU, C.; PUCKNELL, C.; MUNRO, C.K.; KRUK, T.M.A.C. et
al. Detection and characterization of the hemolysin genes in Aeromonas hydrophila and
Aeromonas sobria by multiplex PCR. J. Clin. Microbiol, 41(3): 1048–54, 2003.
WIRTH, F., GOLDANI, L.Z. Epidemiology of Rhodotorula: an emerging pathogen.
Interdiscip. Perspect. Infect. Dis. doi:10.1155/2012/465717. PMID: 23091485, 2012.
YAMADA, S.; MATSUSHITA, S.; DEJSIRILERT, S.; KUDOH, Y. Incidence and clinical
symptoms of Aeromonas associated traveller’s diarrhoea in Tokyo. Epidemiology and
Infection, v. 119, p. 121-26, 1997.
87
APÊNDICE A- Autorização para atividades com finalidade cientifica - SISBIO
88
APÊNDICE B- Autorização do Comitê de Ética da UECE