UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos...
Transcript of UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos...
![Page 1: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/1.jpg)
1
Ilse Fernanda Ferrari
“Caracterização anatômica e molecular da
embriogênese somática direta e indireta de Coffea arabica.”
“Anatomical and molecular characterization of somatic embryos in Coffea arabica by direct and indirect
pathways”
Campinas 2016
UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA
![Page 2: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/2.jpg)
2
Ilse Fernanda Ferrari
“Caracterização anatômica e molecular da embriogênese somática direta e indireta de Coffea arabica.”
“Anatomical and molecular characterization of somatic embryos in Coffea arabica by direct and indirect pathways”
Orientador: Jorge Mauricio Costa Mondego Coorietadora: Juliana Lischka Sampaio Mayer
Campinas 2016
Tese apresentada ao Instituto de Biologia da Universidade Estadual de Campinas como parte dos requisitos exigidos para obtenção do título de Doutora em GENÉTICA E BIOLOGIA MOLECULAR na área de Genética Vegetal e Melhoramento.
Thesis presented to the Biology Institute of the University of Campinas as a partial fulfillment of requirements for the degree of Doctor, in the area of GENETICS AND MOLECULAR BIOLOGY in the area of Plant genetics and Breeding.
ESTE ARQUIVO DIGITAL CORRESPONDE À
VERSÃO FINAL DA TESE DEFENDIDA PELA
ALUNA ILSE FERNANDA FERRARI E
ORIENTADA PELO ORIENTADOR JORGE
MAURICIO COSTA MONDEGO.
![Page 3: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/3.jpg)
3
![Page 4: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/4.jpg)
4
Campinas, 30 de Novembro de 2016.
COMISSÃO EXAMINADORA
Dr. Jorge Mauricio Costa Mondego (Orientador)
Prof. Dr. Rafael Silva Oliveira
Profa. Dra. Alexandra Christine Helena Frankland Sawaya
Dra. Alexandra Bottcher Marchesini
Dr. Walter José Siqueira
Os membros da Comissão Examinadora acima assinaram a Ata de Defesa, que se encontra no processo de vida acadêmica do aluno.
![Page 5: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/5.jpg)
5
“A ciência nunca resolve um problema sem criar pelo menos outros dez”.
(George Bernard Shaw)
![Page 6: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/6.jpg)
6
AGRADECIMENTOS
Primeiramente, gostaria de agradecer ao meu marido Felipe e meus pais Osmar
e Meire, por todo apoio, carinho, compreensão e dedicação nesse período da minha
vida, me motivando a seguir em frente e superar todas as dificuldades.
Aos meus orientadores Dr. Jorge Mondego e Profa. Dra. Juliana Mayer, por
aceitar um projeto de doutorado em tão pouco tempo e, principalmente pela orientação e
oportunidade de realização das atividades em seus laboratórios, incentivando e
enriquecendo minha formação acadêmica.
Ao Prof. Dr. Marcelo Menossi, pela excelente coordenação e por se mostrar
prestativo durante sua gestão na Pós Graduação em Genética e Biologia Molecular.
A CAPES pela concessão da bolsa.
Aos amigos que cultivei durante esse período, em especial, aos amigos da
Fisiologia Vegetal, Laboratório de Anatomia vegetal da Unicamp e do departamento de
Genética do IAC, pela troca de experiência na bancada e pela paciência e
disponibilidade em me ensinar. E também por me ajudarem a encaram com leveza
todos os períodos conturbados do Doutorado.
Aos estagiários, Giovanna A. Marques e Ton Sachetti pelo grande auxílio
prestado no desenvolvimento do trabalho e pela amizade.
Aos técnicos de Laboratório: Eduardo Kiota, Luciano Pereira, Pedro Araujo, Elzira
e Sebastião Militão Jr, pelo imenso auxílio prestado durante minhas atividades em
laboratório;
A todos aqueles que contribuíram direta ou indiretamente para a realização desse
trabalho.
![Page 7: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/7.jpg)
7
Resumo
A embriogênese somática (ES) tem um papel fundamental na micropropagação in vitro
de Coffea, proporcionando a produção de mudas em larga escala e em um menor
tempo. A ES pode ser realizada pela via direta (ESD) e indireta (ESI). Na primeira os
embriões formam-se diretamente de células do explante que se tornam determinadas e
competentes através da formação da massa pró-embriogênica, para o desenvolvimento
do embrião. Na segunda, o desenvolvimento dos embriões somáticos acontece a partir
de calos. O conhecimento sobre a transição de células somáticas para células
embriogênicas é fundamentado em análises histológicas, as quais permitem
acompanhar as características diferenciadoras entre esses tipos celulares. Sabe-se que
durante a formação e diferenciação dos embriões somáticos, os genes LEC1, BBM e
WUS são diferencialmente expressos e atuam como reguladores positivos da indução e
maturação. Considerando a aplicação biotecnológica da ES, o estudo da ontogênese
dos embriões somáticos, bem como dos genes ligados a esse processo, pode ser uma
importante ferramenta de apoio aos programas de melhoramento, conservação de
germoplasma e na identificação e avaliação de novos genótipos. Assim, o presente
trabalho teve por objetivo caracterizar a ontogênese dos embriões somáticos
regenerados via ESD e ESI em explantes foliares de Coffea arabica cultivar Mundo
Novo, analisar a expressão dos genes envolvidos na formação e diferenciação dos
embriões e avaliar a influência dos compostos fenólicos na formação de embriões
durante o processo in vitro. A partir da caracterização da ES e ontogênese dos
embriões, verificamos que a ESI, utilizando explantes de plantas mantidas in vitro, é
mais rápida e eficiente quando comparada às demais condições e que na ESD
o desenvolvimento dos embriões se dá a partir da massa pro-embriogênica que é
essencial para a formação destes. Os genes analisados durante a embriogênse
apresentaram uma maior expressão durante a diferenciação das células que dão origem
ao calo e a massa pro-embriogênica e no desenvolvimento dos embriões.
Palavras chaves: Embriogênse somática, Coffea arabica, Mundo Novo, LEC1, BBM,
WUS.
![Page 8: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/8.jpg)
8
Abstract
Somatic embryogenesis (SE) process enhance seedlings production at reduced time on
in vitro micropropagation of Coffea. SE is divided into two distinct ways: indirect (ISE)
and direct (DSE). DSE promotes embryos formation directly from pro-embryogenic mass
from determined and competent explant cells. ISE develops somatic embryos from
callus. The transition from somatic cells to embryogenic cells is based in histological
analysis, allowing to identify the differentiation features among cell types. Some genes
play a key role during the formation and differentiation of somatic embryos: LEC1, BBM
and WUS. They are differentially expressed and act as regulators of embryogenesis
induction and maturation. Somatic embryogenesis has biotechnological potential to
breeding programs, germplasm conservation, identification and evaluation of new
genotypes. Therefore, the ontogenesis of somatic embryos and associated genes can
revaels new insights and increase our background. Our study intends to characterize the
ontogenesis of somatic embryos from Coffea arabica Mundo Novo regenerated by DSE
and ISE from leaf explants. We analyzed the gene expression in the formation and
differentiation of embryos and, at the same time, evaluated the influence of phenolic
compounds. ISE was clearly faster than DSE for somatic embryogenesis from explants
in vitro.
