UNIVERSIDADE DE LISBOA

FACULDADE DE CIÊNCIAS

DEPARTAMENTO DE BIOLOGIA VEGETAL

GENE EXPRESSION DURING PLASMODIUM

TRANSMISSION

Dissertação

Neuza Arrimar Duarte

Mestrado em Biologia Molecular e Genética

2013

UNIVERSIDADE DE LISBOA

FACULDADE DE CIÊNCIAS

DEPARTAMENTO DE BIOLOGIA VEGETAL

GENE EXPRESSION DURING PLASMODIUM

TRANSMISSION

Dissertação orientada por:

Doutor Jorge Miguel L. Marques da Silva, Faculdade de Ciências, Universidade de Lisboa

Doutora Patrícia Agostinho Gonçalves Costa da Silva, Instituto Medicina Molecular

Mestrado em Biologia Molecular e Genética

2013

1

Acknowledgments

To all the UPAMOL team, a sincere thank you for having me during this last year.

To Patrícia who kindly accepted me as her student and diligently helped me in everything I

needed. To Jorge, whom I’m already picturing as a P.I….for giving me the opportunity of

working with him these last months. Two both for all the time you took teaching me

everything I needed… and for this long correction marathon.

To Ana, the “always on top of things” lab manager, who always has a solution for everything,

and who would always narrate to you the online news the funniest way.

To Gunnar, who gave me the opportunity of working in his group, whose work is an

inspiration for everyone in this field. Sorry for any inconvenience I may have caused you.

Most importantly, thank you UPAMOL for showing me how a group is supposed to be like.

UPAMOL fighting!

To Prof. Jorge Silva, my internal supervisor, for helping me with all the thesis issues.

To everyone in UPAR, our neighbours, for always being hyper, enthusiastic and a mood

raiser. In particular to Leonor, former UPAMOL member, and current UPAR lab manager, for

being a one-of-kind person and for the promptly assistance you would give me, and

everyone else, when needed.

To everyone in UMA, who were always nice and helpful to me. To Vanessa, for the liver

samples. To Ana Parreira just because you’re the coolest insectary technician ever! To

Joana Dias, wish you great luck in your future!

To our friendly invaders, Miguel Prudêncio’s lab, even though our cohabitation was short,

you were always nice to me. Inês, your geekiness and personality always makes you a nice

presence to have around.

To Patrícia Meireles, my “sister”, flat mate, and former companion in the trenches of the

Biochemistry battlefield in Porto… well, there’s no need for words, you rock! さいこう！

Also, to my other “sister” Sarinha, for all these years of friendship. Good luck in your PhD!

Most importantly, to my family, mom, dad, sista, grandma and grandpa… for whom I always

did my best. Even though things haven’t always turned out the way we wanted…we are

gonna make it! Mamy, you are going to be a published writer, for sure!

To all, thanks!

2

Abbreviations used 3’UTR: 3’ untranslated region

5’UTR: 5’ untranslated region

cDNA: complementary DNA

CITH: CAR-I and fly Trailer Hitch Homolog

DHHC-CRD: Asp-His-His-Cys Cystein rich domain

DNA: Deoxyribonucleic acid

DOZI: Development of Zygote Inhibited

DTT: Dithiothreitol

EEF: Exo-erythtrocytic forms

EPSF: Essential Protein for Sporozoite Formation

Fig.: Figure

GFP: Green fluorescent protein

HIV/AIDS: Human immunodeficiency virus infection / acquired

immunodeficiency syndrome

HRP: Horseradish peroxidase

Hsp70: 70 kDa heat shock protein

IFA: Immunofluorescence assay

IP: Immunoprecipitation

IPET: Invasion Protein Essential for Transmission

iRBC: infected RBC

kDa: kilodalton

LB medium: Lysogeny Broth medium

MG Spz: Midgut sporozoites

mRNA: messenger RNA

mRNP: messenger ribonucleoprotein

ook: ookinete

PAT: Protein S-acyl transferase

PbSR: Plasmodium berghei scavenger receptor-like protein

PBS: Phosphate buffered saline

p.i.: post-infection

PCR: Polymerase chain reaction

PTM: Post-translational modification

PUF: Pumilio protein

RNA: Ribonucleic acid

RBC: Red blood cell

RT: Room temperature

SDS: Sodium dodecyl sulfate

3

SDS-PAGE: Sodium dodecyl sulfate Polyacrylamide gel

electrophoresis

SG Spz: Salivary glands sporozoites

SOC: Super Optimal Broth

TAE: Tris-acetate-EDTA

TAP: Transcription associated protein

TBV: Transmission blocking vaccine

TE: Tris-EDTA

TF: Transcription factor

tgdhfr/ts: Toxoplasma gondii dihydrofolate reductase/ thymidylate

synthase

TMD: Transmembrane domain

uis4: upregulated in infectious sporozoites gene 4

WT: Wild type

4

Abstract

Malaria is an infectious disease caused by the Plasmodium parasite that is transmitted

by the bite of a female Anopheles mosquito to its host. Nowadays, malaria still constitutes to

be a major burden despite the enormous progression made in different strategies of

prevention and treatment. Plasmodium exhibits a complex life cycle whose mechanisms of

regulation are still a matter of intense research and debate. Translational repression is a

post-transcriptional mechanism that allows regulation of transcripts translation both spatially

and temporally. In the P. berghei female gametocytes, DOZI- (Development of Zygote

Inhibited) and CITH- (CAR-I and fly TrailerHitch Homology) defined translational repressor

complexes have a vital role in maintaining in a quiescent state certain messenger RNAs

(mRNAs) that will be translated later on, during post-fertilization development. On the other

hand, PUF2 (Pumilio 2) protein was found to have a similar vital role but at the sporozoite

stage in maintaining their latency by translationally repressing certain transcripts. In addition,

P. falciparum PUF2 protein was shown to regulate sexual development and differentiation,

although in P. berghei it has not been possible to confirm such role for PUF2 protein. Our

findings suggest that dhhc10 (Asp-His-His-Cys cysteine-rich domain – DHHC-CRD family

member), ipet (Invasion Protein Essential for Transmission) and epsf (Essential Protein for

Sporozoite Formation) transcripts are translationally repressed by the DOZI- and CITH-

defined repressor complexes. In the ookinetes, they are translated and apparently stored in

crystalloid bodies. Protein palmitoylation mediated by DHHC10 will have then a vital role in

sporozoite formation. Lack of EPSF also leads to the absence of oocyst sporulation. Our

results further confirm the dynamic and complex nature of post-transcriptional gene

regulation in the Plasmodium life cycle, and its importance in the parasite transmission.

Keywords: CITH, development, DOZI, gametocytes, mRNPs, ookinete, oocyst,

Plasmodium, PUF proteins, sporozoite, translational repression, transmission

5

Resumo

A malária é uma doença infecciosa causada por parasitas do género Plasmodium

pertencente ao filo Apicomplexa, cujo modo de transmissão requer um vector, um mosquito

fêmea do género Anopheles. A espécie responsável pela forma mais mortífera de malária

denomina-se Plasmodium falciparum, que possui uma incidência mais prevalente nas

regiões de África. De acordo com o World Malaria Report (WMR) de 2012, as populações

com um maior risco de contrair malária estão localizadas nas regiões a sul do Sahara. As

estimativas indicam que o número de pessoas em risco de contrair malária em 2011 seria de

3,3 biliões de pessoas no mundo inteiro. Nos últimos anos diferentes estratégias foram

desenvolvidas para combater esta doença, ainda considerada como uma das três grandes

doenças infecciosas, a par com HIV/AIDS (Human Immunodeficiency Virus/ Acquired

Immunodeficiency Syndrome) e tuberculose. Exemplos dessas estratégias incluem métodos

de prevenção, como é o caso das redes impregnadas com insecticidas de longa duração, e

também as várias formas de tratamento com diferentes combinações de fármacos.

Actualmente, o problema que se considera difícil de contornar na luta contra a malária é a

capacidade que o parasita tem de adquirir resistência aos fármacos antimaláricos, como é o

caso da artemisinina; mas para além disso, a aquisição de resistência estende-se também

aos insecticidas.

O parasita da malária possui um ciclo de vida complexo que é caracterizado pela

presença de um hospedeiro humano, ou no caso do modelo usado no nosso estudo, um

morganho, e de um vector. A reprodução sexual ocorre na fase do ciclo de vida em que o

parasita se encontra no interior do mosquito e é um evento que ocorre apenas uma vez por

ciclo. Os mecanismos de regulação responsáveis pelo desenvolvimento e diferenciação

sexual do parasita permanecem por deslindar.

Devido ao facto dos hospedeiros e do vector possuírem ambientes fisiológicos muito

discrepantes, é imprescindível que haja uma rápida adaptação a nível celular e molecular

por parte do parasita e um controlo exacto da expressão génica ao longo do seu ciclo de

vida. No entanto, a forma como é regulada a expressão génica no parasita ainda tem de ser

elucidada. Com a sequenciação do genoma de Plasmodium verificou-se que este possui

uma menor quantidade de proteínas associadas à transcrição (TAPs) do que seria de se

esperar para um genoma do seu tamanho. Este facto levou a que se colocasse a hipótese

de que a regulação transcricional em Plasmodium difere da de outros sistemas eucarióticos,

como por exemplo, a levedura.

A repressão da tradução é um mecanismo no qual um conjunto de mRNAs é movido

selectivamente para complexos ribonucleoproteicos (mRNPs) onde são armazenados,

sendo apenas traduzidos mais tarde no ciclo de vida. Este processo permite tanto uma

6

regulação temporal como uma regulação espacial da expressão das proteínas. Estudos

demonstraram que uma região rica em uridinas (designada U-rich region) encontrada nas

regiões 3’ ou 5’ não traduzidas (UTRs) dos mRNAs reprimidos, é um factor-chave neste

mecanismo de regulação. Ao longo dos últimos anos, a repressão da tradução tem vindo a

estabelecer-se como um mecanismo essencial no desenvolvimento sexual em Plasmodium.

Em gametócitos (as células percursoras sexuais) de P. berghei, demonstrou-se que os

mRNAs que dão origem às proteínas de superfície de oocinetos (o estadio seguinte após a

fertilização) P25 e P28 colocalizam com a DEAD-box RNA helicase DOZI (Development of

Zygote Inhibited) e com a Sm-like factor CITH (CAR-I/Trailer Hitch Homolog). DOZI e CITH

definem um complexo ribonucleoproteico composto por 16 factores principais, que incluem

eIF4E, um factor de iniciação da tradução e uma proteína de ligação à cauda poli-(A)

(PABP). Os complexos repressores definidos por DOZI e CITH reprimem a tradução de

certos mRNAs em gametócitos, que só irão ser utilizados mais tarde, após a fertilização.

A família PUF consiste em proteínas de ligação a RNA cujo papel principal é a

regulação pós-transcricional dos RNAs aos quais se ligam. A investigação incidente nesta

família de proteínas teve uma importância fulcral no desenvolvimento do conhecimento

sobre os mecanismos pós-transcrição. Em P. falciparum, PfPUF2 desempenha um papel

importante na regulação do desenvolvimento e diferenciação sexual. Em gametócitos, a

proteína PUF2 reprime a tradução de determinados transcritos, reprimindo assim a

diferenciação sexual. Por outro lado, em P. berghei, esporozoítos puf2-KO desenvolvem-se

precocemente dentro das glândulas salivares do mosquito, exibindo uma morfologia

característica de estadios posteriores, nomeadamente de estadios do fígado. PUF2 parece

ser então de extrema importância para a latência dos esporozoítos de P. berghei. Para além

disso, estes resultados demonstram que a repressão da tradução é um mecanismo

essencial para o controlo do desenvolvimento dos esporozoítos e da sua transmissão ao

hospedeiro.

O principal objectivo deste trabalho é obter uma compreensão mais aprofundada sobre

o papel dos complexos de repressão da tradução em gametócitos. Em gametócitos pbdozi-

KO, um número elevado de mRNAs estão sob e sobre-expressos em relação ao wild type

(WT). Usando uma análise por RIP-Chip foi possível confirmar que muitos desses transcritos

estão fisicamente ligados aos complexos repressores definidos por DOZI e CITH, sugerindo

que a sua tradução está a ser reprimida. Por outro lado, em P. berghei, a expressão de

PUF2 em gametócitos ainda não foi demonstrada. O estudo de mRNAs potencialmente

reprimidos pelos complexos definidos por DOZI e CITH, e também o estudo da proteína

PUF2, permitir-nos-á compreender mais aprofundadamente qual a importância destes

complexos repressores na expressão génica em gametócitos.

7

A immunoprecipitação (IP) de proteínas é uma técnica que permite o isolamento de

uma proteína em particular, através de anticorpos específicos, e de qualquer parceiro

(proteína ou ácido nucleico) que esteja fisicamente ligado à proteína alvo. Utilizou-se esta

técnica para confirmar a expressão de PUF2 em gametócitos de P. berghei e isolar

potenciais parceiros; infelizmente, não fomos bem-sucedidos nesta tarefa.

Foram também alvo de estudo neste projecto um conjunto de proteínas, denominadas

DHHC2 e DHHC10, enzimas da família das S-aciltransferase de Proteínas (PATs), IPET

(Invasion Protein Essential for Transmission) e EPSF (Essential Protein for Sporozoite

Formation). Foi proposto que a tradução destas proteínas seria reprimida pelos complexos

repressores definidos por DOZI e CITH, em gametócitos, tal como acontece com P25 e P28.

Para além disso, o facto de todas elas possuírem péptidos sinal e domínios

transmembranares, é uma forte indicação de que possam ser proteínas de superfície. Esta

possibilidade gera interesse adicional neste conjunto de proteínas já que, ao longo dos anos

foram descobertas várias proteínas de superfície com função essencial para a transmissão

do parasita, tendo muitas delas, tornado-se candidatos promissores a vacinas de bloqueio

de transmissão (TBVs). Estas vacinas têm como objectivo principal a diminuição do número

de mosquitos infectados, cessando o desenvolvimento do parasita no mosquito.

Os nossos resultados sugerem que os transcritos de dhhc10, ipet e epsf estão num

estado quiescente nos gametócitos, sendo a sua tradução reprimida nesta fase. Ao contrário

de dhhc2, cuja expressão proteica já existe nos gametócitod, não sendo por isso, a sua

tradução reprimida, como inicialmente previsto, pelos complexos repressores definidos por

DOZI e CITH. Mais tarde, já no interior do mosquito, a produção das proteínas DHHC10,

IPET e EPSF começa nos oocinetos, onde são armazenadas nos corpos cristalóides, e

usadas posteriormente, durante o desenvolvimento no mosquito. Os corpos cristalóides são

um organelo tipicamente encontrado em oocinetos e oocistos maduros, que se supõe

constituir um reservatório de proteínas que serão usadas pelo parasita durante o

desenvolvimento de oocistos. Para além disso, sabe-se que DHHC10 tem como função a

palmitoilação de proteínas – uma modificação pós-traducional de extrema importância no

controlo da actividade, localização e transporte de proteínas. Os parasitas KO desta

proteína não desenvolvem esporozoítos apesar do número de oocistos permanece normal

quando comparado com wild type (WT). Estes oocistos ∆dhhc10 apresentam contudo uma

morfologia aberrante, com oocistos não esporulados e vacuolados. Estes resultados indicam

que a palmitoilação de proteínas mediada por DHHC10 é essencial para o processo de

formação de esporozoítos. Paralelamente, os parasitas KO de EPSF também não

desenvolvem esporozoítos, indicando que esta proteína será essencial para a sua formação.

No geral, os nossos resultados confirmam o papel vital do mecanismo de repressão da

tradução no desenvolvimento sexual em Plasmodium. Para além disso, fornecem indicações

8

adicionais sobre a elevada e complexa estruturação dos mecanismos pós-transcricionais e

pós-traducionais que regulam o ciclo de vida deste parasita.

Palavras-chave: CITH, desenvolvimento, DOZI, esporozoíto, gametócitos, mRNPs,

oocineto, oocisto, Plasmodium, proteínas PUF, repressão da tradução, transmissão

9

Table of Contents

Acknowledgements…………………………………………………………………………………...1

Abbreviations…..………………………………………………………………………………………2

Abstract……….………………………………………………………………………………………..4

Resumo……………………………………………………………………………………………...…5

1 – Introduction……………………………………………………………..………………………..11

1.1. Malaria disease…………………………………………………………..……………………..11

1.2. Plasmodium life cycle………………………………………………………………………….12

1.3. Plasmodium regulation of gene expression…………………………………………………13

1.3.1. Translational repression in Plasmodium…………………………………………………..15

1.3.2. Translational repression and Plasmodium PUF2 protein………………………………..16

1.4. Aims of this work………………………………………………………………………………..17

2 – Materials and Methods………………………………………………………………………….18

2.1. Experimental animals…………………………………………………………………………..18

2.2. Reference P. berghei ANKA lines used……………………………………………………...18

2.3. Immunoprecipitation of PUF2 protein in P. berghei gametocytes………………………...19

2.3.1. puf2::gfp line………………………………………….……………………………………… 19

2.3.2. puf2::gfp sequencing…………………………………………………………………………19

2.3.3. IP of PUF2::GFP and DOZI::GFP in gametocytes and mixed blood stages…………..20

2.3.3.1. Nycodenz method………………………………………………………………………….20

2.3.3.2. Nycodenz method with enhanced gametocytaemia……………………………………20

2.3.3.3. PUF2::GFP and DOZI::GFP mixed blood stages IP using GFP-Trap® Kit………….20

2.3.4. Detection of PUF2::GFP and DOZI::GFP proteins in gametocytes and mixed blood

stages by Western blot analysis……………………………………………………………………21

2.4. DHHC2, DHHC10, IPET and EPSF mutant lines characterization, Western blot analysis

and expression profiles……………………………………………………………………………..21

2.4.1. Mosquito infections and bite-backs………………………………………………………...21

2.4.2. Genotyping and RT-PCRs of ∆dhhc10, ∆epsf, dhhc2::gfp, dhhc10::gfp, ipet::gfp and

epsf::gfp parasite lines………………………………………………………………………………22

2.4.3. Sequencing of ipet-main version and ipet-splice variant cDNA…………………………22

2.4.4. Life cycle RT-PCRs…………………………………………………………………………..23

2.4.5. Western blot analysis of CSP expression in oocysts from dhhc10-KO and epsf-KO

parasite lines…………………………………………………………………………………………23

2.4.6. Live imaging and immunofluorescence assays (IFAs) of blood stages, ookinetes,

oocysts and sporozoites……………………………………………………………………………24

2.4.7. Statistical methods…………………………………………………………………………..24

10

3 – Results and Discussion…………………………………………………………………………24

3.1. Immunoprecipitation of PUF2 protein in P. berghei gametocytes…………………………24

3.1.1. puf2::gfp sequencing…………………………………………………………………………27

3.1.2. Discussion…………………………………………………………………………………….27

3.2. Characterization of a set of proteins translationally repressed by DOZI and CITH defined

mRNPs………………………………………………………………………………………………..29

3.2.1. Confirmation of the targeted disruption of dhhc10 and epsf…………………………….29

3.2.2. Molecular analysis of GFP-tagged parasite lines…………………………………………29

3.2.3. Alternative splicing in ipet……………………………………………………………………29

3.2.4. Life cycle mRNA and protein expression profile and protein localization………………30.

3.2.5. dhhc10-KO and epsf-KO mutant phenotypes……………………………………………..34

3.2.6. Discussion…………………………………………………………………………………….37

3.2.6.1. DHHC10, IPET and EPSF role in Plasmodium life cycle……………………………...37

3.2.6.2. DHHC family in Plasmodium berghei: DHHC2 and DHHC10…………………………38

4 – Conclusions……………………………………………………………………………………...39

5 – References……………………………………………………………………………………….40

6 – Appendix I………………………………………………………………………………………..44

7 – Appendix II……………………………………………………………………………………….44

8 – Appendix III……………...……………………………………………………………………… 45

9 – Appendix IV………………………………………………………………………………………47

11

1 – Introduction

1.1. Malaria disease

Malaria is an infectious disease caused by parasites of the genus Plasmodium [1],

belonging to the Phylum Apicomplexa [2], that are transmitted by a vector, a female mosquito

of the genus Anopheles, to its host [1]. Five Plasmodium species can cause human malaria:

P. falciparum, P. vivax, P. ovale, P. malariae and P. knowlesi [1]. The responsible for the

deadliest form of malaria is P. falciparum, which has a prevailing incidence in the region of

Africa [3]. A remarkable feature of the Plasmodium parasite is the restrictedness of the hosts

they choose, only closely related vertebrates are infected by the around 5000 Plasmodium

species described [4]. Plasmodium host exclusiveness has been supported by molecular

phylogenetic studies, which have demonstrated the evolutionary relatedness between the

different species that infect mammals [2]. In malaria research, there are several Plasmodium

species that, over the years, became essential to its development; among these we have the

primate malaria model Plasmodium knowlesi, which is a macaque monkey’s parasite in the

wild, and three rodent malaria parasites, Plasmodium berghei, Plasmodium yoelli and

Plasmodium chabaudi, which infect thicket rats in central Africa [5]. The rodent malaria

parasite P. berghei was used as a malaria research model in the present study.

According to the World Malaria Report of 2012, the estimate number of people at risk

of acquiring malaria in 2011 was 3,3 billion people worldwide; more particularly, the

populations at a higher risk are located in the regions of sub-Saharan Africa [3]. In the last

years, many different strategies have been developed to fight the malaria burden; relevant

examples include nets treated with long-term insecticides and also combination of drug

therapies. These strategies proved their success as a strong reduction of malaria cases was

achieved among several regions, while in others complete eradication was successfully

accomplished [6]. Nowadays, a central problem in the fight against malaria is the ability of

the Plasmodium parasite to acquire resistance to antimalarial drugs, like artemisinin, and

also insecticides [7]. In addition, as in any other disease control program, the success also

depends largely on a continuous funding [7]. Presently, there are 104 countries marked as

endemic areas, 99 of these have ongoing malaria transmission, and the remaining ones are

in the prevention or reintroduction phases [3].

Uncomplicated malaria is characterized by sporadic febrile episodes which the host’s

immune system is capable of controlling, and eventually, eliminate [8]. In contrast, severe

malaria may cause death and is characterized by one or a combination of the following

syndromes: cerebral malaria, metabolic acidosis and severe anemia [8]. Cerebral malaria

and metabolic acidosis have a mortality rate of 15-20%, even with artemisinin derivatives

treatment. Moreover, neurological impairment is a common feature among the survivors [8].

12

The ones most affected by severe malaria are children under five years and pregnant women

[3]. The main aim of today’s antimalarial drugs is to prevent progression to severe disease by

targeting the asexual blood stages responsible for the symptoms of the disease [8].

1.2. Plasmodium life cycle

The malaria parasite exhibits a complex life cycle that involves a vertebrate, human

host (or a mouse in the rodent model) and a mosquito vector, as depicted in Fig. 1. Sexual

reproduction occurs in the mosquito; its regulation and the formation of sexual precursors in

infected red blood cells (iRBC) is still unclear, but it was shown for P. falciparum, that the

commitment to sexual differentiation occurs before schizont maturation [9]. During a blood

meal, the mosquito ingests gametocytes and, in the mosquito midgut lumen, the formation of

gametes (gametogenesis) is initiated. Male gametogenesis, termed exflagellation, is

triggered by a set of environmental cues: xanthurenic-acid (a molecule present in the

mosquito) and temperature and pH changes [10]. When fertilization occurs, a diploid zygote

is formed, followed by a tetraploid motile ookinete. The ookinete route includes traversing of

the midgut epithelial cells and subsequent exit through the basal lamina of the epithelium.

This process activates the ookinete to switch from a cell traversal mode to a sessile mode

called oocyst [10]. Oocysts go through a process of plasma membrane invagination, forming

sporoblasts, through which sporozoites will bud-off [10]. The process of sporozoite formation

takes place during a time period of 2 weeks, and after mature oocysts rupture, sporozoites

are released into the haemolymph. From this point on, sporozoites travel to the salivary

glands of the mosquito, invade them, and reach the salivary duct, their journey’s destination,

where they can be injected into a new host during a subsequent blood feeding by the

mosquito [1].

Plasmodium sporozoites are transmitted to a mammalian host during the bite of an

infected mosquito and are deposited in the dermis of the host. However, as it was shown by

Amino et al. (2006), only a proportion of the parasites have the capability of entering the

blood capillaries, the remaining is drained by the lymphatics [11]. Once inside the circulatory

system, sporozoites rapidly reach the liver [10, 12]. Sporozoites traverse a number of

hepatocytes before reaching and invading a final hepatocyte, using a membrane-associated

actin-myosin motor [10]. This traversal process was shown by Mota et al. (2001) to be

essential for the completion of the life cycle, hypothesizing that sporozoites might need to

traverse a number of cells, so that signaling pathways essential for entry and development

inside the hepatocyte can be activated [13]. Inside the final hepatocyte, sporozoites will

develop and multiply, giving rise to thousands of merozoites [12]. The release of Plasmodium

merozoites from hepatocytes is a vital step in the life cycle of this intracellular pathogen. The

common place idea was that the release of merozoites would occur after hepatocyte rupture.

13

However, Sturm et al. (2006) showed that parasites induce hepatocyte death, and

subsequently bud-off inside vesicles (merosomes) into the sinusoid lumen [14]. After being

released from the merosomes, the merozoites invade the host’s red blood cells and the

blood stage of infection begins. The intraerythrocytic parasite development includes the ring,

trophozoite, and schizont stages, and ultimately the formation of new merozoites. To

successfully enter a new red blood cell (RBC), the merozoite must be very quick in selecting

a RBC, adhere to it, enter and enclose itself inside it [15, 16, 17]. Some merozoites develop

into gametocytes, which when taken up by a mosquito during a blood meal allow for a

productive infection of the parasite’s vector [15].

Fig. 1 – Plasmodium life cycle. (A) Sporozoites

transmission to a human host during a blood meal of a

infected mosquito; (B) Traversal of several hepatocytes

before invading a final one; (C) Release of merozoites into

the bloodstream; (D) Merozoite infection of red blood cells;

(E) Formation of male and female gametocytes; (F)

Ingestion of gametocytes by the mosquito during a blood

meal; (G) Gametes fertilization in the mosquito midgut and

further development into ookinetes, and later on, to

oocysts; (H) Migration of sporozoites to the salivary glands

of the mosquito and transmission to another human host

during the next blood meal (Adapted from [18]).

1.3. Plasmodium regulation of gene expression

How the Plasmodium parasite regulates and manages gene expression has been a

matter of intense research and debate [19, 20]. Our malaria study model P. berghei has an

estimated genome size of approximately 18Mbp [21], very similar to P. falciparum (22.8 Mbp)

[22], and also like P. falciparum, an exceptionally high A+T composition [22, 23]. Both P.

berghei and P. falciparum have their genome split in 14 chromossomes [22, 24]. P.

falciparum genome sequencing made available an enormously amount of information about

its composition and characteristics. Particularly, an interesting feature was revealed about

this parasite, it possesses a small amount of transcription associated proteins (TAPs) [22].

This observation was the starting point for the hypothesis that transcriptional regulation in

Plasmodium is most probably unlike that of others well studied eukaryotic systems, like yeast

or mammalian cells [19, 25]. Van Noort et al. (2006) proposed that the few regulatory

proteins encountered in Plasmodium regulate gene expression in a combinatorial manner,

14

relying on a higher number of regulatory DNA sequences per gene than those observed in

other eukaryotes [26].

Until 2005, no specific transcription factors in Plasmodium had been reported. Balaji et

al. (2005) were the first to describe a group of conserved proteins containing putative AP2

DNA-binding domains, referred nowadays as the Apicomplexan AP2 (ApiAP2) protein family.

The P. falciparum ApiAP2 gene family was reported to have 27 members, with a high degree

of conservation between Plasmodium species and with DNA binding domains closely related

to the ones found in transcription factors of other eukaryotes [27]. Even though it was initially

thought that the Plasmodium ApiAP2 would have a prominent role in asexual blood stages,

transcriptional and proteomic studies indicated that possibly they are required throughout the

life cycle [28]. Furthermore, it was shown that the Plasmodium transcription factor (TF) AP2-

O activates gene expression in ookinetes [29], providing additional evidence for a significant

role of this TF family in gene regulation.

The combination of high-throughput techniques and bioinformatics in malaria research

were decisive tools to uncover the prominent role of post-transcriptional regulation in the

Pasmodium parasite [20]. A global analysis of transcript and proteins levels in P. falciparum

is an example of such studies, where it was possible to identify the delay between mRNA

and protein accumulation as the most common expression pattern. In the last years, it

became clear that stage-specific gene regulation is essential for the parasite, which is

illustrated by reports in transcriptional regulation during asexual and sexual development.

Bozdech et al. (2003) analyzed the transcriptome of P. falciparum complete asexual

intraerythrocytic developmental cycle transcriptome and proposed a model for the parasite

transcriptional regulation. The authors compare the transcriptome at this stage of

development to a “just-in-time manufacturing process”, where a gene induction is a onetime

event per cycle and only at the required moment [30]. The existence of sex-specific genes in

Plasmodium was established by Khan et al. (2005), leading to an enormous progress in

uncovering the mechanisms of sexual development regulation. By analyzing the proteome of

separate male and female gametocytes, the authors showed that the male proteome

contained 36% of male-specific proteins and the female proteome 19% of female-specific

proteins [31]. Uncovering the role played by post-transcriptional mechanisms role in

Plasmodium sexual differentiation began when it was shown that p25 and p28 (genes

encoding ookinete surface proteins) mRNAs were kept in a quiescent state in female

gametocytes. These stored transcripts were only, later on, translated in gametes and zygotes

[32]. This process was termed translational repression, and it will be discussed with further

detail in 1.3.1. section. Further studies demonstrated, both in human and rodent malaria

parasites, that an additional substantial amount of mRNAs were also stored in gametocytes

and only translated in a later stage, namely in gametes [21, 33]. The studies mentioned

15

above emphasize that precise regulation of transcription is essential for the parasite, since

dynamic expression of transcripts seems like a critical mechanism at several points during

the intraerythrocytic life cycle.

1.3.1. Translational repression in Plasmodium

Translational repression is a mechanism in which certain mRNAs are selectively

moved into cytoplasmic messenger ribonucleoprotein (mRNPs) complexes and are

maintained in a quiescent state for translation at a later time. This process allows the control

of both temporal and spatial protein expression [20, 34]. The mRNAs that are translationally

repressed in this manner usually possess a U-rich RNA region that can be found in the 3’ or

5’-untranslated regions (UTRs), which is a key factor for their regulation [35].

As mentioned above, both p25 and p28 mRNAs are kept untranslated in female

gametocytes ribonucleoparticles. It was found that these unstranslated p25 and p28 mRNAs

colocalize with the DEAD-box RNA helicase DOZI (Development of Zygote Inhibited) and

Sm-like factor CITH (CAR-I/Trailer Hitch Homolog) proteins in P. berghei [34, 36]. DOZI and

CITH disruption leads to a drastic reduction of abundance of both p25 and p28 mRNAs, as

well as of an additional 370 mRNAs [34, 36]. pbdozi and pbcith-KO female (but not male)

gametocytes do not form ookinetes after fertilization, which indicates that most likely a

fraction of these translationally repressed mRNAs are essential for this particular step of

development [34, 36]. P-granules have an important role in metazoan sexual development,

since they are the storage particles where the translationally silent transcripts are kept and

stabilized [36]. The idea of P-granules as stable storage places is strengthened by the

absence of RNA degradation factors in these granules [36]. A translational repression model

in gametocytes was established in which an mRNP complex is composed of CITH, DOZI and

16 major factors, including eIF4E, a translation initiation factor, and poly-(A)-binding protein,

as depicted in Fig. 2. This complex translationally represses mRNAs that will have a critical

role in the initial stages of the mosquito infection [36]. More recently, a biochemical

characterization of the DOZI homologue commonly known as DDX6 from Plasmodium

falciparum was presented, being the first report that shows the direct interaction between

DDX6 and PfeIF4E [37].

Fig.2 – DOZI and

CITH defined mRNP

structure in female

gametocytes.