Key words: Somatic embryogenesis, Coffea arabica, Mundo Novo, LEC 1, BBM, WUS.
![Page 9: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/9.jpg)
9
Lista de Figuras
Capítulo I .............................................................................................................................. 20
Figure 1: Scanning electron micrograph of somatic embryogenesis in Coffea arabica
cv Mundo Novo .............................................................................................................................. 35
Figure 2: Somatic embryogenesis in Coffea arabica cv Mundo Novo. (A, C) Direct
somatic embryogenesis (DSE). ................................................................................................... 36
Figure 3: Process of direct somatic embryogenesis in Coffea arabica cv Mundo Novo ... 38
Figure 4: Process of indirect somatic embryogenesis in Coffea arabica cv Mundo
Novo ................................................................................................................................................. 40
Figure 5: Process of indirect somatic embryogenesis in Coffea arabica cv Mundo
Novo ................................................................................................................................................. 42
Figure 6: Process of indirect somatic embryogenesis in Coffea arabica cv Mundo
Novo, embryo development detail during ontogenesis of explants from in vitro plants ...... 43
Figure 7: Representation of the ontogenesis of Coffea arabica cv Mundo Novo ............... 44
Figure 8: Somatic embryogenesis in Coffea arabica under different histochemical tests . 45
Capítulo II ............................................................................................................................. 46
Figura 1. Tabela adaptada de Li et al. (2004), seleção dos iniciadores otimizados .......... 52
Figura 2. Expressão relativa dos genes BBM2, LEC1, WOX4 durante a embriogênise
somática .......................................................................................................................................... 56
![Page 10: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/10.jpg)
10
Lista de Tabelas
Capítulo II ............................................................................................................................. 46
Tabela 1. Sequência dos iniciadores desenhados ............................................................ 54
Tabela 2. Níveis transcricionais dos genes homeólogos (CaFt, CaCc, CaCe) de
BBM2, expresso pela média entre os Ct ao longo da embriogênese somática direta ...... 54
Tabela 3. Níveis transcricionais dos genes homeólogos (CaFt, CaCc, CaCe) de
BBM2, expresso pela média entre os Ct ao longo da embriogênese somática indireta ... 55
![Page 11: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/11.jpg)
11
Lista de Figuras Suplementar
Capítulo II ............................................................................................................................. 46
Figura suplementar 1. Alinhamento das sequências transcritas traduzidas do gene
BBM2 ................................................................................................................................. 65
Figura suplementar 2. Alinhamento das sequências transcritas traduzidas do gene
LEC1 .................................................................................................................................. 66
Figura suplementar 3. Alinhamento das sequências transcritas traduzidas do gene
WOX4 ................................................................................................................................. 67
![Page 12: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/12.jpg)
12
LISTA DE ABREVIATURAS E SIGLAS
2 iP Isopentenyl adenine
2,4-D 2,4-dichlorophenoxyacetic acid
ANA Naphthalene acetic acid
BBM2 Baby Boom2
DSE Direct somatic embryogenesis
ESD Embriogênese somática direta
ESI Embriogênese somática indireta
HCl Ácido clorídrico
IAC Instituto Agronômico de Campinas
ISE Indirect somatic embryogenesis
LEC1 Leafy Cotyledon 1
NaOH Hidróxido de sódio
PCR Reação em cadeia da polimerase
qRT-PCR Reverse transcription polymerase chain reaction
SE Somatic embryogenesis
SNPs Polimorfismo de nucleotídeo único
WOX4 Wuschel-Related Homeobox 4
![Page 13: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/13.jpg)
13
Sumário
AGRADECIMENTOS .............................................................................................................. 6
Resumo .................................................................................................................................. 7
Abstract .................................................................................................................................. 8
Introdução ........................................................................................................................................ 15
Objetivos .............................................................................................................................. 19
Capítulo I .............................................................................................................................. 20
ORIGIN AND DEVELOPMENT OF SOMATIC EMBRYOS IN COFFEA ARABICA BY
DIRECT AND INDIRECT PATHWAYS. ................................................................................ 20
Artigo submetido a revista - Plant Cell, Tissue and Organ Culture (PCTOC) ............ 20
Abstract............................................................................................................................................ 20
1. Introduction ................................................................................................................................. 21
2. Methodology: .............................................................................................................................. 22
2.1. Biological Material: ............................................................................................................. 22
2.2. Somatic Embryogenesis in Coffea: ................................................................................. 22
2.3. Morphological and anatomical analyzes:........................................................................ 23
3. Results: ....................................................................................................................................... 24
4. Discussion: ................................................................................................................................. 27
5. References: ................................................................................................................................ 30
Capítulo II ............................................................................................................................. 46
CARACTERIZAÇÃO MOLECULAR DOS GENES BBM, LEC E WOX DURANTE A
EMBRIOGÊNESE SOMÁTICA DIRETA E INDIRETA DE COFFEA ARABICA CV.
MUNDO NOVO. .................................................................................................................... 46
Resumo: .......................................................................................................................................... 46
1. Introdução: .................................................................................................................................. 47
2. Metodologia: ............................................................................................................................... 49
2.1. Material vegetal: ................................................................................................................. 49
![Page 14: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/14.jpg)
14
2.2. Embriogênese somática em Coffea: ............................................................................... 49
2.3. Análises in silico: ................................................................................................................ 50
2.4. Desenho dos iniciadores homeólogos específicos: ...................................................... 51
2.5. Extração de RNA total e síntese de cDNA: .................................................................... 52
2.6. PCR quantitativo em tempo real (qRT-PCR): ................................................................ 52
3. Resultados: ................................................................................................................................. 53
4. Discussão: .................................................................................................................................. 57
5. Referências: ............................................................................................................................... 60
6. Material Suplementar: ............................................................................................................... 65
Conclusão geral: ................................................................................................................. 68
![Page 15: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/15.jpg)
15
Introdução Geral
O cafeeiro
O agronegócio cafeeiro tem um papel importante no PIB nacional e no
comércio internacional. A estimativa de produção para 2016 é de 49,64 milhões de
sacas de café beneficiado, sendo 83% da produção nacional de café de Coffea arabica,
o que representa um acréscimo de 14,8% em relação a sacas produzidas em safra 2015
(Conab 2016).
O cafeeiro é uma planta perene, pertencente à família Rubiaceae, tribo
Coffeeae, gênero Coffea (Davis et al. 2006). Teve seu centro de origem na África,
contêm as três espécies utilizadas na produção e bebida do café: C. arabica, C.
canephora e C. liberica (Davis et al. 2006). Coffea L. é caracterizado como
dicotiledônea, de folhas persistentes e flores hermafroditas, porte arbustivo ou arbóreo e
caule lenhoso (Carvalho 2008).
Os plantios comerciais no Brasil em sua grande maioria são de C. arabica,
principalmente pela qualidade superior da bebida, característica aromática e baixo
conteúdo de cafeína. A cultivar Mundo Novo, genótipo 38817-6, é altamente plantada no
Brasil, apresentando porte alto, com maior diâmetro de copa, frutos vermelhos
de maturação média e apresenta ótima qualidade de bebida (Carvalho 2008).
Embriogênese somática
A embriogênese somática (ES) em Coffea é um importante método
de multiplicação in vitro de plantas elite, em larga escala, capaz de maximizar a
propagação do cafeeiro, tanto de cultivares já recomendadas para plantio como de
híbridos vindos de programas de melhoramento genético. Além disso, é de grande
interesse em trabalhos de transformação genética de plantas (Ahmed et al. 2013;
Almeida et al. 2014; Ibrahim et al. 2013). A ES é o processo pelo qual células ou tecidos
somáticos se desenvolvem até a formação completa de uma planta, através de uma
série de desenvolvimentos embriogênicos que apresentam características semelhantes
ao desenvolvimento de embriões zigóticos (Wann 1988; Williams and Maheswaran
1986). Este processo inicia-se com a transição de células somáticas para um estado
embriogênico onde a escolha da fonte apropriada de células competentes e estímulo por
auxina, em condições in vitro, são pré-requisitos para a competência embriogênica nas
células somáticas (Gaj 2004; Gaj et al. 2005). A ES apresenta eventos semelhantes
![Page 16: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/16.jpg)
16
àqueles da embriogênese zigótica, portanto, fornece um atraente modelo experimental
para o estudo molecular e de mecanismos celulares envolvidos nos processo de
desenvolvimento in vivo, que vai do zigoto ao embrião (Gaj 2004; Mordhorst et al. 2002).
A primeira fase da ES é a fase globular, em que o embrião é esférico, ligado através do
suspensor ao tecido materno.
Após a formação dos primórdios cotiledonares, o embrião desenvolve a
forma de coração e, a partir da expansão longitudinal dos cotilédones, o embrião
adquire a forma de torpedo que, na fase final, desenvolve-se no embrião cotiledonar
(Gaj et al. 2005). A propagação através da técnica de ES pode ocorrer pela via direta e
indireta, sendo promissora na produção de mudas em Coffea arabica (Ibrahim et al.
2013). Na embriogênese somática direta (ESD) os explantes passam por uma mínima
proliferação celular, com o surgimento da massa pro-embriogênica, antes da formação
dos embriões (Vasconcellos et al. 2009). Já na embriogênese somática indireta (ESI),
acontece a redeterminação de células diferenciadas para indiferenciadas, com a
proliferação de calos, antes da formação do embrião (Berthouly and Michaux-Ferriere
1996; Sondahl et al. 1985).
Genes ligados à embriogênese
As pesquisas sobre engenharia genética do café têm contribuído de maneira
decisiva para o desenvolvimento da cultura no país, ajudando a elucidar a função,
regulação e interação de genes com importância para a produção agrícola (Mishra and
Slater 2012). A investigação sobre os mecanismos de transição de células somáticas
para embriogênicas está centrada em análises histológicas e na regulação hormonal
(Rose and Nolan 2006). No entanto, sabe-se que durante a formação e diferenciação
dos embriões somáticos, uma série de genes são diferencialmente expressos. O gene
Baby Boom (BBM), isolado a partir de culturas de embriões de micrósporos de Brassica
napus, codifica um fator de transcrição pertencente à família gênica AP2/ERF,
preferencialmente expresso no desenvolvimento de embriões e sementes (Boutilier et
al. 2002). Todos os genes da família AP2/ERF codificam proteínas que apresentam um
domínio conservado AP2 compreendendo de 60-70 resíduos de aminoácidos (Sakuma
et al. 2002). O domínio AP2 é etileno-responsivo e se liga ao fator de transcrição com
domínio ERF. Este domínio, por sua vez, se liga ao GCC-box, que é uma sequência de
DNA envolvida na resposta ao etileno (Ohme-Takagi and Shinshi 1995).
![Page 17: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/17.jpg)
17
Genes que apresentam o domínio conservado AP2/ERF podem
desempenhar papéis distintos no diferentes estágios de desenvolvimento, assim como,
apresentam interações com genes redundantes e induzem diferentes vias de
desenvolvimento dependendo do ambiente genético e celular (Srinivasan et al. 2007). A
expressão ectópica de BBM em Arabidopsis e Brassica levou à formação espontânea de
embriões somáticos e mudanças fenotípicas adicionais, incluindo o crescimento
neoplásico e regeneração de explantes sem adição de hormônios (Boutilier et al. 2002;
Passarinho et al. 2008).
A suprexpressão do BBM pode ser aplicada em espécies com baixa
eficiência de regeneração in vitro, estudos com Populus e Theobroma cacao,
demostraram que a superexpressão do BBM induz a formação de embriões somáticos
sem passar pelo estádio de calo, melhorando a eficiência da regeneração de plantas
transgênicas (Deng et al. 2009; Florez et al. 2015). A expressão ectópica do BBM
resultou na indução de ESI em tabaco transgênicos (Srinivasan et al. 2007). Mutantes
de tabaco com perda de função para BBM apresentaram perda completa da capacidade
de ES (El Ouakfaoui et al. 2010).
O gene LEC1 (Leafy cotyledon 1) desempenham um papel central no
controle da embriogênese zigótica, atuando como regulador da morfogênese (Chugh
and Khurana 2002). A expressão ectópica de LEC1 confere características embrionárias
e resulta na formação de estruturas parecidas com embriões, na superfície da folha,
indicando assim, que o gene desempenha um papel em conferir competência
embriogênica nas células (Lotan et al. 1998).
Este gene codifica uma proteína com a subunidade HAP3 do fator de
transcrição CCAAT, que age como regulador transcricional (Lotan et al. 1998). Estudos
demonstram que a expressão ectópica dos genes LEC de Arabidopsis (AtLEC1 e
AtLEC2) em plantas transgênicas de tabaco promovem embriogênese somática (Guo et
al. 2013). Em C. canephora, o gene LEC1 atua como regulador da ES, sendo expresso
em diferentes estádios de desenvolvimento do embrião (Nic-Can et al. 2013). Segundo
Gaspari-Pezzopane et al. (2011), o gene LEC1 é requerido para a especificação da
identidade cotiledonar e completa maturação de embriões zigóticos em Coffea arabica.