16

1.3.2. Translational repression and Plasmodium PUF2 protein

The PUF family consists of RNA-binding proteins whose major role is post-

transcriptional regulation. The first two members of the PUF family to be analyzed in detail

were Drosophila melanogaster Pumilio and Caenorhabditis elegans FBF, so consequently,

the group was termed PUF or PUM-HD proteins [38, 39] PUF proteins regulate mRNAs by

binding to specific regions in the 3’-UTRs [40, 41, 42]. All members of the PUF family contain

a PUM-HD (Pumilio homology domain)-type RNA binding domain [39], that can physically

interact with both RNAs and proteins [40, 41]. PUM-HD-type RNA binding domain usually

has 8 consecutive Puf repeats, that normally consist of around 40 aminoacids with two short

flanking regions [38, 39]. Puf repeats are located in the C-terminus region of the protein and

are characterized by having a “core consensus” containing aromatic and basic residues and

[40]. Examples of this family functions are: development, differentiation, germline function,

neuronal function, memory, and mitochondrial and cell cycle biogenesis [40, 41, 42, 43]. The

preservation of stem cells mitotic potential has been proposed as an ancestral role for the

PUF family [40].

Studies focused on the PUF family had a major role in uncovering post-transcriptional

mechanisms [41]. The mechanism of mRNA repression was first described by Goldstrohm et

al. (2006), where the authors suggest that yeast PUF protein recruits factors that assist on its

role in mRNA repression and/or decay, namely proteins of the deanylase complex [45].

Moreover, it was also found that in many cases PUF proteins regulate specific sets of

transcripts whose encoded proteins have related functionalities [45]. For example, mRNAs

involved in organellar biosynthesis were found to be regulated spatially and temporally by

PUF proteins [45]. Since PUF proteins dynamically coordinate many transcripts, its own

regulation has to be extremely tight. Both their activity and expression are regulated at all

levels of gene expression, from transcription to post-translation [42].

In Plasmodium falciparum, PfPUF2 plays an important role in arresting sexual

development in gametocytes [46]. PfPUF2 was found to be expressed in both male and

female gametocytes, and deletion of this gene resulted in increased gametocyte formation

and a considerable higher male/female sex ratio [46]. In contrast, such role for PUF2 in

parasite sexual development and sex differentiation was not observed with the rodent P.

berghei. Interestingly though, P. berghei PUF2 was found to play a critical role in regulating

parasite development during transmission from the mosquito to the mammal host [47]. P.

berghei puf2-KO sporozoites exhibit a precocious development into exo-erythrocytic liver

stage forms (EEFs) inside mosquito salivary glands, showing that translational repression by

PUF2 is an essential control mechanism in sporozoite development [47], as depicted in Fig.

3. Other recent findings also support the idea of PUF2 as a key player in parasite

17

transmission between the mosquito and the mammalian host [48]. Their results suggest that

P. berghei PUF2 regulates IK2 (eIF2α kinase) inhibiting translation of certain transcripts in

salivary gland sporozoites [48]. The rodent P. yoelii PUF2 protein was also analyzed and,

despite some differences when compared with P. berghei, found to play a similar crucial role

in maintaining the homeostasis of specific transcripts and therefore ensuring a successful

parasite transmission from the mosquito to the mammalian host [49].

Fig.3 – Model for the regulation of development during transmission between mosquito and mammalian host having PUF2 protein as a key player (Adapted from [47]).

1.4. Aims of this work

Translational repression is an essential mechanism in sexual differentiation and

gametogenesis. DOZI and CITH roles at this stage have been well established, and evidence

is growing for a PUF2 role in the repression of transcripts in gametocytes. In pbdozi-KO

gametocytes, a great number of transcripts are up and downregulated [37], and RIP-Chip

analysis has been done to confirm that those transcripts are indeed being physically bound

to DOZI- and CITH-defined mRNPs (data not published), thus suggesting that they are

translationally repressed. In P. berghei, PUF2 expression in gametocytes has not yet been

demonstrated.

The main goal of this work is to further dissect the role of these translational repression

complexes in gametocytes. To do so, two different strategies were applied:

a) Perform immmunoprecipitation of PUF2::GFP in P. berghei gametocytes, to

confirme its expression at this stage, and subsequently use the IP-eluates to analyze the

candidate transcripts to be translationally repressed. In addition, the puf2::gfp parasite line

can be used to assess PUF2 localization using microscopy tools.

b) A set of transcripts predicted to be translationally repressed by the DOZI- and

CITH- defined complexes in P. berghei gametocytes (based on the previous data obtained

from the pbdozi-KO and pbcith-KO mutant parasite lines) were chosen using defined criteria

18

(please read below), and GFP-tagged and KO mutant parasite lines were constructed for

each selected gene. Using molecular biology tools, microscopy and Western blot analysis we

were able to characterize them in terms of protein expression, localization, transcription

profile throughout the life cycle and function. The selected genes, with their predicted

features, designations attributed and respective mutant parasite lines constructed in the lab,

are summarized in Appendix IV Table S1.

In the beginning of the selection process, a bigger set of genes were chosen that had

the common characteristic of possessing either a signal peptide, transmembrane domains

(TMDs) or both, indicating that they could potentially be surface proteins, and like many

others discovered in the last years, be of relevance for Plasmodium development in the

mosquito. Preliminary data of the KO-parasite lines for dhhc10, ipet (Invasion Protein

Essential for Transmission) and epsf (Essential Protein for Sporozoite Formation), rendered

them as promising for further studies. DHHC10, as well as DHHC2, another protein studied

in this work, belong to a family of proteins called Asp-His-His-Cys cysteine-rich domain

(DHHC-CRD) S-acyltransferase (PAT) family. This group of enzymes catalyzes the transfer

of a palmitate from palmitoyl-CoA to a protein, a post-translational modification termed

protein palmitoylation. A recent report states that some apicomplexan-specific DHHCs are

essential for parasite growth [50], leading us to an additional interest in this family of proteins,

aiming at a better understanding of the role of these enzymes in P. berghei life cycle,

specially within its mosquito vector.

2 – Material and Methods

2.1. Experimental animals. Female Balb/c ByJ mice (6–8 weeks bred at Charles River,

France) were used. All animal experimentation protocols were approved by the IMM Animal

Care Committee and performed according to EU regulations.

2.2. Reference P.berghei ANKA lines used. Four reference P. berghei ANKA parasite lines

were used in the present work: line HPEcy1m50cl1, a wild-type non-gametocyte producer

clone (Janse et al., 1989); line 820cl1m1cl1 (WT Fluo-frmg; RMgm-164) expressing RFP

under the control of the female gametocyte specific promoter of lap4(ccp2) gene

(PBANKA_131950) and GFP under the control of the male gametocyte specific promoter of

dynein heavy chain gene (PBANKA_041610); line 259cl1 (WT PbGFPcon; RMgm-5)

expressing GFP under the control of the constitutive eef1a promoter; and line cl15cy1 (WT).

Lines 820cl1m1cl1 and contain the transgene integrated into the silent 230p gene locus

(PBANKA_030600) and do not contain a drug-selectable marker. Line 259cl1 contains the

transgene integrated into the small subunit ribosomal rna gene (c-type unit) and does contain

the tgdhfr/ts drug selectable marker.

19

2.3. Immunoprecipitation of PUF2 protein in P. berghei gametocytes

2.3.1. puf2::gfp line. The mutant parasite line that expresses a C-terminally GFP-tagged

version of PUF2 (PBANKA_071920) was previously constructed in the lab (parasite line

1750cl4; data not published).

2.3.2. puf2::gfp sequencing. PUF2::GFP genomic DNA and gametocytes cDNA of were used.

Primers used for both gDNA and cDNA were: g0477 X g0459c; TRAP gDNA was used as a

positive control with the primers g0432 X g0433c. PUF2::GFP PCR products were obtained

using a 50µL PCR mix reaction containing: 10X Taq Buffer with 500mM KCl (Thermo

Scientific), 2mM MgCl2 (Thermo Sientific), 15mM of each primer, 10mM dNTPs, 1µl 5U Taq

DNA Polymerase (Thermo Scientific) and 2µL of DNA sample. Cycling conditions used were:

initial denaturation at 94°C for 3 minutes, followed by 45 cycles of denaturation at 94°C for 10

seconds, annealing at 55°C for 30 seconds and extension at 62°C for 30 seconds. A final

round at 62°C for 10 minutes allowed complete elongation of the PCR product. 5µL of a 1:50

dilution of the PCR products were loaded in a 1% agarose gel to confirm amplification. The

PCR products obtained were cloned using the kit mentioned in Appendix I Table S2. and

transformation was performed using 50µL of DH5α competent cells and 1µL of plasmid.

Samples were incubated on ice for 20 minutes, followed by a thermal shock of 45 seconds at

42°C and by 2 minutes on ice. 1mL LB medium was used to incubate the bacteria for 1 hour

at 37°C. Afterwards, 100µL were plated directly in LB agar plates supplemented with

ampicillin (100µL/mL) and left incubating overnight at 37°C. Colonies were picked from the

plates and mini-prep cultures were grown in 2mL LB medium supplemented with ampicillin

overnight at 37°C. Plasmid DNA extraction was performed used the kit mentioned in

Appendix I Table S2. Correct ligation of the insert into the plasmid was confirmed with a

restriction reaction using the enzymes XhoI (3U; from Promega, Madison, WI U.S.A.) and

XbaI (30U from Jena Bioscience), 1X NEBuffer 4 (BioLabs, Inc. New England), 100 X

Purified BSA (BioLabs, Inc. New England), mili-Q water (Millipore®) and 15µlL of the DNA

previously extracted (in a total volume reaction of 30µl) and incubated for 1 hour and 30

minutes at 37°C. The restriction product was loaded in a 1% agarose gel, and the PCR

products with the expected insert size were chosen. pJET plasmid containing the correct

inserts were used to prepare cultures for midi-preps in LB medium supplemented with

ampicillin and grown overnight at 37°C. DNA concentrations obtained were determined with

a Nanodrop-1000® Spectrophotometer. DNA samples were sequenced by Stabvida using

pJET forward and reverse primers. The sequences obtained were afterwards analyzed using

Finch TV Version 1.4.0 © and Clone Manager © Software.

20

2.3.3. Immunoprecipitation of PUF2::GFP and DOZI::GFP in gametocytes and mixed blood

stages

2.3.3.1.Nycodenz method. After sacrificing one mouse per each parasite line, heparinized

syringes were used to subtract the blood from each mouse by cardiac puncture. PBS was

added up to a volume of 2mL. Purified gametocytes were obtained by loading the blood on a

5mL of 49% Nycodenz solution in PBS, followed by a centrifugation of 20 minutes at 450 rcf

room temperature (RT) with acceleration 3 but no brake. The brownish layer was collected

from the gradient and centrifuged for 5 minutes at 450 rcf at RT. The supernatant was

discarded. The purified gametocytes obtained were washed two times in ice-cold “enriched”

PBS with spins of 5 minutes each at 450rct at 4ºC. Lysis of the parasites was done with 210

μl of NET-2++ buffer for 30 minutes at 4°C using a shaker. After lysis the extract was

centrifuged for 10 minutes at 14000 rpm and the supernatant collected. 50 μl extract were

used per IP with mouse anti-GFP-antibody (1µg Roche Diagnostics, Inc.), anti-c-myc-

antibody (1 μg, Sigma-Aldrich, St. Louis Missouri, USA) or beads-only and incubated for 1

hour at 4°C using a shaker. Another 50µL were saved for the control input sample. Protein G

Sepharose™ 4 Fast Flow beads (GE Healthcare), 20μL packed bead volume per IP,

previously washed 5x with NET-2 buffer and 2x with NET-2++ buffer were then added to

each sample and incubated for 1 hour and 30 minute at 4°C in a shaker. IP samples were

afterwards washed three times with 200μL NET-2 buffer with an additional final wash with

300µL NET-2 buffer. One third of the final wash was resuspended in 500µL TRIzol®

(Reagent for RNA from Ambion®), while the other two thirds were centrifuged and the beads

resuspended in 50µL 2X SDS-PAGE loading buffer and used for western blot analysis.

2.3.3.2. Nycodenz method with enhanced gametocytaemia. Enhanced gametocytemia was

obtained as described in [52]. Nycodenz purification and Immunoprecipitation were

performed as described in the previous section.

2.3.3.3. PUF2::GFP and DOZI::GFP mixed blood stages IP using GFP-Trap® Kit. After

sacrificing one mouse per each parasite line, heparinized syringes were used to subtract the

blood from each mouse by cardiac puncture. 1X RBC lysis buffer was added to the blood the

lysis step performed on ice until the solution became translucent. After a centrifugation of 8

minutes at 2000 rpm, an extra lysis step was performed using 0,1% saponin in PBS

supplement with protease inhibitors (1 tablet of Complete Mini, Roche) 30 minutes on ice.

After another 8 min 2000 rpm spin, the pellet was washed three times with enriched PBS.

Parasite lysis step was performed with 210 µL NET-2++ buffer during 30 minutes at 4°C

using a shaker and a 10 minute spin at maximum speed. 50µL of the lysate were saved as

21

the input fraction to which 50µL 2X SDS-PAGE loading buffer were added. From this point on,

GFP-Trap® _A Kit for Immunoprecipitation of GFP Fusion Proteins (Chromotek) Protocol

(2012-12-07 version) was used starting from step 4.

2.3.4. Detection of PUF2::GFP and DOZI::GFP protein in gametocytes and mixed blood

stages by Western Blot analysis. For Western Blot analysis 15 to 25 µL of IP samples from

purified PUF2::GFP and DOZI::GFP gametocytes as well as mixed blood stages were used.

DTT (200mM final concentration) was added to the samples before the denaturing step at

95°C for 10 minutes. Samples were loaded in a precast gel (BioRad, Any-kD™) and ran the

required time to obtain a desirable band separation at the molecular weight of interest

(PUF2::GFP and DOZI::GFP expected molecular weight were ~83kDa and ~76kDa,

respectively). Using a wet transfer system, the proteins were transferred to a nitrocellulose

membrane for 1 hour and 45 minutes at 200mA. The nitrocellulose membrane was then

blocked for 1 hour at RT with 5% skim milk in 0,05% PBS/Tween 20 and afterwards probed

with anti-GFP antibody in blocking solution overnight at 4ºC. Rabbit anti-GFP (Invitrogen)

and rabbit anti-GFP (Sigma-Aldrich, St. Louis Missouri, USA) were used in a dilution of 1:500

and anti-GFP Roche was used in a dilution of 1:5000. After washing the membrane two

times, 10 minutes each with 0,05% PBS/Tween 20, it was probed with a secondary antibody

for 3 hours at 4°C. HRP-conjugated donkey anti-rabbit (Jackson ImmunoResearch

Laboratories, Inc., West Grove, PA) was used in a 1:500 dilution and HRP-conjugated goat

anti-mouse (Santa Cruz Biotechnology Inc.) was used in a 1:5000 dilution. The membrane

was then washed with 0,05% PBS/Tween 20 developed using Immobilon® Western

Chemiluminescent HRP Substrate (Millipore®).

2.4. DHHC2, DHHC10, IPET and EPSF mutant lines characterization, Western blot

analysis and expression profiles

2.4.1. Mosquito infections and bite-backs. For mosquito passage of the different parasite

lines used in this study, female Balb/c ByJ mice (6–8 weeks years old) were infected

intraperitoneally (IP) with 106 iRBCs of each line. On days 4-5 post-infection (p.i.), these mice

were anesthetised and Anopheles stephensi female mosquitoes allowed to feed for 30 min.

Twenty-four hours after feeding, mosquitoes were anesthetized by cold shock and unfed

mosquitoes were removed. To determine oocyst burdens, mosquito midguts were dissected

at days 12 or 13 p.i., stained with mercurochrome and imaged using a Leica DMR

microscope. To determine oocyst diameters over time mosquito midguts were dissected at

days 12, 14, 16, 19 and 21/22 p.i. and imaged using a Leica DMR microscope. Oocysts were

counted and measured from these images using ImageJ 1.47n software (imagej.nih.gov/ij).

For confirmation of normal development of GFP-tagged parasite lines in mosquitoes, midguts

22

were dissected at different time points and directly imaged in a Leica DM5000B microscope.

For sporozoite (Spz) counting, midguts and salivary glands were dissected at days 20-22 p.i.,

mashed and Spz counted in a Neubauer chamber. For bite-back experiments, 10 starved

female infected mosquitoes were allowed to feed for 30 min on anesthetised naïve female

Balb/c ByJ mice (6–8 weeks years old) on days 20-21 p.i. (10 mosquitoes per mouse).

Successful feeding was confirmed by the presence of blood in the abdomen of mosquitoes.

Parasitemias in these mice were followed up to 32 days post-bite.

2.4.2. Genotyping and RT-PCRs of ∆dhhc10 and ∆epsf and dhhc2::gfp, dhhc10::gfp; ipet::gfp

and epsf::gfp lines Parasite genomic DNA extraction was done using the kit mentioned in

Appendix I Table S2. RNA extraction and cDNA synthesis was performed as stated in the

Appendix II (7.1 and 7.2). Genomic DNA samples were used in a 10 ng/µL concentration. For

cDNA samples, several dilutions were tested, and the most satisfactory was chosen. PCR

mix was done as described in the Appendix II (7.3) and PCR cycling conditions were the

following: initial step of 3 minutes at 95°C, followed by denaturation step of 10 seconds 95°C,

annealing step during 30 seconds using an appropriate annealing temperature, and an

extension step at 68°C for the required amount of time depending on the size of the

fragments amplified. Finally, an extension step of 10 minutes at 68°C was done. The variable

PCR conditions used for each PCR are summarized in the Appendix III Table S3. RNA

polymerase II was used as control genes; PbAcl15cy1 and PbA820cl1m1cl1 were used as

WT control lines for GFP-tagged lines and KO lines, respectively.

2.4.3. Sequencing of ipet-main version and ipet-splicing variant cDNA. Gel extraction of ipet

cDNA from a pool of several PCR products from RT+ PbAcl15cy1 WT mRNA (g1196 X

g1201c), with a final volume of 192µL (160µL of PCR product and 32 µL of 6X loading dye)

and RT+ 2180 GFP-tagged (g1196 X g0408c), with a final volume of 36 µL (30µL of PCR

product and 6 µL of 6X loading dye) was performed using the kit in Appendix I Table S2. The

cDNA extracted was eluted in 30 µL of Elution Buffer and quantified in a Nanodrop-1000®

Spectrophotometer, followed by cloning of the PCR products obtained in a commercial vector.

In the ligation reaction, 7µL of PCR product were used in a 20µL ligation reaction during 25

minutes. The resulting plasmid was transformed in E. coli DH5α chemically competent cells,

using 2 µL of product per 50 µL of cells and incubated on ice for 20 minutes. Then thermal

shock for 45 seconds at 42°C was done, followed by 2 minutes on ice. 950µL of SOC

medium (per tube) were used to incubate the cells for 1 hour at 37°C. Afterwards, 100µL

were plated directly in an agar plate supplemented with ampicillin (100µg/mL), the remaining

culture was centrifuged 3 minutes at 5000 rpm, and most of the supernatant was discarded

leaving around 200µL that were resuspended and plated. Cells were grown at 37°C

overnight. Mini-prep cultures were grown using 3 mL of LB medium supplemented with

23

ampicillin overnight at 37°C. Plasmid DNA extraction was done using the kit in Appendix I

Table S2 and the DNA obtained was diluted in a final volume of 50µL. Correct ligation of the

insert into the vector was confirmed with a restriction reaction using 0,5 µL of BgI-II 10 U/µL

(Fermentas), 1X Buffer Orange (Fermentas) and 5µL of the previously extracted DNA (in a

total volume reaction of 20µL) and incubated for 1 hour at 37°C. Five µL of 6X loading dye

was added to the restriction reaction and 10µl were in a 1% agarose gel in TAE Buffer.

Correctly cloned plasmids were chosen for sequencing using primers flanking the inserts

(provided with the kit) by Stabvida. The sequences obtained were analyzed using BioEdit

Sequence Alignment Editor Version 7.1.11© and Clone Manager© Software.

2.4.4. Life Cycle RT-PCRs. Asexual mixed blood stages originated from P. berghei HPE line

and asexual and gametocytes stages originated from P. berghei ANKA 820cl1m1cl1 line. In

vitro culture ookinetes 8-hours and 16-hours originated from P. berghei ANKA cl1515cy1 line.

Oocysts sample was obtained from oocysts day 12 p.i. P. berghei ANKA 820cl1m1cl1 line-

infected midguts. Midguts and salivary glands sporozoites samples were both obtained from

P. berghei ANKA 259cl1 parasite line at day 21 p.i.. In vivo exoerythrocytic forms 6 hours, 22

hours and 47 hours samples were obtained from P. berghei ANKA 259cl1 parasite line. RNA

extraction, cDNA synthesis and PCR mix were done as stated in Appendix II (7.1, 7.2. and

7.3). PCR cycling conditions were the following: initial step of 3 minutes at 95°C, followed by

denaturation step of 10 seconds 95°C, annealing step during 30 seconds using an

appropriate annealing temperature, and an extension step at 68°C for the required amount of

time depending on the size of the fragments amplified. Finally, an extension step of 10

minutes at 68°C was done. The variable PCR conditions used for each PCR are summarized

in the Appendix III Table S4. Five µL of each PCR product was loaded in a 3% agarose gel in

TAE Buffer. 18S and hsp70 were used as loading controls and p25, p28, dozi and uis4 were

used as control genes.

2.4.5. Western Blot analysis of CSP expression in oocysts from dhhc10-KO and epsf-KO

parasite lines. To determine circumsporozoite protein (CSP) expression in oocysts from

dhhc10-KO and epsf-KO parasite lines, WT (820cl1m1cl1), dhhc10-KO (PbA2097cl1) and

epsf-KO (PbA2099cl1m7) infected midguts were dissected at day 13 p.i. and resuspended in

1X Laemmli Buffer. DTT was added to a final concentration of 200 mM and samples were

boiled for 10 minutes at 95°C. Samples were loaded and ran the necessary time to obtain the

desired band separation at the molecular weights of interest, CSP and Hsp70 (loading

control) expected molecular weights were about 50kDa and 70kDa, respectively. Afterwards,

the proteins were transferred to nitrocellulose membranes for 1 hour and 45 minutes at

200mA. Nitrocellulose membranes were then blocked for 1 hour at RT with 5% skim milk in

PBS/Tween 20 0,05% and probed overnight at 4°C with 1:9000 Anti-CSP and 1:1000 Anti-

24

Hsp70 in blocking solution in the case of dhhc10-KO line, and in the case of epsf-KO line,

probed with 1:18000 Anti-CSP and 1:1000 Anti-Hsp70 in blocking solution. After 6 short

washes with 0,05% PBS/Tween 20, membranes were probed with HRP-conjugated anti-

mouse antibody for 1 hour at RT, 1:5000 for Hsp70 and 1:10000 for CSP, in the case of

dhhc10-KO line, and in the case of epsf-KO line, 1:5000 for Hsp70 and 1:20000 for CSP.

Finally, membranes were washed with PBS/Tween 20 0,05%, and developed using

Immobilon® Western Chemiluminescent HRP Substrate (Millipore®).

2.4.6. Live imaging and immunofluorescence assays (IFAs) of blood stages, ookinetes,

oocysts and sporozoites. Live imaging of blood stages and blood meal ookinetes of the

different GFP-tagged parasite lines was done by collecting infected red blood cells (iRBCs)

from infected mice and by collecting blood meals from infected mosquitoes, incubating with 1

ug/mL of Hoechst-33342/PBS and visualizing under a Leica DM5000B fluorescence

microscope. IFAs to detect GFP-tagged protein expression and localization in blood stages,

oocysts and sporozoites of the different GFP-tagged parasite lines used in this study were

done using rabbit polyclonal anti-GFP 1:100-1:500 as primary antibody and goat anti-rabbit

IgG-Alexa Fluor®488 1:400-1:500 as secondary antibody. IFAs to detect CSP expression and

localization in WT (820cl1m1cl1) and dhhc10-KO oocysts, as well as in dhhc2

and dhhc10::gfp sporozoites were done using mouse anti-CSP as primary antibody and goat

anti-mouse IgG-CyTM3 1:400-1:500 as secondary antibody. In all IFAs, the RBCs were

previously washed twice with 1X RPMI (GIBCO) with 8-min spins at 2000 rpm at 37°C, and

resuspended in 1X PBS at 37°C. Samples were fixed with 4%PFA/PBS for 10 min at RT,

permeabilised with 0.1-0.5% TritonX-100/PBS (for 10 minutes at RT) and blocked for 1h at

RT with 1-3% BSA/PBS. All antibody incubations were done in blocking solution for 1h at RT

and 1-5 ug/mL of Hoescht-33342/PBS was used to stain nuclei; 3X washes with 1X PBS

were done between incubations. Fluoromount-G™ (SouthernBiotech, U.K.) was used to

mount the coverslips. Images were taken with a Leica DM5000B or Zeiss Axiovert 200M

fluorescence microscope and processed using ImajeJ 1.47n software (imajej.nih.gov/ij).

2.4.7. Statistical methods. Statistical analysis of oocyst numbers per mosquito midgut,

sporozoite numbers per mosquito and oocyst diameters was performed using Mann-Whitney

test as part of Prism software package 5 (GraphPad Software).

3 – Results and Discussion

3.1. Immunoprecipitation of PUF2 Protein in P. berghei gametocytes

To study stage-specific expression of P. berghei PUF2 protein in gametocytes,

immunoprecipitations of PUF2::GFP fusion protein from Nycodenz-purified gametocytes

25

were performed. Western blot analysis of the total gametocyte lysate input, the specific

fraction (GFP) and control eluates (c-myc and beads fractions), showed that the protein

could only be detected in the input (Fig. 4). A band was observed in the input fraction

between 72 kDa and 100 kDa that could potentially correspond to PUF2::GFP detection

(which is expected to be around 83 kDa). No such putative PUF2::GFP protein could be

detected however in the specific immunoprecipitated samples (GFP fraction). A total of 5

independent IP experiments were performed to verify the consistency of the results obtained

using the Nycodenz method to purify gametocytes. In two out of five experiments (data not

shown), a putative PUF2::GFP protein was obtained in the input fraction, but not on the

specific eluate of the GFP fraction, similar to the result on Fig. 4; in the remaining three

experiments, PUF::GFP was not detected neither on the input fraction nor on the GFP-

fractions. The unsatisfactory results obtained led to the following hypotheses: a) faulty

execution of the protocol, or b) the IP method is not suitable for PUF2 protein in gametocytes.

Fig. 4 – Western blot analysis using rabbit anti-GFP (Invitrogen) of one

independent PUF2::GFP IP experiment in P. berghei gametocytes purified by the

Nycodenz method

To verify if the protocol was being correctly performed, a control IP was done in parallel

with PUF2::GFP, using the Nycodenz method (Fig. 5. a)). DOZI::GFP protein has been

demonstrated to be successfully immunoprecipitated in gametocytes [36]. As depicted in Fig.

5. a), no PUF2::GFP protein could be detected in neither the input nor the GFP fractions,

while our control line immunoprecipitated successfully, with DOZI::GFP being identified both

in the input fraction and in the specific GFP eluate (~80 kDa) (Fig. 5. a)). This led us to

hypothesize that maybe the gametocyte purified fraction obtained using the Nycodenz

method had an insufficient amount of material for us to be able to consistently detect

PUF2::GFP by Western blot analysis. To enhance gametocytemia in the PUF2::GFP infected

mouse, and subsequently in the IP starting material, phenylhydrazine was injected 2 days

before infecting the mice with puf2::gfp and dozi::gfp (as control) parasite lines, as previously

described [51]. Starting from day 3 post-infection sulfadiazine was added to their drinking

water [51]. Phenylhydrazine stimulates erythropoiesis and consequently, enhances

parasitemia early after infection. Sulfadiazine was used to suppress proliferation of asexual

stage parasites. The Western blot results show that again DOZI::GFP protein was identified

both in the input fraction and in the specific immunoprecipitate GFP eluate (Fig. 5. b). No

PUF2::GFP corresponding band was detected in any of the fractions (Fig. 5. b)). The results

suggest that this method, used with the intent of enhancing gametocytemia, did not improve

26

the amount of IP starting material. This strategy was therefore not successful in increasing

the detection of PUF2::GFP expression in purified gametocytes.

Fig. 5 – Western blot analysis of PUF2::GFP IP experiment

in parallel with DOZI::GFP IP (control line) in P. berghei

gametocytes purified by the Nycodenz method. a) Nycodenz

method only; b) Nycodenz method with enhanced

gametocytemia.

Another approach used to overcome the unsuccessful immunoprecipitation of

PUF2::GFP in gametocytes, was to perform the IP using the commercially available GFP-

Trap® Kit, a kit used specifically for immunoprecipitation of GFP-fusion proteins. This kit

contains a small GFP-binding protein covalently coupled to the surface of agarose beads. In

the previous method, the parasite material was first incubated with the anti-GFP antibody,

and afterwards the resulting complex PUF2::GFP/anti-GFP was incubated with beads. In this

kit, the GFP-binding protein is already coupled to beads, so the complex GFP-binding

protein/beads is directly incubated with the parasite material, saving time, extra handling of

the samples and ideally increasing the binding events and their stability.

Immunoprecipitations of PUF2::GFP and DOZI::GFP fusion proteins were performed using

mixed blood stages lysates (without gametocyte Nycodenz purification). Western blot

analysis of total mixed blood stages input, bound fraction (to the beads) and non-bound

fraction was performed using a mouse anti-GFP antibody (Roche). Unfortunately this

antibody gave a strong unspecific band pattern especially around 55 kDa (Fig. 6), which

most likely corresponds to the heavy chain of the antibody. Still, from this western blot, it can

be concluded that DOZI::GFP could easily be identified in input and bound fraction, while no

specific PUF2::GFP protein could be detected. The strong unspecific band pattern (Fig. 6)

masks the signal that could potentially correspond to PUF2::GFP protein in the input sample,

as a band between 72-100 kDa (the expected size for this protein is 83 kDa) can be

detected; however the fact that this band is not present in the bound fraction, while it is

detectable in the non-fractions of both IPs, argues that it is most likely non-specific and

unrelated to PUF2::GFP. Having a GFP-binding protein/beads complex would theoretically

improve the IP efficiency, as it significantly raises the chances for PUF2::GFP to “find” its

binding partner. However, this was not the case as PUF2::GFP was not successfully

immunoprecipitated using this strategy.

27

Fig. 6 – Western blot analysis of PUF2::GFP and DOZI::GFP IPs in

mixed blood stages using GFP-Trap® Kit. Non bound fraction abbreviated

as Non-B.

3.1.1. puf2::gfp sequencing

While dealing with the inability to immunoprecipitate PUF2::GFP in gametocytes and

mixed blood stages, another hypothesis emerged: what if puf2::gfp parasite line was not

expressing a functional PUF2::GFP fusion protein as expected? To verify this hypothesis,

two different types of samples were sequenced, puf2::gfp genomic DNA (gDNA) and cDNA

prepared from RNA isolated from mouse infected with the PUF2::GFP parasite line. The

primers used and their annealing positions are depicted in Fig. 7. A. puf2::gfp construct had

been designed changing the TGA linker to GGATCC, creating a BamHI restriction site (Fig.

7). Two single mismatches were found in the gfp gene, one synonymous at position 3529

and one at position 3396 that changes a methionine (ATG) to an isoleucine (ATA). Since the

gfp reading frame is still maintained and the mutations found most likely have a minor, if at all,

effect in the overall folding/functioning of the protein, we concluded that the puf2::gfp parasite

line used so far (1750cl4) should express a functional PUF2::GFP fusion protein.

Fig. 7 – puf2::gfp construct

sequencing. A. Schematic diagram

depicting puf2::gfp construct, showing

the sequencing primers (g0477 X

g0459c), their annealing position

(2956 and 3840, respectively), and

the GGATCC linker region between

puf2 and gfp. B. Alignment of

puf2::gfp theoretical construct

(denoted as PUF2::GFP_theore), and

the sequenced clones (two gDNA

clones (denoted as gDNA_clone_G2

and gDNA_clone_G4) and one cDNA clone (cDNA_clone_C4), focusing only on the linker region.

3.1.2. Discussion

Sexual development is a decisive point in the Plasmodium life cycle. In contrast to the

rigid determined progression in all the other stages [52], commitment to gametocytogenesis

is a process characterized by plasticity and in addition regulated by several environmental

factors [46]. Still, the molecular mechanisms governing sexual development and

differentiation remain to be elucidated.

28

PUF2 protein has been emerging as a stage-specific key regulator in Plasmodium. In P.

berghei, it was shown that PU2 protein has an essential role in parasite transmission

between the mosquito and the mammalian host [47]. In addition, further evidences in P.

falciparum suggest that PUF2 has a significant role in suppressing gametocyte differentiation

[46]. Moreover, PUF2 protein is only expressed in sexual stages (and not in asexual stages),

with a cytoplasmic evenly distributed localization [46]. These findings rendered PUF2 protein

as a strong candidate in the repression of transcripts in P. berghei.