Estudos com plantas de Zea mays L. (milho) demonstram que a expressão
do gene LEC1 foi fortemente detectada na fase precoce do desenvolvimento do embrião
e diminuindo nas fases posteriores, indicando que este gene pode ser usado como
![Page 18: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/18.jpg)
18
marcador molecular do inicio da embriogênese somática (Zhang et al. 2002). Assim, o
gene LEC1, pode ser utilizado como ferramenta para definir mecanismos moleculares
subjacentes que controlam a fase de maturação e o início de ES (Braybrook and Harada
2008).
O gene que atua mais precocemente durante o desenvolvimento embrionário
é o Wuschel-Related Homeobox 4 (WOX4), pertencente a superfamília de fatores
transcrição homeobox (HB) (Gehring et al. 1990). Esta família gênica de fatores
transcrição é diferentemente expressa nas fases iniciais da embriogênese e no
desenvolvimento de órgãos laterais em plantas (Haecker et al. 2004).
Membros da família WOX cumprem funções especializadas em processos
de desenvolvimento chave nas plantas, como a padronização embrionária, manutenção
de células-tronco e formação de órgãos (van der Graaff et al. 2009). Estas funções
podem estar relacionadas com a promoção da divisão celular e/ou prevenção de
diferenciação celular prematura (Wu et al. 2007). Estudos indicam que alguns genes da
superfamília WOX podem ser reguladores importantes da embriogênese somática,
reduzindo a característica recalcitrante de algumas cultivares (Gambino et al. 2010). Em
Arabidopsis, a combinação da atividade dos genes da família WOX, pode regular
diferentes aspectos da proliferação de tecido no desenvolvimento embrionário (Wu et al.
2007).
Considerando que a indução de embriões somáticos de cafeeiro, através de
técnicas de cultura de tecidos vegetais, permite não apenas a propagação vegetativa
em larga escala, como também pode ser usado na formação e manutenção de bancos
de germoplasma e em programas de melhoramento através da transformação genética.
Sendo assim, o estudo da ontogênese dos embriões somáticos, bem como dos genes
ligados a esse processo, pode ser uma importante ferramenta de apoio aos programas
de melhoramento, na criação de novas cultivares e na identificação e avaliação de
novos genótipos.
![Page 19: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/19.jpg)
19
Objetivos
- Caracterizar a ontogênese dos embriões somáticos regenerados via embriogênese
somática direta e indireta de explantes foliares de Coffea arabica cultivar Mundo Novo,
com o propósito de verificar se a origem e as fases de desenvolvimento nos dois
processos são semelhantes.
- Comparar o desenvolvimento dos embriões somáticos via embriogênese direta e
indireta a partir de explantes foliares de plantas adultas mantidas no campo e de
explantes foliares de plantas mantidas in vitro.
- Avaliar a expressão dos genes envolvidos nos diferentes estádios da embriogênse
somática, com o intuito de, melhorar a compreensão sobre os genes envolvidos durante
a formação e diferenciação dos embriões oriundos de explantes foliares em Coffea
arabica.
![Page 20: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/20.jpg)
20
Capítulo I
ORIGIN AND DEVELOPMENT OF SOMATIC EMBRYOS IN COFFEA ARABICA
BY DIRECT AND INDIRECT PATHWAYS.
Artigo submetido a revista - Plant Cell, Tissue and Organ Culture (PCTOC)
Ilse Fernanda Ferrari1,2
, Giovanna Arcolini Marques2, Welington Luis Sachetti Junior
2, Bárbara Borti
Biazotti2, Julieta Andrea Silva de Almeida
3, Jorge Maurício Costa Mondego
1, Juliana Lischka Sampaio
Mayer2,
†,‡
1Centro de Pesquisa e Desenvolvimento de Recursos Genéticos Vegetais, Instituto Agronômico,
Campinas, São Paulo, Brazil
2Departamento de Biologia Vegetal, Instituto de Biologia, Universidade Estadual de Campinas,
Campinas, São Paulo, Brazil
3Centro de Café Alcides Carvalho, Instituto Agronômico, Campinas, São Paulo, Brazil
† These authors share senior authorship.
‡ Correspondence: [email protected]
Abstract
In vitro micropropagation is an important way for coffee multiplication, performed by
somatic embryogenesis (SE). SE can be indirect (ISE) or direct (DSE). The first one
consists of two phases: re-determination of explant cells, followed by formation of callus
and development of somatic embryos from callus. In DSE, embryos form directly from
explant cells that are determined and competent to embryogenic development. This work
characterizes the ontogenesis of somatic embryos regenerated by indirect and direct
way from leaf explants of Coffea arabica cultivar Mundo Novo, comparing the
development of these embryos from leaf explants of adult plants grown in the field and
leaf explants of plants maintained in vitro. It was found that both ways of somatic
embryogenesis there were anatomical features not yet described. ESD the formation of
pro-embryogenic mass is essential for the formation of the embryos and their anatomical
characteristics differ greatly from the callus. ESI depending on the source of explant,
callus development presents differences in anatomy. Explants from in vitro plants have
the formation of layers of cells with intense cell divisions. In addition to producing
embryos in less time than other conditions evaluated.
Key Words: Anatomy, callus, ontogenesis, pro-embryogenic mass, somatic embryos,
Tissue culture.
![Page 21: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/21.jpg)
21
1. Introduction
Micropropagation is an important method of multiplication able to maximize
the in vitro propagation of coffee for elite and hybrid cultivars from breeding programs
(Ahmed et al. 2013; Almeida et al. 2014; Rezende et al. 2012). It can be accomplished
through somatic embryogenesis (SE), a process that allows high plant production
genetically identical to the mother plant in a reduced space and time. SE is based in the
concept of cell totipotency - somatic cells of the plant tissue contain all the genetic
information needed to originate a complete and functional plant (Williams and
Maheswaran 1986). This process presents similar events to those of zygotic
embryogenesis, and can be used for most species in laboratory condition (Gaj 2004),
thus it is an important approach to study the development of plant embryos (Quiroz-
Figueroa et al. 2002a). Initially, there is the explant cell induction acquiring embryogenic
characteristic, followed by expression of somatic embryo (Jiménez 2005), which is a
bipolar structure, without connection to the original vascular tissue, and has unicellular or
multicellular origin (Carman 1990; Dodeman et al. 1997; Feher et al. 2003; Quiroz-
Figueroa et al. 2006; von Arnold et al. 2002).
SE may occur indirectly (ISE) or directly (DSE) (Williams and Maheswaran
1986). ISE consists of two phases: first occurs re-determination of differentiated cells,
followed by division and proliferation activation leading to development of a cell mass
called callus. The second stage is related to initiation and development of somatic
embryos from certain callus cells (Almeida et al. 2005; Berthouly and Michaux-Ferriere
1996; Santana-Buzzy et al. 2007). In DSE, embryos are directly formed from explant
cells that are determined and competent to embryogenic development, not needing
callus formation (Dublin 1981; Emons 1994; Motoike et al. 2007; Vasconcellos et al.
2009; Yasuda et al. 1985).
SE has been successfully applied to Coffea arabica, but some genotypes
respond only to indirect or direct way, while others respond to both. Most studies of C.
arabica comprise which application is better; usually ISE stands out generating a greater
number of somatic embryos than DSE (Vieira and Kobayashi 2000). The development
pattern of somatic embryo has many similar morphological characteristics to the zygotic
embryo. The various embryonic stages of development, from embryo in globular stage,
going through heart and torpedo, are morphologically and anatomically similar to the
formations related in Coffea canephora zygotic embryogenesis (Moens 1965).
![Page 22: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/22.jpg)
22
Leaf tissue is the target tissue when generating embryos (Clarindo et al.
2012; Landey et al. 2013; Ribas et al. 2011; Silva et al. 2014). Genetic engineering
studies have reported that low viability of embryonic tissues and low transformation
efficiency of this type of tissue are major limitation in the genetic transformation of coffee
(Mishra et al. 2010; Ribas et al. 2011). Thus, it is necessary studies to provide a clear
distinction between embryogenic and non embryogenic tissues, demonstrating the best
method for obtaining embryos with high cell viability.
This study aimed to characterize the ontogenesis of somatic embryos
regenerated via direct and indirect somatic embryogenesis from leaf explants of Coffea
arabica cultivar Mundo Novo, in order to verify if the origin and stages of development in
both cases are similar, besides comparing the development of these somatic embryos
from leaf explants of adult plants grown in the field and leaf explants of plants maintained
in vitro.
2. Methodology:
2.1. Biological Material:
Young leaves from field plants and leaves of plants grown in vitro were used,
obtained from Coffea arabica cultivar Mundo Novo produced in the experimental area of
Santa Eliza Farm, IAC, Campinas-SP.
2.2. Somatic Embryogenesis in Coffea:
Asepsis of young leaves of plants under field conditions was performed by
washing the leaves in detergent solution, rinsing in running water, then subjecting them
to sodium hypochlorite solution (2%) for 25 minutes and rinsing three times in autoclaved
distilled water. The disinfected leaves were kept in a humid chamber (80% humidity) for
twenty-four hours, and thereafter, subjected again to sodium hypochlorite solution (2%)
(Ramos et al. 1993). Leaves were cut in laminar flow cabinet, removing the midrib and
edges, obtaining rectangular explants of 1cm2, which were inoculated with the adaxial
side in contact with the culture medium, then kept in dark in a temperature of 25° C
± 2°C.
In vitro plants obtained by DSE were maintained on half strength MS medium
(Murashige and Skoog 1962), with photoperiod of 12 hours light at 25° C ± 2° C. Leaves
were used to obtain the explants in a laminar flow cabinet without the need of asepsis.
Explants, rectangular with 1cm2 were directly inoculated in vitro.
![Page 23: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/23.jpg)
23
Both conditions were subjected to ISE and DSE. For ISE induction it was
used two culture media. First the Murashige and Skoog (1962) culture medium for
induction of embryogenic callus with addition of 30 g L-1
sucrose, 2.5 µM
2,4-dichlorophenoxyacetic acid (2,4-D), and 5 µM kinetin. Then for embryo induction it
was used the modified MS medium (Murashige and Skoog 1962) with half the
concentration of macronutrients and micronutrients with the addition of 20 g L-1
sucrose,
0.5 uM naphthalene acetic acid (NAA) and 2.5 µM kinetin. For DSE induction modified
MS culture medium was used (Murashige and Skoog, 1962), with half the concentration
of macronutrients and micronutrients, added with 20 g L-1 sucrose and 10 µM of
isopentenyl adenine (2 iP). All culture media were solidified with the addition of 5 g L-1
agar and pH adjusted to 5.8 using NaOH or 0.1N HCl prior to autoclaving at 121 ° C and
1.5 atm for 20 minutes.
2.3. Morphological and anatomical analyzes:
Direct and indirect analyses were performed from samples of leaf explants
collected at the time of in vitro inoculation (control) and in different development stages,
at the time intervals of 2, 8, 12, 16, 18, 28, 62 and 72 days after inoculation in culture
medium, somatic embryos were collected from their complete development, presenting
torpedo shape embryos.
In the anatomical analysis, samples were fixed in FAA 50 solution
(formaldehyde, acetic acid and 50% ethanol, 5: 5: 90) (Johansen 1940), then subjected
to vacuum pump to remove the air contained in the tissues, being dried in series of
ethanol and infiltrated in plastic resin (Leica Historesin®) according to manufacturer's
instructions. Samples were sectioned in manual rotary microtome (Leica®) with C-type
knife, 5 micrometers thick. Sections were stained with toluidine blue 0.05% (Sakai 1973)
in phosphate and citrate buffer, pH 4.5 (McIlvaine 1921) and mounted in "Entellan®"
(Merck®) synthetic resin. Different histochemical tests were used: Lugol reagent to
highlight the presence of starch (Berlyn et al. 1976); Xylidine Ponceau reagent for
proteins (Vidal 1969); ferric chloride 3% reagent for phenolic compounds (Johansen
1940); Red ruthenium for mucilage (Gregory and Baas 1989); Nadi reaction for terpenoid
(David and Carde 1964) and Sudan IV for lipid substances (Pearse 1985). Image capture
for result documentation was performed with Olympus DP71 video camera attached to
the Olympus BX 51 microscope.
![Page 24: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/24.jpg)
24
To analyze the surface of the samples in scanning electron microscopy
(SEM), the botanical material was fixed in FAA 50 solution (formaldehyde, acetic acid
and 50% ethanol, 5: 5: 90) (Johansen 1940), dehydrated in series of ethanol and critical
point dried with CO2 in Balzers model CPD 030 equipment. Then the material was
mounted on metal supports and coated with colloidal gold for 220 seconds in Bal-Tec
SCD model 050 equipment. Analysis and micrograph recording was performed with
LEO scanning electron microscope model VP 435 operated at 10 kV, at the Institute of
Biology / Unicamp.
3. Results:
The emergence of pro-embryogenic mass in the DSE (Fig. 1A) and callus in
ISE (Fig. 1D) occurs first at the end of the opposite side to the vascular bundle in contact
with the culture medium. The pro-embryogenic mass in DSE has compact appearance
and smooth surface (Fig. 1B-C; 2A). It appears that the emergence of embryos occurs in
a restricted manner in those areas of pro-embryogenic mass (Fig 1B; 2C) and at the
same time embryos at different stages of development (globular, heart and cotyledon
stage) are observed (Fig. 1C; 2C).