Immunoprecipitation of proteins is a powerful technique that is used to isolate a

particular protein, and eventual partners, in a sample where are thousands of other proteins.

By using this technique, it would be possible to confirm PUF2 protein expression in P.

berghei gametocytes and, in addition, create a starting point to study proteins interactions

either with other proteins or with RNA, in the case of RNA-binding proteins. When a protein is

immunoprecipitated, the RNAs that physically interact with it will also be isolated and can be

further identified.

DOZI alongside with CITH protein define a translation repressor complex with an

established role in sexual development [36]. DOZI::GFP and CITH::GFP were shown to

immunoprecipitate successfully in gametocytes, and since then, this complex has been

further characterized [34, 36]. In these studies, immunoprecipitations were performed with

purified gametocytes obtained by the Nycodenz method using blood extracted from one

mouse. Unfortunately, our results demonstrate that the aforementioned IP strategy is not

successful when applied to PUF2::GFP fusion protein. One possibility is that PUF2

expression is much lower when compared to DOZI, and the same IP starting material will

allow detecting DOZI::GFP but not PUF2::GFP. Using a commercial IP kit for GFP fusion

proteins, an improvement in the interaction between the GFP-binding protein and

PUF2::GFP was expected. However, no PUF2 expression was detected, reinforcing the idea

that our handicap was the insufficient amount of gametocyte lysate. Taking our results into

account, the next step would be to perform the IP protocol with a higher number of mice per

each GFP-tagged fusion protein. Using this strategy, it would be possible to define the

detection limit in Western Blot analysis for immunoprecipitated PUF2::GFP. In addition,

preliminary immunofluorescence results (data not shown) indicate that P. berghei

PUF2::GFP is not only expressed in the gametocytes but also in asexual blood stages,

therefore, using mixed blood stages lysates instead of purified gametocytes might be

advantageous. Further studies are required to outline the optimal strategy to

immunoprecipitate PUF2::GFP tagged fusion in P. berghei gametocytes.

29

3.2. Characterization of a set of proteins translationally repressed by the DOZI and

CITH defined mRNP complex

3.2.1. Confirmation of the targeted disruption of dhhc10 and epsf

To investigate the function of PbDHHC2, PbDHHC10, PbIPET and PbEPSF, a series

of mutant parasite lines were previously constructed in the lab. dhhc10 and epsf were

independently disrupted via double homologous recombination and integration of a modified

Toxoplasma gondii dihydrofolate reductase/thymidylate synthase (tgdhfr/ts) gene cassette

(which confers resistance to pyramethamine, an antimalarial drug) to create ∆dhhc10 and

∆epsf lines. The ∆dhhc10 and ∆epsf mutants were verified by diagnostic PCR. Successful

gene deletion was further confirmed by RT-PCR analysis on mixed-blood stages cDNA,

which failed to detect the respective dhhc10 and epsf mRNA. Expression of control genes

was detected (Appendix IV Figs. S1 and S2).

3.2.2. Confirmation of successful GFP-tagging of dhhc2, dhhc10, ipet and epsf

GFP-tagged parasite lines of dhhc2, dhhc10, ipet and epsf were previously generated

in the lab to assess their expression and localization. This was achieved by stably

introducing the gfp gene at the C-terminus of each open reading frame, using single

homologous recombination. As in the case of KO parasite lines, a modified tgdhfr/ts gene

cassette was introduced for selection purposes conferring resistance to pyrimethamine.

Diagnostic PCR across the predicted integration sites showed correct integration of the GFP-

tagging construct. No WT version of the genes was detected. Successful GFP-tagging was

further confirmed by RT-PCR analysis on mixed blood stages cDNA, which failed to detect

the respective WT mRNAs, and successfully detected the respective GFP-tagged mRNAs

(Appendix IV Figs. S3 – S6).

3.2.3. Alternative splicing in ipet

When performing diagnostic RT-PCRs in ipet::gfp parasites we were able to

consistently detect a second amplicon of higher molecular weight. As depicted in Appendix

IV Fig. S5, both ipet mRNA WT version and GFP-tagged version both display a stronger

bottom band (displaying the theoretical expected size, 501bp and 474 bp, for ipet cDNA and

ipet::gfp cDNA, respectively) and a weaker top band. To investigate the origin of the extra

amplicon, bottom and top bands for both WT and ipet::gfp parasites were electroforeticaly

separated, gel extracted and sequenced. As listed in Appendix IV Table S1, ipet gene has 6

exons, which are illustrated in the alignment diagram shown in Fig. 8 A (PBANKA_060580

cDNA). The ipet contig stretch is a region of the genome that includes the ipet gene and a

stretch upstream and downstream of the gene. The contig was aligned with the theoretical

30

ipet cDNA sequence, as well as with the cDNA sequences obtained from both bottom and

top bands originated from both WT and ipet::gfp parasites. As observed in Fig. 8 A, both

bottom bands (PbAcl15cy1 and 2180cl1m4) display a similar exon pattern to ipet theoretical

cDNA; on the other hand, both top bands (PbAcl15cy1 and 2180cl1m4) display a 3’

extension of exon 5. In terms of protein sequence, until aminoacid number 106 a 100%

match for all sequences was verified. When comparing the theoretical version and the splice

variant proteins sequences of IPET, one can see that the theoretical variant and the splice

variant showed a different C-terminal sequence from the position 106th onwards (Fig. 8 B).

Fig. 8 – ipet presents a splice variant. A. Diagram displaying the alignment of ipet contig (PBANKA_060580 contig), ipet theoretical cDNA

sequence (PBANKA_060580 cDNA), ipet splice variant WT version (PbAcl15cy1 top band), ipet splice variant GFP-tagged version

(PbA2180cl1m4 top band), ipet mRNA main version WT version (PbAcl15cy1 bottom band) and ipet mRNA main version GFP-tagged version

(PbA2180cl1m4 bottom band). ipet (PBANKA_060580) gene length is indicated with double dashed line. B. Protein ClustalW multiple alignment of

ipet splice variant WT version (PbAcl15cy1 top band), ipet splice variant GFP-tagged version (PbA2180cl1m4 top band), ipet mRNA main version

WT version (PbAcl15cy1 bottom band) and ipet mRNA main version GFP-tagged version (PbA2180cl1m4 bottom band). Identical and similar

aminoacids are indicated in black and grey shading, respectively.

3.2.4. Life cycle mRNA and protein expression profile and protein localization

To assess the transcription pattern of the studied genes, RT-PCR analysis of dhhc2,

dhhc10, epsf and ipet mRNA was performed in all stages of the P. berghei life cycle (Fig. 9).

In the case of dhhc2, mRNA expression prevails in the gametocytes, however, there is

mRNA detection in the asexual blood stages, although in a lower level. In the mosquito stage,

dhhc2 transcription remains switched on until the midgut sporozoites stage, with a significant

decrease in expression in ookinetes at a later time point. In liver stage, dhhc2 transcription is

switched off. In the case of dhhc10, mRNA transcription is switched on in the gametocytes

and still remains in the ookinete stage at 8 hours, but with a lower expression. In the

remaining of the parasite life cycle, dhhc10 gene transcription is switched off. ipet and epsf

genes transcription have somewhat a similar pattern to dhhc2 gene transcription; the most

31

relevant differences are that ipet and epsf mRNA expression remains during the salivary

glands sporozoites stage, and only in the EEFs is switched off, and in both cases, there is no

expression in asexual blood stages. Even though dhhc2 and dhhc10 belong to the same

enzyme family, their mRNA expression profile is dissimilar, the only resemblance being the

high expression in gametocytes. p25 and p28 are known to be translationally repressed in

gametocytes by the DOZI- and CITH-defined repressor complexes. As expected, their mRNA

transcription is switched on and has the highest expression level in the gametocytes; this is

particularly evident for p25, as observed in Fig. 15. The same situation is verified in our set of

genes predicted to be translationally repressed: dhhc2, dhhc10, ipet and epsf. Among our set

of gene, ipet and epsf are the ones that share the most resembling mRNA profile throughout

the life cycle, with a highest expression in gametocytes and ookinetes at an earlier time point,

and with a lower, but still detectable, expression in the remaining mosquito stages. Since our

set of genes was predicted to be translationally repressed in gametocytes by the DOZI- and

CITH-defined repressor complexes, these findings are in agreement with the proposed

mechanism of repression. In this translationally repression model, a switch on in transcription

is expected in gametocytes, then the mRNAs are maintained in a quiescent state and later

on, when needed, they can be translated into protein.

Fig. 9 – mRNA expression profile of dhhc2, dhhc10, ipet

and epsf. Asexual mixed blood stages were originated from P.

berghei HPE strain. Asexual and gametocytes as well as

oocysts d12 p.i. were originated from P. berghei ANKA

820cl1m1cl1 parasite line. In vitro cultivated ookinetes (ooks)

at 8 and 16 hours were originated from P. berghei ANKA

cl15cy1. Midgut sporozoites (MG Spz) and salivary glands

sporozoites (SG Spz), both from day 20 p.i., and in vivo

exoerythrocytic forms (EEFs) at 6, 22 and 47 hours p.i. were

obtained from P. berghei ANKA 259cl1 parasite line. p25, p28,

dozi and uis4 are shown as control genes. hsp70 and 18S

rRNA were used as loading control genes.

To examine DHHC2, DHHC10, IPET and EPSF expression and localization, live

imaging and immunofluorescence essays were performed using the GFP-tagged parasite

lines mentioned in 3.2.2.. DHHC2 expression in asexual blood stages and gametocytes was

assessed and presence of DHHC2 was detected at these stages (Fig. 10). DHHC2::GFP

32

parasites revealed green fluorescence throughout the cytoplasm in all blood stages, as

depicted in Fig. 10. In contrast, DHHC10 expression in blood stages was not detected (data

not shown), but in ookinetes fluorescence in two cytoplasmic focal points was observed (Fig.

11). DHHC10 was also detected in oocysts and salivary gland sporozoites, characterized by

a dispersed cytoplasmic pattern and a speckled pattern, respectively (Fig. 12).

DHHC10::GFP parasite line gave rise to oocysts that sporulated normally, and originated

functional sporozoites with standard CSP expression, as depicted in Fig. 13, that were

efficiently transmitted to naive mice by infected mosquito bites (data not shown).

Fig. 10 – DHHC2 is expressed in asexual blood stages, as well as

gametocytes. Live imaging of asexual and sexual blood stages of

dhhc2::gfp parasites show DHHC2 expression all blood stage

parasite forms. Bars correspond to 5 µm.

Fig. 11 – DHHC10 is present in ookinetes. Live imaging of

ookinetes of dhhc10::gfp parasites shows DHHC10 expression at this

developmental stage. Bars correspond to 5 µm.

Fig. 12 – DHHC10 is expressed in oocysts and salivary gland

sporozoites but not in blood stages. A. Immunofluorescence

assay of oocyst-infected midguts at day 14 p.i. with anti-GFP

antibody (green) and Hoechst-33342 (blue). DHHC10 is expressed

at this stage as seen by the GFP signal. Bar corresponds to 20 µm.

B. Immunofluorescence assay of salivary gland sporozoites at day

33 p.i. with anti-GFP antibody (green) and Hoechst-33342 (blue).

DHHC10 is expressed at this stage as seen by the GFP signal. Bar

corresponds to 5 µm.

Fig. 13 – dhhc10::gfp parasite lines develop normally in the mosquito vector.

Live imaging of dhhc10::gfp oocysts at days 8 (400X magnification) and 19 post-

infection (630X magnification) and anti-CSP immunofluorescence assay on

salivary gland sporozoites at day 33 post-infection. Oocysts show normal

sporulation while sporozoites show normal morphology and CSP expression and localisation. Red staining in sporozoites correspond to CSP and

blue staining to DNA (Hoechst-33342). Bars correspond to 20 µm in the case of oocysts and to 5 µm in the case of sporozoites.

33

IPET expression was observed in ookinetes, oocysts, midguts and salivary glands

sporozoites. Expression in blood stages was not detected (data not shown). Interestingly,

IPET::GFP fluorescence pattern in ookinetes resembled that of DHHC10::GFP, showing two

cytoplasmic focal points (Fig. 14). In oocysts, green fluorescence was observed throughout

the cytoplasm (Figs. 14 and 15). In midguts and salivary glands sporozoites a speckled

pattern was observed, suggesting localization to granules or organelles (Fig. 15). Both

patterns are similar to the ones observed in the case of DHHC10 protein. EPSF expression

was examined in ookinetes, and again, two cytoplasmic focal points were detected (Fig. 16).

Fig. 14 – IPET is expressed in ookinetes and oocysts. Live imaging of

mosquito blood meal ookinetes and oocysts of ipet::gfp parasites at days 13

and 21 post-infection shows IPET expression in both parasite forms. IPET is

strikingly located in 2 discrete dots in live ookinetes. Bars correspond to 5 µm

in the case of ookinetes and 20 µm in the case of oocysts.

Fig. 15 – IPET is expressed in oocysts and sporozoites.

Anopheles stephensi female mosquitoes were allowed to feed

on anesthetised BALB/c mice infected with ipet::gfp parasite

line. A. Immunofluorescence assay of oocyst-infected midguts

at day 14 p.i. with anti-GFP antibody (green) and Hoechst-

33342 (blue). IPET is expressed at this stage as seen by the

GFP signal. Bar corresponds to 20 µm. B.

Immunofluorescence assay of midgut sporozoites (MG Spz) at

day 24 p.i. with anti-GFP antibody (green) and Hoechst-33342

(blue). IPET is expressed at this stage as seen by the GFP

signal. Bar corresponds to 5 µm. C. Immunofluorescence

assay of salivary gland sporozoites (SG Spz) at day 21 p.i.

with anti-GFP antibody (green) and Hoechst-33342 (blue).

IPET is expressed at this stage as seen by the GFP signal.

Sporozoites show normal morphology and CSP expression

and localisation (red). Bars correspond to 5 µm.

Fig. 16 – EPSF is expressed in ookinetes. Live imaging of epsf::gfp

mosquito blood meal ookinetes at 16h post-infection shows EPSF

expression in two discrete dots. Bars correspond to 5 µm.

34

As observed before, dhhc2 mRNA expression was detected in asexual blood stages

and gametocytes (Fig. 9). Protein expression was also detected at these stages. dhhc2 is

part of our set of transcripts predicted to be translationally repressed by the DOZI and CITH-

defined repressor complexes, but unexpectedly, there is both mRNA and protein expression

in gametocytes (Figs. 9 and 10). In contrast, dhhc10 has mRNA expression but no protein

expression in gametocytes (Fig. 9; data not shown). Protein expression is detected later on,

in the mosquito stages. In dhhc10 the expression pattern expected in a translationally

repressed transcript in gametocytes was verified, on the contrary, in dhhc2 this pattern was

not observed. We concluded that, even though dhhc2 was initially part of the set of

transcripts predicted to be translationally repressed, dhhc2 translation is not repressed in

gametocytes. In the ookinete stage, DHHC10, IPET and EPSF expression was detected in

two discrete dots, resembling a pattern found in proteins that are associated with crystalloid

bodies [53] (Figs. 11, 14 and 16).

3.2.5. ∆dhhc10 and ∆epsf mutants phenotype

Both ∆dhhc10 and ∆epsf parasite lines were capable of infecting Anopheles stephensi

mosquitoes, and on day 12 to 13 post-infection numbers of oocysts were counted. ∆dhhc10

parasites exhibited normal oocyst development. (Fig. 17 A). In contrast, ∆epsf parasites

exhibited an impairment in oocyst development, since in this KO parasite line, there were

fewer number of oocysts per midgut when compared to WT parasites (Fig. 18 A). In both KO

parasite lines infections (on days 20 to 22 post-infection) no midgut or salivary gland

sporozoites were observed, in contrast to WT infections (Figs. 17 B and 18 B.)

Fig. 17 – dhhc10 gene

deletion mutants are

impaired in development

during mosquito passage.

Anopheles stephensi

female mosquitoes were

allowed to feed on

anesthetised BALB/c mice

infected with either WT

(PbA820cl1m1cl1) or

∆dhhc10 parasite lines. A.

∆dhhc10 parasites show

normal oocyst development. Oocysts were counted on days 12 to 13 post-infection. Absolute numbers of oocysts per midgut from 5 independent

experiments are presented for both WT (n=70) and ∆dhhc10 (n=48) parasites. B. ∆dhhc10 parasites no not form any midgut sporozoites (MG Spz),

as well as salivary gland sporozoites (SG Spz). Absolute numbers of sporozoites from 4 independent experiments are presented for both WT

(n=5) and ∆dhhc10 (n=10) parasites. Sporozoites were counted in pools of 5 to 25 mosquitoes on days 20 to 22 post-infection. (A-B) Mean and

SEM values are shown by the lines, while p-values for Mann-Whitney test are shown above the data sets in both plots.