The callus development in ISE has many elongated and disorganized cells
with large intercellular spaces and covered in part by a secretion (Fig. 1E, 2B). Embryos
originate exclusively from callus cells (Figure 1F; 2D) and it is possible to observe
embryos at various stages of development (globular, heart, torpedo and cotyledon) in the
same callus region (Fig 1H-I; 2D). Both in DSE as in ISE is possible to clearly check the
presence of a suspensor, connecting the embryo to the pro-embryogenic mass or callus,
respectively (Fig. 1C and 1G).
Anatomical analysis showed that leaf explants from plant controls grown in
field (Fig. 3A) and in vitro (Fig. 3B) have structural differences. The main differences
between them are that in vitro explants have: i) greater intercellular space in spongy
parenchyma; ii) palisade cells are shorter and rounded; iii) chlorophyll parenchyma cells,
in general, have little dense cytoplasm.
In the early stages of DSE, eight days after explant inoculation, these in vitro
conditions have an intense cell division in the mesophyll from the spongy parenchyma
cells (Fig. 3D), this is the first indication of pro-embryogenic mass formation. As for the
explant derived from leaves of plants field grown, the onset of cell division occurs at eight
days (Fig. 3C), but only becomes more intense 18 days after in vitro inoculation (Fig.
![Page 25: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/25.jpg)
25
3E). In both growing conditions there was proliferation of mesophyll cells presenting cells
with evident nucleus, dense cytoplasm and little intercellular space (Fig. 3D-E).
Formation of pro-embryogenic mass can be seen on the edges of in vitro
explants, near the vascular bundle, 18 days after inoculation (Fig. 3F), and its surface
region has intense cell division, the same happens in the vascular bundle surrounding
region. Superficial mass cells have meristematic characteristics with dense cellular
content and evident nucleus. After 28 days, in field explants (Fig. 3G) occurs the
emergence of pro-embryogenic mass, more delayed and with less intense mitotic activity
when compared to in vitro explants (Fig. 3H).
When the mass appears externally in the explants, 62 days after inoculation,
field explant (Fig. 3I) seem to have lower pro-embryogenic mass than in vitro explants
(Fig. 3J), and this mass has few regions containing cells with dense cytoplasmic contents
on the surface. In vitro explant present masses with larger projection and the innermost
cells are rounded, vacuolated and larger when compared to the smaller peripheral cells
with dense cytoplasmic contents, forming meristem regions. The same is observed in
subsequent samplings of both materials 72 days after in vitro inoculation.
In the initial ISE process, two days after in vitro inoculation, it is possible to
observe presence of greenish phenolic compounds in the chlorenchyma cells, especially
in the palisade, both in field and in vitro (Fig. 4A-B) . With eight days of culture, explants
have regions with a high mitotic activity in the spongy parenchyma, mainly near the edge
of the explant and next to the vascular bundles, both in field (Fig. 4C) and in vitro (Fig.
4D).
The beginning of callus formation can be seen on in vitro explants after 12
days, cells are have high mitotic activity in the entire explant length, these cells do not
have intercellular spaces and form meristems containing cells with dense cytoplasm and
evident nucleus (Fig. 4F). The field explant, 12 days after inoculation (Fig. 4E), remained
similar to that observed after eight days.
Calluses are already visible at the edge of the explant 16 days after
inoculation, noting that in both types of explants there were no changes in the skin. Cells
separate leaving room for callus growth in the palisade, and the callus arises exclusively
from the spongy parenchyma cells (Fig 4G-H; 5A-B). At this stage of callus development,
size and structure of callus are the biggest difference between field and in vitro explants.
Field explants have larger, vacuolated and rounded callus cells (Fig. 4G). In vitro explant
![Page 26: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/26.jpg)
26
have more bulky innermost callus cells when compared to the surface cells which are
smaller and with dense cytoplasmic contents, besides exhibiting strong mitosis (Fig. 4H).
At 28 days of cultivation, explant callus from in vitro and field leaves have
very different structures (Fig. 5A-B). Field explants have more elongated, vacuolated and
with larger intercellular spaces callus cells (Fig. 5A). In the edge of the explant is
possible to observe projection of the vascular bundle toward the callus central portion
(Fig. 5A-C). In vitro explant present callus with greater and vacuolated cells in its inner
region and these cells are lined with smaller cells arranged in continuous layers in
intensive cell division. More externally to these layers, cells become elongated,
vacuolated, and are coated with a continuous cell layer without intercellular spaces (Fig.
5B). The arrangement of these cells with meristematic characteristics in layers becomes
more evident after 30 days of culture (Fig. 6A-B), and it is possible to identify alignment
of these continuous cells with expanding outer layers and with less dense cytoplasm
cells (Fig. 6B). During the callus development, explants coming from field material
showed no obvious anatomical changes, only increasing in size, with more spaced,
elongated, vacuolated and irregularly shaped cells, giving a friable aspect to the callus
(Fig 5C; 5E). In explants of plants grown in vitro, samples of 62 days (Fig. 5D) and 72
days (Fig. 5F) presented larger calluses when compared to the earlier stages of
development, but they still have regions presenting cells with meristematic
characteristics and intense mitotic activity. These meristem cells contribute to the
continued callus growth. Only surface cells of the callus are bulky, have large vacuoles
and intercellular spaces (Figure 5D; 5F).
Embryo formation begins with 62 days of in vitro culture (Fig. 6C). This pro-
embryo comprises few dividing cells in the upper portion that result in the embryo itself
and its basal portion has a set of triangular-shaped cells, which give rise to the
suspensor. The explant with 72 days presents embryos in globular stage, with well-
defined protoderm and presence of the suspensor in the embryo base (Fig. 6D). When
the explant reaches 176 days of culture (Fig. 6E-G), it is possible to observe embryos at
different stages of development. During the transition from embryonic stages (globular to
heart stage) there is a longitudinal elongation (Fig. 6E). The embryos in the torpedo and
heart stages have well defined protoderm and procambium (Fig. 6F) remaining
connected to the callus by the suspensor present in the embryo base (Fig. 6G).
![Page 27: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/27.jpg)
27
During DSE and ISE, the embryo development process is similar for all
studied conditions, regardless of the explant origin (field or in vitro), with a significant
variation in the time which happens each ontogeny stage (Fig. 7).
Histochemical tests carried out during callus (Fig. 8B) and pro-embryogenic
mass development (Fig. 8A; 8C-I) detected the presence of phenolic compounds in DSE
(Fig. 8A) and ISE (Fig. 8B), and lipids in the vacuoles of the palisade parenchyma cells
and in scattered cells bordering the callus and mass (Fig. 8D). Lipids are characterized
as acidic in nature because of their light blue color with Nile Blue sulfate reagent (Fig.
8E).