35

Fig. 18 – epsf gene

deletion mutants are

impaired in development

during mosquito passage.

Anopheles stephensi female

mosquitoes were allowed to

feed on anesthetised

BALB/c mice infected with

either WT (PbA820cl1m1cl1)

or ∆epsf parasite lines. A.

∆epsf parasites show an

impairment in oocyst development. Oocysts were counted on days 12 to 13 post-infection. Absolute numbers of oocysts per midgut from 6 and 5

independent experiments are presented for WT (n=88) and PBANKA_072090-KO (n=92) parasites, respectively. B. ∆epsf parasites no not form

any midgut sporozoites (MG Spz), as well as salivary gland sporozoites (SG Spz). Absolute numbers of MG Spz from 4 independent experiments

are presented for both WT (n=5) and ∆epsf (A) (n=10) parasites, while in the case of SG Spz data from 5 independent experiments are presented

for both WT (n=6) and ∆epsf (n=11) parasites. Sporozoites were counted in pools of 5 to 24 mosquitoes on days 20 to 22 post-infection. (A-B)

Mean and SEM values are shown by the lines, while p-values for Mann-Whitney test are shown above the data sets in both plots.

Oocysts diameter was measured for both ∆dhhc10 and ∆epsf parasite lines at different

time points. As times progresses, both ∆dhhc10 and ∆epsf oocysts become progressively

enlarged when compared to WT (Fig. 19). Two types of oocyst populations were possible to

observe in both KO parasite lines: non-sporulated oocysts, that resemble immature wt

oocysts, and oocysts that seem vacuolated or degenerated (data not shown).

Fig. 19 – epsf and dhhc10 gene

deletion oocysts become

progressively enlarged throughout

time. Anopheles stephensi female

mosquitoes were allowed to feed on

anesthetised BALB/c mice infected

with either WT (PbA820cl1m1cl1)

∆epsf or ∆dhhc10 parasite lines.

Oocyst diameters were measured at

different time point post-infection (p.i.) from bright field Leica DMR microscopic pictures taken 400X magnification using Image J software. A.

Oocyst diameters at day 12 p.i.. B. Oocyst diameters at day 14 p.i.. C. Oocyst diameters at day 16 p.i.. D. Oocyst diameters at day 19 p.i.. E.

Oocyst diameters at days 21/22 p.i.. (A-E) Mean and SEM values are shown by the lines, while p-values for Mann-Whitney test are shown above

the data sets in all plots.

Since circumsporozoite protein (CSP) plays an important role in sporozoite

development [54] and csp disruption mutant has the same phenotype as ∆dhhc10 and ∆epsf

parasites [55], CSP expression was assessed in oocysts of both KO parasite lines by

36

Western blot analysis and immunofluorescence assay at days 13 and 14 p.i., respectively. A

similar result was obtained in both cases, as depicted in Figs. 20 and 21, CSP expression in

KO oocysts was only detected in experimental settings where WT CSP expression was

oversaturated. During WT oocyst development, oocyst plasma membrane invaginations lead

to sporoblasts formation, and consequently sporozoite with CSP covering the whole

membrane [10]. In KO oocysts, however, there is an impairment in sporozoite formation,

which is accompanied by a highly reduced CSP expression. These results strengthen the

hypothesis that both DHHC10 and EPSF are essential proteins for sporozoite formation. In

both KO parasites, oocysts do not sporulate and CSP expression is dramatically reduced,

suggesting that both proteins are vital for the mechanisms underlying sporozoite formation.

Fig. 20 – dhhc10 gene deletion oocysts show

decreased CSP expression. Anopheles stephensi female

mosquitoes were allowed to feed on anesthetised BALB/c

mice infected with either WT (PbA820cl1m1cl1) or

∆dhhc10 parasite lines. Midguts were harvested between

days 13 and 14 post-infection (p.i.). A. Western blot of

infected midguts (2 midguts per lane) at day 13 p.i. with

anti-CSP and anti-Hsp70 antibodies. Two anti-CSP

exposure times are shown. Note that when CSP is

detected in ∆dhhc10 oocysts, signal coming from WT

oocysts is already oversaturated. Hsp70 serve as parasite

loading control. B. Immunofluorescence assay of oocyst-

infected midguts at day 14 p.i. with anti-CSP antibody (red)

and Hoechst-33342 (blue). Anti-CSP images were taken with the same exposure time and their brightness and contrast adjusted in 2 different

ways to highlight that when CSP is detected in ∆dhhc10 oocysts, signal coming from WT oocysts is already oversaturated. Bar corresponds to 20

µm.

Fig. 21 – epsf gene deletion oocysts show decreased

CSP expression. Anopheles stephensi female mosquitoes

were allowed to feed on anesthetised BALB/c mice

infected with either WT (PbA820cl1m1cl1) or ∆epsf

parasite lines. Midguts were harvested between days 13

and 14 post-infection (p.i.). A. Western blot of infected

midguts at day 13 p.i. with anti-CSP and anti-Hsp70

antibodies. Two anti-CSP exposure times are shown. Note

that when CSP is detected in ∆epsf oocysts, signal coming

from WT oocysts is already oversaturated. Hsp70 serves

as parasite loading control. B. Immunofluorescence assay

of oocyst-infected midguts at day 14 p.i. with anti-CSP

antibody (red) and Hoechst-33342 (blue). Anti-CSP images

were taken with the same exposure time and their

brightness and contrast adjusted in 2 different ways to

highlight that when CSP is detected in ∆epsf oocysts, signal coming from WT oocysts is already oversaturated. Hoechst staining is reduced in

∆epsf oocysts when compared to WT oocysts, indicating less DNA replication. Decreased CSP and DNA stainings are in agreement with the

absence of sporozoite formation in ∆epsf parasites. Bars corresponds to 20 µm.

37

3.2.6. Discussion

3.2.6.1. DHHC10, IPET and EPSF role in Plasmodium life cycle

In the last 20 years, translational repression has been emerging as a critical post-

transcriptional mechanism in the Plasmodium life cycle. DOZI and CITH are present in

Plasmodium P-granules [35], contributing to the translational repression of hundreds of

mRNAs [34, 36]. The DOZI and CITH-defined repressor complexes were shown to have a

central role in the sexual development of the parasite [37]. P25 and P28 are ookinete surface

proteins whose transcripts were found to be translationally repressed by DOZI and CITH

defined mRNPs complexes [37]. Their vital role in Plasmodium development in the mosquito

is well established. It was shown that P25 and P28 double-KO ookinetes traversal ability is

impaired, as is their further development into oocysts [57]. Both P25 and P28 are very well

studied targets of transmission blocking antibodies. Transmission blocking vaccines primary

aim is to decrease the number of infected mosquitoes by arresting parasite development in

the mosquito [58]. Since P25 and P28 are antigens expressed in the ookinetes surface they

are called postfertilization antigens; antigens located on the surface of male and female

gametocytes and gametes are termed prefertilization antigens [59]. Gametocyte/gamete

surface proteins P48/45 and P230 are another example of extensively studied transmission

blocking vaccine candidates [59]. Throughout the years, several ookinete surface proteins

and ookinete secreted proteins have been appointed as promising candidates for the

transmission blocking strategy: ookinete micronemal proteins chitinase (PgCHT1),

circumsporozoite and TRAP-related protein (CTRP), von Willebrand factor A domain-related

protein (WARP) [60], cell-traversal protein for ookinetes and sporozoites (CelTOS) [61] and

Plasmepsin 4 [62], among others.

Similarly to P25 and P28, DHHC2, DHHC10, IPET and EPSF were predicted to be

translationally repressed by DOZI- and CITH-defined repressor complexes. Moreover, this

set of proteins was predicted to be surface proteins due to the presence of signal peptides

and/or transmembrane domains. For these reasons, we originally hypothesized that they

could be useful TBV candidates. However, DHHC10, IPET and EPSF localization in

ookinetes resembles that of proteins associated with crystalloid bodies. Crystalloid bodies

origin and functions are still very unclear. However, a role in malaria transmission has been

proposed due to their stage specific presence in ookinetes and young oocysts [63].

Crystalloid bodies proposed function would be of an organelle where proteins synthesized in

the gametocytes are stored only to be used, afterwards during oocyst development [63].

Interestingly, our findings suggest that dhhc10, ipet and epsf transcripts are in a quiescent

state in the gametocytes, with no protein translation at this stage. In the ookinetes DHHC10,

IPET and EPSF protein production begins, and their localization suggests that they are

38

stored in crystalloid bodies, being used later on in the life cycle. DHHC10 and EPSF seem

crucial for sporozoite formation, since their corresponding KO parasites are characterized by

impairment of sporozoite formation. DHHC10-mediated protein palmitoylation seems to be

absolutely vital but only at the stage of sporozoite formation, since the number of KO oocysts

per mosquito midgut remained normal when compared to a WT line. In contrast, the number

of ∆epsf oocyst per midgut was significantly lower than that of WT parasites, suggesting that

EPSF role starts earlier in the oocyst development. pbdhhc10 disruption phenotype is similar

to the one observed for P. berghei scavenger receptor-like protein PbSR, a protein produced

in the macrogametocytes which is also localized to crystalloid bodies in ookinetes, and was

shown to be involved in the formation of these organelles [53]. PbSR is a member of the

LCCL/lectin adhesive-like protein (LAP) family suggested to be associated with the

crystalloid bodies [63]. Other members of this family showed similar loss-of-function

phenotypes to the ones observed for pbsr and pbdhhc10, with the same enlarged and

vacuolated or non-sporulated oocyst phenotype [64]. These similarities strengthen our

hypothesis of DHHC10 being localized to the crystalloid bodies, where it is stored, and then

delivered to the oocyst. DHHC10 would then palmitoylate targeted proteins essential in the

membrane invagination process that results in sporoblasts formation.

Our perception of RNA regulation in Plasmodium has changed drastically in the last

years. Post-transcriptional mechanisms like translational repression illustrate how

Plasmodium life cycle regulation is a dynamic and sophisticated process. Additional

evidences of complex mechanisms of mRNA processing in Plasmodium species have arised,

such as alternative splicing [65]. In gametocytes, ipet transcription produces a main variant,

which seems to be necessary for development in the mosquito, since IPET is expressed in

ookinetes, oocysts, midgut and salivary gland sporozoites. However, ipet was found to

possess an alternative splice variant, with a coding potential for a protein with a different C-

terminal sequence. This may be indicative of a possible IPET isoform with a different

localization, regulation and function. Further studies are needed to assess the functionality

and relevance of this splice variant. Nonetheless, our findings are an additional indication of

the complexity of the RNA metabolism in Plasmodium.

Our results further confirm the critical role of translational repression in the Plasmodium

sexual development and give additional indications about the highly organized post-

transcriptional mechanisms that regulate the Plasmodium life cycle.

3.2.6.2. DHHC family in Plasmodium: DHHC2 and DHHC10

In the last years, studies regarding palmitoylation role in Plasmodium life cycle have

been increasing significantly. Palmitoylation is a reversible post-translational modification

(PTM) and is essential for the control of protein trafficking, localization, enzyme activity,

39

among others [66]. DHHC domain-containing proteins, also called palmitoylacyl-transferases

(PATs), mediate palmitoylation intracellularlly [66]. PfAnkDHHC, a protein containing a

DHHC domain, was suggested to be important for the development of asexual blood stages

in Plasmodium falciparum [67]. Evidences started to emerge that palmitoylation would be

important for gliding, and consequently for host cell invasion, since GAP45 an important

component of the glideosome is palmitoylated in P. falciparum [68]. More recently, around

400 palmitoylated proteins were identified in asexual blood stages, strengthening the

hypothesis that palmitoylation has a central role in blood stage development, namely in

schizont maturation and erythrocyte invasion [69].

A global analysis of apicomplexan PATs reinforced the idea that palmitoylation is an

important PTM in schizont development, since PbDHHC5, 7, 8 and 9 expression were

detected in P. berghei schizonts [50]. Our results strengthen this idea, since PbDHHC2 is

also detected in schizonts. In addition, PbDHHC2 is also expressed in the remaining blood

stages, suggesting that this protein may have a role throughout blood stage development. In

contrast, PbDHHC10 was not detected in any blood stages, implying that these proteins

have non-overlapping roles in the Plasmodium life cyle. ∆pbdhhc10 parasite line confirmed

this hypothesis, since dhhc10 absence led to impairment only in sporozoite formation. This is

the first indication that palmitoylation is an essential PTM in sporozoite formation.

Our results further confirm the importance of protein palmitoylation mechanism in the

biology Plasmodium parasites, a feature that seems to be shared among the Apicomplexa

parasites [50].

4 – Conclusions

Translational repression is a crucial mechanism in the Plasmodium sexual

development. DOZI and CITH proteins are major key players in this process forming

ribonucleoprotein complexes in female gametocytes where certain mRNAs are translationally

repressed, being stored until fertilization occurs. In sporozoites, PUF2 binds to mRNAs and

also represses their translation controlling, possibly by regulating eIF2α, sporozoite latency.

Indications are emerging of a role of PUF2 in translational repression in the gametocytes; still,

our results weren’t able to further confirm this hypothesis. As depicted in Fig. 22, our findings

suggest that DHHC10, EPSF and IPET are translationally repressed by the DOZI- and CITH-

defined complexes, and only translated later on in ookinetes, where they are stored in

crystalloid bodies. In contrast, DHHC2 expression is already detected in gametocytes, and

also in asexual blood stages, thus suggesting a role at these stages. Afterwards, DHHC10

and EPSF will have an essential role in sporozoite formation. On the other hand, IPET main

variant seems to have a role in parasite development in the mosquito. In addition, our results

40

demonstrate the critical role of protein palmitoylation in sporozoite formation, and hence, in

malaria transmission. Briefly concluding, post-transcriptional mechanisms have a critical role

in the Plasmodium life cycle. Translational repression allows the maintenance of a pool of

important mRNAs ready to be rapidly translated upon a certain signal and thus, ensuring a

rapid transition from one stage to the next in the life cycle.

Fig. 22 – Translational

repression in P. berghei life

cycle. Illustration summarizing

the main conclusions of our

study. Ookinetes abbreviated as

ook and salivary gland

sporozoites as SG Spz.

(Adapted from [56]).

5 – References [1] Barillas-Mury, C. and S. Kumar (2005). "Plasmodium–mosquito interactions: a tale of dangerous liaisons." Cellular Microbiology 7(11): 1539-1545.

[2] Martinsen, E. S., S. L. Perkins, et al. (2008). "A three-genome phylogeny of malaria parasites (Plasmodium and closely related genera): Evolution of life-history traits and host switches." Molecular Phylogenetics and Evolution 47(1): 261-273.

[3] World Health Organization (WHO), World Malaria Report, 2012.

[4] Matuschewski, K. (2006). "Getting infectious: formation and maturation of Plasmodium sporozoites in the Anopheles vector." Cellular Microbiology 8(10): 1547-1556.

[5] Frech, C. and N. Chen (2011). "Genome comparison of human and non-human malaria parasites reveals species subset-specific genes potentially linked to human disease." PLoS Comput Biol 7(12): e1002320.

[6] Thera, M. A. and C. V. Plowe (2012). "Vaccines for Malaria: How Close Are We?" Annual Review of Medicine 63(1): 345-357.

[7] Schwartz, L., G. Brown, et al. (2012). "A review of malaria vaccine clinical projects based on the WHO rainbow table." Malaria Journal 11(1): 11.

[8] Miller, L. H., H. C. Ackerman, et al. (2013). "Malaria biology and disease pathogenesis: insights for new treatments." Nat Med 19(2): 156-167.

[9] Silvestrini, F., P. Alano, et al. (2000). "Commitment to the production of male and female gametocytes in the human malaria parasite Plasmodium falciparum." Parasitology 121 Pt 5: 465-471.

41

[10] Aly, A. S., A. M. Vaughan, et al. (2009). "Malaria parasite development in the mosquito and infection of the mammalian host." Annu Rev Microbiol 63: 195-221.

[11] Amino, R., S. Thiberge, et al. (2006). "Quantitative imaging of Plasmodium transmission from mosquito to mammal." Nat Med 12(2): 220-224.

[12] Prudencio, M., A. Rodriguez, et al. (2006). "The silent path to thousands of merozoites: the -Plasmodium liver stage." Nat Rev Microbiol 4(11): 849-856.

[13] Mota, M. M., G. Pradel, et al. (2001). "Migration of Plasmodium Sporozoites Through Cells Before Infection." Science 291(5501): 141-144.

[14] Sturm, A., R. Amino, et al. (2006). "Manipulation of host hepatocytes by the malaria parasite for delivery into liver sinusoids." Science 313(5791): 1287-1290.

[15] Ho, M. and N. J. White (1999). "Molecular mechanisms of cytoadherence in malaria." American Journal of Physiology - Cell Physiology 276(6): C1231-C1242.

[16] Bannister, L. H., J. M. Hopkins, et al. (2000). "A Brief Illustrated Guide to the Ultrastructure of Plasmodium falciparum Asexual Blood Stages." Parasitology today (Personal ed.) 16(10): 427-433.

[17] Bannister, L. and G. Mitchell (2003). "The ins, outs and roundabouts of malaria." Trends in Parasitology 19(5): 209-213.

[18] Portugal, S., H. Drakesmith, et al. (2011). "Superinfection in malaria: Plasmodium shows its iron will." EMBO Rep 12(12): 1233-1242.

[19] Coleman, B. I. and M. T. Duraisingh (2008). "Transcriptional control and gene silencing in Plasmodium falciparum." Cellular Microbiology 10(10): 1935-1946.

[20] Deitsch, K., M. Duraisingh, et al. (2007). "Mechanisms of gene regulation in Plasmodium." Am J Trop Med Hyg 77(2): 201-208.

[21] Hall, N., M. Karras, et al. (2005). "A comprehensive survey of the Plasmodium life cycle by genomic, transcriptomic, and proteomic analyses." Science 307(5706): 82-86.

[22] Gardner, M. J., N. Hall, et al. (2002). "Genome sequence of the human malaria parasite Plasmodium falciparum." Nature 419(6906): 498-511.

[23] Janse, C. J., P. F. J. van der Klooster, et al. (1986). "DNA synthesis in Plasmodium berghei during asexual and sexual development." Molecular and Biochemical Parasitology 20(2): 173-182.

[24] Ponzi, M., C. J. Janse, et al. (1990). "Generation of chromosome size polymorphism during in vivo mitotic multiplication of Plasmodium berghei involves both loss and addition of subtelomeric repeat sequences." Molecular and Biochemical Parasitology 41(1): 73-82.

[25] Tuteja, R., A. Ansari, et al. (2011). "Emerging functions of transcription factors in malaria parasite." J Biomed Biotechnol 2011: 461979.

[26] van Noort, V. and M. A. Huynen (2006). "Combinatorial gene regulation in Plasmodium falciparum." Trends Genet 22(2): 73-78.

[27] Balaji, S., M. M. Babu, et al. (2005). "Discovery of the principal specific transcription factors of Apicomplexa and their implication for the evolution of the AP2-integrase DNA binding domains." Nucleic Acids Res 33(13): 3994-4006.

[28] Painter, H. J., T. L. Campbell, et al. (2011). "The Apicomplexan AP2 family: integral factors regulating Plasmodium development." Mol Biochem Parasitol 176(1): 1-7.

[29] Yuda, M., S. Iwanaga, et al. (2009). "Identification of a transcription factor in the mosquito-invasive stage of malaria parasites." Mol Microbiol 71(6): 1402-1414.

[30] Bozdech, Z., M. Llinás, et al. (2003). "The Transcriptome of the Intraerythrocytic Developmental Cycle of Plasmodium falciparum.” PLoS Biology 1 (1): e5.

[31] Khan, S. M., B. Franke-Fayard, et al. (2005). "Proteome Analysis of Separated Male and Female Gametocytes Reveals Novel Sex-Specific Plasmodium Biology." Cell 121(5): 675-687.

[32] Paton, M. G., G. C. Barker, et al. (1993). "Structure and expression of a post-transcriptionally regulated malaria gene encoding a surface protein from the sexual stages of Plasmodium berghei." Mol Biochem Parasitol 59(2): 263-275.

42

[33] Le Roch, K. G., Y. Zhou, et al. (2003). "Discovery of gene function by expression profiling of the malaria parasite life cycle." Science 301(5639): 1503-1508.

[34] Mair, G. R., E. Lasonder, et al. (2010). "Universal Features of Post-Transcriptional Gene Regulation Are Critical for Plasmodium Zygote Development." PLoS Pathog 6(2): e1000767.

[35] Braks, J. A. M., G. R. Mair, et al. (2008). "A conserved U-rich RNA region implicated in regulation of translation in Plasmodium female gametocytes." Nucleic Acids Research 36(4): 1176-1186.

[36] Mair, G. R., J. A. M. Braks, et al. (2006). "Regulation of Sexual Development of Plasmodium by Translational Repression." Science 313(5787): 667-669.

[37] Tarique, M., M. Ahmad, et al. (2013). "Plasmodium falciparum DOZI, an RNA helicase interacts with eIF4E." Gene 522(1): 46-59.

[38] Zhang, B., M. Gallegos, et al. (1997). "A conserved RNA-binding protein that regulates sexual fates in the C. elegans hermaphrodite germ line." Nature 390(6659): 477-484.

[39] Zamore, P. D., J. R. Williamson, et al. (1997). "The Pumilio protein binds RNA through a conserved domain that defines a new class of RNA-binding proteins." RNA 3(12): 1421-1433.

[40] Wickens, M., D. S. Bernstein, et al. (2002). "A PUF family portrait: 3′UTR regulation as a way of life." Trends in Genetics 18(3): 150-157.

[41] Quenault, T., T. Lithgow, et al. (2011). "PUF proteins: repression, activation and mRNA localization." Trends in Cell Biology 21(2): 104-112.

[42] Miller, M. A. and W. M. Olivas (2011). "Roles of Puf proteins in mRNA degradation and translation." Wiley Interdiscip Rev RNA 2(4): 471-492.

[43] Spassov, D. S. and R. Jurecic (2003). "The PUF family of RNA-binding proteins: does evolutionarily conserved structure equal conserved function?" IUBMB Life 55(7): 359-366.

[44] Goldstrohm, A. C., B. A. Hook, et al. (2006). "PUF proteins bind Pop2p to regulate messenger RNAs." Nat Struct Mol Biol 13(6): 533-539.

[45] Gerber, A. P., D. Herschlag, et al. (2004). "Extensive association of functionally and cytotopically related mRNAs with Puf family RNA-binding proteins in yeast." PLoS Biol 2(3): E79.

[46] Miao, J., J. Li, et al. (2010). "The Puf-family RNA-binding protein PfPuf2 regulates sexual development and sex differentiation in the malaria parasite Plasmodium falciparum." J Cell Sci 123(Pt 7): 1039-1049.

[47] Gomes-Santos, C. S. S., J. Braks, et al. (2011). "Transition of Plasmodium Sporozoites into Liver Stage-Like Forms Is Regulated by the RNA Binding Protein Pumilio." PLoS Pathog 7(5): e1002046.

[48] Müller, K., K. Matuschewski, et al. (2011). "The Puf-Family RNA-Binding Protein Puf2 Controls Sporozoite Conversion to Liver Stages in the Malaria Parasite." PLoS ONE 6(5): e19860.

[49] Lindner, S. E., S. A. Mikolajczak, et al. (2013). "Perturbations of Plasmodium Puf2 expression and RNA-seq of Puf2-deficient sporozoites reveal a critical role in maintaining RNA homeostasis and parasite transmissibility." Cell Microbiol 15(7): 1266-1283.

[50] Frenal, K., C. L. Tay, et al. (2013). "Global analysis of apicomplexan protein s-acyl transferases reveals an enzyme essential for invasion." Traffic 14(8): 895-911.

[51] Beetsma, A. L., T. J. van de Wiel, et al. (1998). "Plasmodium berghei ANKA: purification of large numbers of infectious gametocytes." Exp Parasitol 88(1): 69-72.

[52] Alano, P. (2007). "Plasmodium falciparum gametocytes: still many secrets of a hidden life." Molecular Microbiology 66(2): 291-302.

[53] Carter, V., S. Shimizu, et al. (2008). "PbSR is synthesized in macrogametocytes and involved in formation of the malaria crystalloids." Mol Microbiol 68(6): 1560-1569.

[54] Thathy, V., H. Fujioka, et al. (2002). "Levels of circumsporozoite protein in the Plasmodium oocyst determine sporozoite morphology." EMBO J 21(7): 1586-1596.

[55] Menard, R., A. A. Sultan, et al. (1997). "Circumsporozoite protein is required for development of malaria sporozoites in mosquitoes." Nature 385(6614): 336-340.

43

[56] Zhang, M., B. R. Joyce, et al. (2013). "Translational Control in Plasmodium and Toxoplasma Parasites." Eukaryotic Cell 12(2): 161-167.

[57] Tomas, A. M., G. Margos, et al. (2001). "P25 and P28 proteins of the malaria ookinete surface have multiple and partially redundant functions." EMBO J 20(15): 3975-3983.

[58] Dinglasan, R. R. and M. Jacobs-Lorena (2008). "Flipping the paradigm on malaria transmission-blocking vaccines." Trends Parasitol 24(8): 364-370.

[59] Saxena, A. K., Y. Wu, et al. (2007). "Plasmodium p25 and p28 surface proteins: potential transmission-blocking vaccines." Eukaryot Cell 6(8): 1260-1265. [60] Li, F., T. J. Templeton, et al. (2004). "Plasmodium Ookinete-secreted Proteins Secreted through a Common Micronemal Pathway Are Targets of Blocking Malaria Transmission." Journal of Biological Chemistry 279(25): 26635-26644.

[61] Kariu, T., T. Ishino, et al. (2006). "CelTOS, a novel malarial protein that mediates transmission to mosquito and vertebrate hosts." Mol Microbiol 59(5): 1369-1379.

[62] Li, F., K. P. Patra, et al. (2010). "Apical surface expression of aspartic protease Plasmepsin 4, a potential transmission-blocking target of the plasmodium ookinete." J Biol Chem 285(11): 8076-8083.

[63] Dessens, J. T., S. Saeed, et al. (2011). "Malaria crystalloids: specialized structures for parasite transmission?" Trends Parasitol 27(3): 106-110.

[64] Raine, J. D., A. Ecker, et al. (2007). "Female inheritance of malarial lap genes is essential for mosquito transmission." PLoS Pathog 3(3): e30.

[65] Singh, N., P. Preiser, et al. (2004). "Conservation and developmental control of alternative splicing in maebl among malaria parasites." J Mol Biol 343(3): 589-599.

[66] Corvi, M. M., A. M. Alonso, et al. (2012). "Protein palmitoylation and pathogenesis in apicomplexan parasites." J Biomed Biotechnol 2012: 483969.

[67] Seydel, K. B., D. Gaur, et al. (2005). "Plasmodium falciparum: characterization of a late asexual stage golgi protein containing both ankyrin and DHHC domains." Exp Parasitol 110(4): 389-393.

[68] Rees-Channer, R. R., S. R. Martin, et al. (2006). "Dual acylation of the 45 kDa gliding-associated protein (GAP45) in Plasmodium falciparum merozoites." Mol Biochem Parasitol 149(1): 113-116.

[69] Jones, M. L., M. O. Collins, et al. (2012). "Analysis of protein palmitoylation reveals a pervasive role in Plasmodium development and pathogenesis." Cell Host Microbe 12(2): 246-258.

[70] Yoshida, N., Nussenzweig, R.S., Potocnjak, P.,Nussenzweig, V., and Aikawa, M. (1980) Hybridoma produces protective antibodies directed against the sporozoite stage of malaria parasites. Science 207: 71–73.

[71] Tsuji, M., Mattei, D., Nussenzweig, R.S., Eichinger, D., and Zavala, F. (1994) Demonstration of heat-shock protein 70 in the sporozoite stage of malaria parasites. Parasitol Res 80: 16–21.

44

6 – Appendix I: General products and kits

Table S1. Composition of buffers and solutions used.

Solution Composition

TAE Buffer 40 mM Tris base; 20 mM acetic acid; 1 mM EDTA; pH 8,0

Running Buffer 0,025 M Tris base; 0,19 M glycine; 0,1% SDS; pH 8,3

Transfer Buffer 0,025 M Tris base; 0,19 M glycine; 20% absolute methanol; pH 8,3

NET-2 Buffer 150 mM NaCl; 50 mM Tris pH 7,4; 0,5% NP40 (IGEPAL CA 630)

NET-2++ Buffer NET-2 Buffer; 2 mM DTT; 1 tablet protease inhibitor ROCHE; RNase Out (2 U/µl; Promega)

RBC Lysis Buffer 1,5 M NH4Cl; 0,1 M KHCO3; 0,01 M EDTA.Na2; pH 7,4

Enriched PBS 1X PBS; 0,1% BSA pH8,4; 10 mM Glucose

Table S2. Molecular Biology Kits used and their origin.

Purpose Kit Origin

Gel extraction PureLink™ Quick Gel Extraction Kit Invitrogen

PCR products purification GeneJET™ PCR Purification Kit Fermentas

Plasmid DNA extraction PureLink™ HiPure Plasmid Filter Midiprep Kit Invitrogen

Plasmid DNA extraction PureLink™ Quick Plasmid Miniprep Kit Invitrogen

Genomic DNA Extraction GenElute™ Mammalian Genomic DNA Miniprep Kit

Sigma-Aldrich (St. Louis, Missouri, USA)

Cloning of PCR products CloneJET PCR Cloning Kit Thermo Scientific

Table S3. Western Blot analysis components used and origin.

Purpose Component Origin

Protein ladder Page Ruler™ Plus Prestained Protein Ladder Thermo Scientific

Protein ladder Precision Plus Protein™ Dual Xtra Standards BioRad

Electrophoretic running system Mini PROTEAN® Tetra Cell BioRad

Electrophoretic transfer system Mini Trans-Blot® Cell BioRad

Running gel Mini-PROTEAN® TGX™ Gels Any-kD™, 10 well-comb, 30 µL

BioRad

Table S4. List of the antibodies used, indicating their origin, the initial concentration and dilution used.

Antibody Origin Initial Concentration/Dilution used

Anti-GFP, rabbit IgG fraction (A11122) Invitrogen 2mg/ml ; 1:500

Rabbit anti-GFP, N-terminal Sigma-Aldrich (St. Louis, Missouri, USA)

1,0 mg/ml ; 1:500

Mouse IgG1к Anti-GFP Stabilized antibody preparation

Roche ---------;1:5000

Goat Anti-Mouse IgG-HRP: sc 2005 Santa Cruz Biotechnology Inc. ---------;1:5000-1:20000

Peroxidase-conjugated AffiniPure Donkey Anti-Rabbit IgG (H+L)

Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA)

0,8 mg/ml ; 1:500

Monoclonal Anti-c-myc Antibody Sigma-Aldrich (St. Louis, Missouri, USA)

2 mg/ml; 0,02 mg/ml

Mouse anti-CSP 3D11 [70] ----------;10µg/µl(conc.IFAs); 1:9000-1:18000 (WB)

Parasite specific mouse monoclonal anti-PbHsp70 2E6

[71] ----------;1:1000

Rabbit polyclonal anti-GFP #ab6556 Abcam® ----------;1:100-1:500

Goat anti-rabbit IgG-Alexa Fluor® 488 Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA)

----------;1:400-1:500

Goat anti-mouse IgG-Cy™3 Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA)

----------1:400-1:500

7 – Appendix II: Protocols

7.1. TRIzol Plasmodium RNA preparation. TRIzol® (Reagent for RNA from Ambion®) was

added to the different samples in a proportion of 10 volumes of sample pellet size followed

by sample solubilization by vigorous shaking. Chlorophorm was added (0,2 times the original

TRIzol volume) and tubes centrifuged for 30 minutes at maximum speed and 4°C. New tubes

were used to collect the aqueous layer, without disturbing the interface, and isopropanol (0,5

times the original TRIzol volume) was added in order to precipitate the nucleic acids.