After 28 days of culture and callus formation, it was possible to verify the
accumulation of starch grains in chlorophyll parenchyma cells and in some callus cells
(Fig. 8C). In DSE starch was seen in vitro. In callus after 72 days of culture, presence of
terpenes was observed in ISE; DSE had terpenes only in the field condition at 16 days
(Fig. 8F). Tests that indicate presence of proteins (Fig. 8G-H) and mucilage (Fig.8I)
demonstrated that proteins accumulate in callus and in pro-embryogenic mass cells (Fig.
8I).
4. Discussion:
Somatic embryogenesis is the process that involves the concept of cell
totipotency, wherein somatic cells from plant tissue undergo a restructuring to generate
embryonic cells, going through a series of developmental stages similar to those of
zygotic embryogenesis. During somatic embryogenesis, cells undergo morphological and
biochemical changes that result in the formation of a somatic embryo. This process
involves hormonal actions, transcription factors and epigenetic regulation (Yang and
Zhang 2010).
Analysis of pro-embryogenic mass development during DSE and callus
development during ISE demonstrated that both originate from mitotically active cells
present in the spongy parenchyma, while epidermal and palisade parenchyma remained
without anatomic changes. During DSE in coffee, embryo emergence does not occur
directly from the explant cells, as previously described for other species (Dublin 1981;
Emons 1994; Motoike et al. 2007; Vasconcellos et al. 2009; Yasuda et al. 1985). Embryo
development occurred indirectly from pro-embryogenic mass, independently of the
explant source. Initially there is the formation of pro-embryogenic mass in the spongy
![Page 28: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/28.jpg)
28
parenchyma, and from the mass there is the embryo development as reported by
Menéndez-Yuffá and de García (1997) and Quiroz-Figueroa et al. (2002b).
Pro-embryogenic mass and callus protruded out of the explants and the
mechanical pressure exerted by them pushed away the palisade parenchyma and the
epidermis. Several studies describe similar events during ISE, however, using field
material as a source of leaf explants (Berthouly and Michaux-Ferriere 1996; Menéndez-
Yuffá and de García 1997; Pierson et al. 1983).
In the initial phase of development, an event that draws attention is the
presence of callus and pro-embryogenic mass near the vascular bundle, showing that
there is a correlation between presence of vascular bundles and early formation of these
tissues. The beginning of cell divisions at the bundles end can be explained by the
presence of pericycle cells with totipotent potential, which is the outermost layer of the
vascular bundle (Xu and Huang 2014). The exposure of tissue in the explant edge due to
sheet incision in regions near vascular bundles of small size facilitates the action of plant
hormones placed in the culture medium, increasing callus and mass formation.
In direct somatic embryogenesis (DSE) tissue development occurs more
rapidly in explant from in vitro plants and later in explant from field plants (Fig. 7). This
occurs both at the beginning of cell division in the spongy parenchyma, and in the
emergence of pro-embryogenic mass. Chlorenchyma material of explants from in vitro
are less differentiated when compared to the parenchymal explants coming from the field
plants, and possibly has a greater totipotency. The most significant difference between
field and in vitro material was the time of embryo development, occurring with 270 and
86 days of culture, respectively (Fig. 7). Studies with cassava cultivars suggest that more
juvenile tissue have a high efficiency in production of somatic embryos (Ravindran et al.
2015).
In vitro grown plants may present a rejuvenation of tissues, which explains
the anatomical and temporal differences of explants from field and in vitro material.
According to Claudot et al. (1993), rejuvenation of mature trees can be obtained by in
vitro culture and is associated with the reappearance of the features found in plant
seedlings. Some cultures, when in vitro, have tissue rejuvenation along with the
acquisition of juvenile morphology (Brand and Lineberger 1992; Ruaud et al. 1992).
Reversion to the juvenile state has the potential to induce embryogenesis in cultures of
species that have so far been recalcitrant (von Aderkas and Bonga 2000).
![Page 29: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/29.jpg)
29
During ISE, initial stages of callus development have little time gap (Fig. 7).
However, from the complete formation of callus it was observed an anatomical difference
in ISE of explants from field and in vitro plants. Callus from field material resemble those
described by Pierson et al. (1983), and callus from in vitro material were similar to the
pro-embryogenic mass, as the presence of large regions of meristematic cells with single
large nucleus and dense cytoplasm, similar structures were observed by Quiroz-
Figueroa et al. (2002a) and Silva et al. (2014).
In histochemical studies, it was observed that in explants from field leaves,
the presence of phenolic compound was more marked than in explants from in vitro
leaves. This can be explained in part by the mechanical disinfection process and
chemical and/or response to injury and strain in which the leaves are subjected to during
in vitro inoculation (Alemanno et al. 2003; van Boxtel and Berthouly 1996). Furthermore,
leaves of adult plants may exhibit greater accumulation of phenols, since accumulation of
phenolic compounds is indicative of mature tissue (Claudot et al. 1993). In explants from
in vitro leaves the small amount of phenol may be related to controlled condition in which
plants are, providing little differentiation of tissues and low presence of products derived
from the secondary metabolism.
Presence of starch detected in ISE was also described by Pierson et al.
(1983) and (Berthouly and Michaux-Ferriere 1996). Starch accumulation may be
associated with embryogenic potential of explants, starch is required for the formation of
somatic embryo, being consumed during the development of meristematic tissue
(Appezzato-da-Glória and Machado 2004; Cunha 2001). Protein reserve appears to be
crucial for formation of embryogenic tissue during ontogenesis. Berthouly and Michaux-
Ferriere (1996) showed that when the protein is absent, embryonic tissue does not
develop.
Embryos, both in DSE and ISE were observed in three developmental stages
(globular, heart and torpedo), which were connected to the callus or pro-embryogenic
mass by the suspensor. Suspensor in the basal region of the embryo connects the
embryo itself to the mother tissue, as cited in other varieties of Coffea by Quiroz-
Figueroa et al. (2006). Although it was not observed unicellular formation in the
beginning of the embryo development, the fact that embryos are attached to the mother
tissue by the suspensor is an indication that it has unicellular origin (Quiroz-Figueroa et
al. 2006; Williams and Maheswaran 1986). Quiroz-Figueroa et al. (2002a) showed that
the somatic embryo in leaf explants of C. arabica, both by the direct route (DSE) and the
![Page 30: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/30.jpg)
30
indirect (ISE) has a single-cell origin. In this study, even with the analysis of numerous
explants and performing sequences sections it was not possible to confirm the unicellular
origin.
In this work, it was found that among the process of somatic embryogenesis
and ontogenesis of embryos, indirect somatic embryogenesis (ISE) using as explants
leaves of in vitro plants proved to be far more promising than the other evaluated
conditions, generating callus with 12 days and embryos with 62 days of culture. This was
not observed in other conditions where the onset of mass and callus as well as embryo
development occurred much later, for example, the explants derived from field plants in
the DSE and ISE took at least 270 days of culture until the appearance of embryos.