Samples were then incubated overnight at 4°C. On the following day, Glycogen (for

45

molecular biology, Roche) was added to the samples and then centrifuged for 30 minutes at

maximum speed and 4°C. The supernatant was carefully removed and the pellet was

washed with 75% RNase free ethanol, centrifuging for 30 minutes at maximum speed and

4°C. The pellets were left to dry and resuspended in 51µL in MiliQ (Millipore®) RNAse free

water, then subjected to DNAse treatment using 3µL DNase I Amplification Grade 1U/µL

(Invitrogen) and 6µL 10x DNase I Reaction Buffer (Invitrogen) and incubated for 30 minutes

at 37°C. Reaction was stopped using 6µL 25 mM EDTA RNase free (Invitrogen) and heat

inactivation, during 10 minutes at 65°C. RNA precipitation was performed using MiliQ

(Millipore®) RNase free water (34µL), 3 mM RNAse free NaOAc pH5,2 (10µL) and 96%

RNase free ethanol (250µL). The samples were stored at -80°C, for at least 1 hour. Glycogen

(for molecular biology, Roche) was added to the samples, and then centrifuged for 30

minutes at maximum speed. The obtained pellet was resuspended in 25µl MiliQ (Millipore®)

RNase free water.

7.2. First strand cDNA synthesis with Super Script II. 10 µL of pure RNAs were used as a

RT+ and 10 µL as a RT-. 1µl of 50 µM Anchored-oligo(dT)18 Primer (Roche) and 1 µl of 3µg/µl

Random Primer (Invitrogen) were added followed by a incubation of 10 minutes at 70°C. On

ice the following reagents were added: 4µL of 5X First Strand Buffer (Invitrogen), 2µL 0,1M

DTT (Invitrogen), 1µL 40U RNase Out (Invitrogen), 1µL 10 mM dNTP Mix (Invitrogen) and

finally, 0,5µL of 200U/µL Super Script™ Reverse Transcriptase (Invitrogen) was added only

to the RT+. Incubation for 1 hour at 42°C was done followed by an activation step of 15

minutes at 70°C. Then 1 µL of RNase H 5000U/ml (Bio Labs) and 2µL of 10X RNase H

Reaction Buffer (Bio Labs) were added followed by a 20-minute incubation at 37°C. Samples

were stored at -20°C.

7.3. PCR mix. If not stated otherwise, PCR mix was done as the following: 2,5µL 10X Taq

Buffer with 500 mM KCl (Thermo Scientific), 2µL 25 mM MgCl2 (Thermo Sientific), 0,5µL

dNTPs, 0,25µL 10 µM Fwd primer, 0,25µL 10µM Rev primer, 0,125µL Taq DNA Polymerase

5 U/µl (Thermo Scientific), 1µL of 10 ng/µL genomic DNA or, in the case of a RT-PCR, 2 µl of

a cDNA dilution. Final reaction volume was 25µL.

8 – Appendix III: Primers and PCR Tables

Table S1. Primers used in the puf2::gfp sequencing protocol. Forward abbreviated as Fwd and Reverse as Rev.

Primer Sequence (5’-3’) target Fwd/Rev

g0432 AACATTCACTCCATTCTTCC

trap Fwd

g0433

CATGTTATTCCAATGCTCAC trap Rev

g0459 AGCTGTTACAAACTCAAGAAGGACC gfp Rev

g0477 GTTGACGACATTCCTGAGG puf2 Fwd

46

Table S2. Primers used for genotyping and RT-PCRs dhhc2::gfp, dhhc10::gfp, ∆dhhc10, ipet::gfp, ∆epsf, epsf::gfp parasite lines. The

lowercase letters represent sequence with no homology to template DNA, whereas homologous regions are shown in uppercase. Forward

abbreviated as Fwd and Reverse as Rev.

Primer Sequence (5’-3’) Target Fwd/Rev

g0084 aaagaattcTGATGGTTTACAATCACC RNA polymerase II Fwd

g0085 aaagcggccgctTTCTTCCTGCATCTCCTC RNA polymerase II Rev

g0115 TTCGATATCATGAATTTTAAATACAG PBANKA_051490 (p28) Fwd

g0116 TCCgcggccgcGCATTACTATCACGTAAATAAC PBANKA_051490 (p28) Rev

g0408 GTATGTTGCATCACCTTC gfp Rev

g0628 aaagaattcCATATATTAGAGTATTG epsf Fwd

g0629 aaagcggccgcAATTTGCCTTTTGTGCATC epsf Rev

g0641 aaagaattcAAAACTGTTTTAAAGATG dhhc10 Fwd

g0642 aaagcggccgcATAATGTTTTATAAAATAGCC dhhc10 Rev

g0952 GATTCATAAATAGTTGGACTTG KO and GFP-tagging vector backbone Fwd

g0964 AACGAATTTGACTTGCATTC dhhc10 5' flanking region Fwd

g0965 GGTATGAACTCATACATGTC dhhc10 3’ flanking region Rev

g0968 TACATTGAAGTGTTGGTATG epsf 5’ flanking region Fwd

g0969 TGCATGCACATATATGTCAC epsf 3’ flanking region Rev

g1019 ATGCATAAACCGGTGTGTC tgdhfr/ts Fwd

g1020 AGCTTCTGTATTTCCGC tgdhfr/ts Rev

g1021 ATTGTTGACCTGCAGGCATG KO vector backbone Rev

g1196 AAAAGAGAAAAAATGGTG ipet 5’ flanking region Fwd

g1197 GCCTTATGGAATTAGTGC epsf 5’ flanking region Fwd

g1199 ATTTTTGGGGGTTTTCAG dhhc10 Fwd

g1200 GTTTTCAACACAAGTGTG dhhc10 3’ flanking region Rev

g1201 GTAAAAAAGGCATTATAG Ipet Rev

g1203 GTATTAATGCATGACTTG epsf 3' flanking region Rev

g1204 ATACAAACCAGACAGATC dhhc10 Fwd

g1205 AAGTTCCTTACGTATTAG epsf Fwd

g1258 ACACATAAATATATGCAG dhhc2 5' flanking region Fwd

g1259 ATGACATATTATAAACTC dhhc2 3’ flanking region Rev

g1261 AATATATGCAGATATCAC dhhc2 Fwd

g1262 AAAAAAATATACTTGTGC dhhc2 Rev

Table S3. PCR conditions used for genotyping and RT-PCR of ∆dhhc10, ∆epsf, dhhc2::gfp, dhhc10::gfp, ipet::gfp and epsf::gfp parasite lines. 5’ integration and 3’ integration abbreviated as 5’ int and 3’ int, respectively, RNA polymerase abbreviated as RNA pol II and annealing temperature as Ta.

Genotyping

RT-PCRs

5’int 3’int WT gene tgdhfr/ts RNA pol II

WT mRNA

GFP-tagged mRNA

p28 RNA pol II

dhhc2::gfp

Primers g1258/0g408c

g0952/g1259c

g1258/g1259c

g1019/g1020c

g0084/g0085c

g1261/g1262c

g1258/0g408c

g0115/g0116c

g0084/g0085c

Ta 40°C 43°C 43°C 40°C 43°C 43°C 53°C 43°C 44°C

Extension time

1min30s 1min27s 1min27s 1min30s 1min27s 58s 1min5s 1min5s 1min5s

Nr. cycles 45 45 45 45 45 45 40 45 45

dhhc10::gfp Primers g1199/ g0408c

g0952/g1200c

g1199/g1200c

g1019/g1020c

g0084/g0085c

g1204/g1200c

g1204/g0408c

g0115/g0116c

g0084/g0085c

Ta 45°C 45°C 47°C 40°C 40°C 45°C 45°C 40°C 40°C

Extension time

1min27s 1min27s 1min20s 2min 1min6s 1min5s 1min5s 1min22s 1min22s

Nr. cycles 45 45 45 35 35 45 45 35 35

∆dhhc10 Primers g0964/g1021c

g0952/g0965c

g0642/g0642c

g1019/g1020c

g0084/g0085c

g0641/g0642c

----------- g0115/g0116c

g0084/g0085c

Ta 40°C 40°C 50°C 40°C 40°C 43°C ----------- 43°C 43°C

Extension time

1min52s 1min52s 1min30s 1min52s 1min52s 1min6s ----------- 1min6s 1min6s

Nr. cycles 45 45 35 45 45 45 ----------- 45 45

ipet::gfp

Primers g1196/g0408c

g0952/g1201c

g1196/g1201c

g1019/g1020c

g0084/g0085c

g1196/g1201c

g1196/g0498c

g0115/g0116c

g0084/g0085c

Ta 45° C 45°C 50°C 40°C 40°C 50°C 50°C 40°C 40°C

Extension time

1min32s 1min32s 1min30s 2min 1min5s 45s 1min5s 1min22s 1min22s

Nr. cycles 45 45 45 35 35 45 45 35 35

47

epsf::gfp Primers g1197/ g0408c

g0952/g1203c

g1197/g1203c

g1019/g1020c

g0084/g0085c

g1205/g1203c

g1205/g0408c

g0115/g0116c

g0084/g0085c

Ta 48°C 46,2°C 48°C 40°C 43°C 46°C 46°C 43°C 43°C

Extension time

1min20s 1min18s 1min11s 1min56s 1min5s 45s 45s 1min5s 1min5s

Nr. cycles 45 45 45 45 45 45 45 45 45

∆epsf

Primers g0968/g1021c

g0952/g0969c

g0628/g0629c

g1019/g1020c

g0084/g0085c

g0628/g0629c

----------- g0115/g0116c

g0084/g0085c

Ta 40°C 40°C 48°C 40°C 48°C 43°C ----------- 43°C 43°C

Extension time

1min56s 1min56s 1min11s 1min56s 1min11s 1min5s ----------- 1min5s 1min5s

Nr. cycles 45 45 45 45 45 45 ----------- 45 45

Table S4. Summary of the PCR conditions used for the Life Cycle RT-PCRs for dhhc2, dhhc10, epsf and ipet cDNAs and the necessary

controls. Annealing temperature abbreviated as Ta.

Primers Ta Extension time Nr. Cycles

dhhc2 g0646/g0644c 43°C 54s 45

dhhc10 g0641/g0642c 43°C 33s 45

p25 g0385/g0476c 43°C 45s 45

p28 g0115/g0116c 43°C 45s 45

Dozi g0546/g0548c 43°C 45s 45

18S 33/34 60°C 10s 45

hsp70 g0258/g0259c 43°C 14s 45

Epsf g0628/g0629c 43°C 33s 45

Ipet g0623/g0624c 43°C 33s 45

uis4 g1370/g1371c 60°C 17s 45

9 – Appendix IV: Supplementary Figures and Tables

Table S1. Designation, predicted characteristics and mutant parasite lines for the genes studied.

Designation P. berghei ID

P. falciparum closest homologue

Predicted function Signal peptide

TMDs Molecular weight

Exons GFP-tagged line

KO line

dhhc2

PBANKA_010830

PF3D7_0609800 DHHC-type zinc finger protein, palmitoyltransferase putative

Not present

4 33,198 kDa 4 PbA2185cl1m1

------------

dhhc10 PBANKA_051200

PF3D7_1027900 DHHC-type zinc finger protein, palmitoyltransferase putative

present 4 32,862 kDa 11 PbA2187cl1m1

PbA2097cl1

ipet

PBANKA_060580

PF3D7_1207300 Unknown function present 1 13,128 kDa 6 PbA2180cl1m4

------------

epsf

PBANKA_072090

PF3D7_0418800 Unknown function present 2 30,289 kDa 9 PbA2182cl2m2

PbA2099cl1m7

*information adapted from plasmodb.org and genedb.org

Fig. S1 – ∆dhhc10 parasite

line diagnostic PCR and RT-PCR

analysis. The dhhc10 gene deletion

construct was obtained by

cloning dhhc10 5´ and 3´ targeting

regions upstream and downstream

of the Toxoplasma gondii dhfr/ts selecta

ble marker, respectively. The construct

was integrated into the dhhc10 locus of

PbA820cl1m1cl1 by double homologous

recombination, resulting in the complete

deletion of dhhc10 ORF in ∆dhhc10

parasites. A. Genomic integration of the

construct, as well as absence of dhhc10 ORF and presence of tgdhfr/ts was confirmed by PCR after cloning of ∆dhhc10 parasites (PbA2097cl1).

B. Absence of dhhc10 mRNA was confirmed in ∆dhhc10 mixed blood stages by RT-PCR. p28 and RNA polimerase II serve as control genes

48

Fig. S2 – ∆epsf parasite line

diagnostic PCR and RT-PCR

analysis. The epsf gene deletion

construct was obtained by cloning

epsf 5´ and 3´ targeting regions

upstream and downstream of

Toxoplasma gondii dhfr/ts selectable

marker, respectively. The construct

was integrated into the epsf locus of

PbA820cl1m1cl1 by double

homologous recombination, resulting

in the complete deletion of epsf ORF

in ∆epsf parasites. A. Genomic

integration of the construct, as well as

absence of epsf ORF and presence

of tgdhfr/ts was confirmed by PCR

after cloning of ∆epsf parasites (PbA2099cl1m7). B. Absence of epsf mRNA was confirmed in ∆epsf mixed blood stages by RT-PCR. p28 and

RNA polimerase II serve as control genes.

Fig. 3 – dhhc2::gfp parasite line

diagnostic PCR and RT-PCR

analysis. dhhc2 GFP tagging

construct was obtained by cloning the

last ~1000 bp of dhhc2 ORF excluding

the stop codon upstream and in frame

with gfp gene. This construct includes

Toxoplasma gondii dhfr/ts selectable

marker. The construct was integrated

into the dhhc2 locus of PbAcl15cy1 by

single homologous recombination,

resulting in the fusion

of dhhc2 to gfp in dhhc2::gfp

parasites. A. Genomic integration of

the construct, as well as absence of WT dhhc2 ORF and presence of tgdhfr/ts was confirmed by PCR after cloning of dhhc2::gfp parasites

(PbA2185cl1m1). B. Absence of WT dhhc2 mRNA and presence of dhhc2::gfp mRNA was confirmed in dhhc2::gfp mixed blood stages by RT-

PCR. p28 and RNA polimerase II serve as control genes.

Fig. 4 – dhhc10::gfp parasite line

diagnostic PCR and RT-PCR analysis.

dhhc10 GFP tagging construct was

obtained by cloning the last ~1000 bp of

dhhc10 ORF excluding the

stop codon upstream and in frame

with gfp gene. This construct includes

Toxoplasma gondii dhfr/ts selectable

marker. The construct was integrated

into the dhhc10 locus of PbAcl15cy1 by

single homologous recombination,

resulting in the fusion

of dhhc10 to gfp in dhhc10::gfp

parasites. A. Genomic integration of the

construct, as well as absence of WT

dhhc10 ORF and presence of tgdhfr/ts

was confirmed by PCR after cloning of dhhc10::gfp parasites (PbA2187cl1m1). B. Absence of WT dhhc10 mRNA and presence of dhhc10::gfp

mRNA was confirmed in dhhc10::gfp mixed blood stages by RT-PCR. p28 and RNA polimerase II serve as control genes

49

Fig. 5 – ipet::gfp parasite line

diagnostic PCR and RT-PCR analysis.

ipet GFP tagging construct was obtained

by cloning the last ~1000 bp of ipet ORF

excluding the stop codon upstream and in

frame with gfp gene. This construct

includes Toxoplasma gondii dhfr/ts

selectable marker. The construct was

integrated into the ipet locus of

PbAcl15cy1 by single homologous

recombination, resulting in the fusion

of ipet to gfp in ipet::gfp parasites. A.

Genomic integration of the construct, as

well as absence of WT ipet ORF and

presence of tgdhfr/ts was confirmed by PCR after cloning of ipet::gfp parasites (PbA2180cl1m4). B. Absence of WT ipet mRNA and presence of

ipet::gfp mRNA was confirmed in ipet::gfp mixed blood stages by RT-PCR. p28 and RNA polimerase II serve as control genes.

Fig. 6 – epsf::gfp parasite line

diagnostic PCR and RT-PCR analysis.

epsf GFP tagging construct was

obtained by cloning the last ~1000 bp of

epsf ORF excluding the

stop codon upstream and in frame

with gfp gene. This construct includes

Toxoplasma gondii dhfr/ts selectable

marker. The construct was integrated

into the epsf locus of PbAcl15cy1 by

single homologous recombination,

resulting in the fusion

of epsf to gfp in epsf::gfp parasites. A.

Genomic integration of the construct, as

well as absence of WT epsf ORF and presence of tgdhfr/ts was confirmed by PCR after cloning of epsf::gfp parasites (PbA2182cl2m2). B.

Absence of WT epsf mRNA and presence of epsf::gfp mRNA was confirmed in epsf::gfp mixed blood stages by RT-PCR. p28 and RNA

polimerase II serve as control genes.