According to Vieira and Kobayashi (2000), indirect somatic embryogenesis (ISE), has the
advantage of producing a larger number of somatic embryos over the direct route (DSE).
Time reduction in tissue culture is a difference which can ensure a higher quality of
embryos, decreasing somaclonal variation, which is a frequent problem in cellular
aggregates maintained for long periods in tissue culture (Smith et al. 2000). It is an
important tool to support breeding programs associated with gene regulation studies of
ontogenesis.
Acknowledgment:
The authors thank the Agronomic Institute of Campinas (IAC), for providing
the plant material used in this work and CAPES (Coordination for the Improvement of
Higher Level Personnel) for granting the PhD student - IFF.
5. References:
Ahmed W, Feyissa T & Disasa T (2013) Somatic embryogenesis of a coffee (Coffea
arabica L.) hybrid using leaf explants. Journal of Horticultural Science and
Biotechnology(88):469-475
Alemanno L, Ramos T, Gargadenec A, Andary C & Ferriere N (2003) Localization and
identification of phenolic compounds in Theobroma cacao L. somatic
embryogenesis. Annals of Botany 92(4):613-623
Almeida JAS, Leal RR, Carmazini VCB, Salomon MV & Guerreiro Filho O (2014) Effect
of temperature and cytokinin on the capacity of direct somatic embryogenesis in
Coffea arabica L. genotypes. Coffee Science 9(3):394-399
Almeida JAS, Ramos LCS & Fazuoli LC (2005) Efeito das estações do ano na
calogênese e embriogênese somática em oito genótipos de Coffea arabica.
![Page 31: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/31.jpg)
31
Appezzato-da-Glória B & Machado SR (2004) Ultrastructural analysis of in vitro direct
and indirect organogenesis. Brazilian Journal of Botany 27(3):429-437
Berlyn GP, Miksche JP & Sass JE (1976) Botanical microtechnique and cytochemistry.
Berthouly M & Michaux-Ferriere N (1996) High frequency somatic embryogenesis in
Coffea canephora. Plant cell, tissue and organ culture 44(2):169-176
Brand MH & Lineberger RD (1992) In vitro rejuvenation of Betula (Betulaceae):
biochemical evaluation. American Journal of Botany:626-635
Carman JG (1990) Embryogenic cells in plant tissue cultures: occurrence and behavior.
In vitro Cellular &Developmental Biology 26(8):746-753
Clarindo WR, Carvalho CR & Mendonça MAC (2012) Ploidy instability in long-term in
vitro cultures of Coffea arabica L. monitored by flow cytometry. Plant Growth
Regulation 68(3):533-538
Claudot A, Jay-Allemand C, Magel E & Drouet A (1993) Phenylalanine ammonia-lyase,
chalcone synthase and polyphenolic compounds in adult and rejuvenated hybrid
walnut tree. Trees 7(2):92-97
Cunha A (2001) Ontogénese lipídica associada à embriogênese somática e ao
crescimento de culturas in vitro de linho (Linum usitatissimum L.).
David R & Carde J (1964) Histochimie-coloration differentielle des inclusions lipidiques et
terpeniques des pseudophylles du pin maritime au moyen du reactif NADI.
Comptes rendus herdomadaires des seances de lacademie des sciences
258(4):1338-&
Dodeman VL, Ducreux G & Kreis M (1997) REVIEW ARTICLE Zygotic embryogenesis
versus somatic embryogenesis. Journal of Experimental Botany 48(8):1493-1509
Dublin P (1981) Embryogenèse somatique directe sur fragments de feuilles de caféier
Arabusta. Café Cacao Thé 25(4):237-242
Emons AMC (1994) Somatic embryogenesis: cell biological aspects. Acta Botanica
Neerlandica 43(1):1-14
Feher A, Pasternak TP & Dudits D (2003) Transition of somatic plant cells to an
embryogenic state. Plant cell, tissue and organ culture 74(3):201-228
Gaj MD (2004) Factors influencing somatic embryogenesis induction and plant
regeneration with particular reference to Arabidopsis thaliana (L.) Heynh. Plant
Growth Regulation 43(1):27-47
Gregory M & Baas P (1989) A survey of mucilage cells in vegetative organs of the
dicotyledons. Israel Journal of Botany 38(2-3):125-174
![Page 32: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/32.jpg)
32
Jiménez VM (2005) Involvement of plant hormones and plant growth regulators on in
vitro somatic embryogenesis. Plant Growth Regulation 47(2-3):91-110
Johansen DA (1940) Plant microtechnique McGraw and Hill Book Company.
Landey RB, Cenci A, Georget F, Bertrand B, Camayo G, Dechamp E, Herrera JC,
Santoni S, Lashermes P & Simpson J (2013) High genetic and epigenetic stability
in Coffea arabica plants derived from embryogenic suspensions and secondary
embryogenesis as revealed by AFLP, MSAP and the phenotypic variation rate.
PloS one 8(2):e56372
McIlvaine T (1921) A buffer solution for colorimetric comparison. Journal of Biological
Chemistry 49(1):183-186
Menéndez-Yuffá A & de García EG (1997) Morphogenic events during indirect somatic
embryogenesis in coffee “Catimor”. Protoplasma 199(3-4):208-214
Mishra MK, Devi S, McCormac A, Scott N, Chen D, Elliott M & Slater A (2010) Green
fluorescent protein as a visual selection marker for coffee transformation. Biologia
65(4):639-646
Moens P (1965) Developpement de l'ovule et embryogenese chez/Coffea
canephora/Pierre. Cellule (Bélgica) 65(2):127-147
Motoike SY, Saraiva ES, Ventrella MC, Silva CV & Salomão LCC (2007) Somatic
embryogenesis of Myrciaria aureana (Brazilian grape tree). Plant cell, tissue and
organ culture 89(1):75-81
Murashige T & Skoog F (1962) A Revised Medium for Rapid Growth and Bio Assays with
Tobacco Tissue Cultures. Physiologia Plantarum 15(3):473-497
doi:10.1111/j.1399-3054.1962.tb08052.x
Pearse A (1985) Histochemistry: theoretical and applied vol2: analytical technology.
Pierson E, Van Lammeren A, Schel J & Staritsky G (1983) In vitro development of
embryoids from punched leaf discs ofCoffea canephora. Protoplasma 115(2-
3):208-216
Quiroz-Figueroa F, Fuentes-Cerda C, Rojas-Herrera R & Loyola-Vargas V (2002a)
Histological studies on the developmental stages and differentiation of two
different somatic embryogenesis systems of Coffea arabica. Plant Cell Reports
20(12):1141-1149
Quiroz-Figueroa F, Méndez-Zeel M, Sánchez-Teyer F, Rojas-Herrera R & Loyola-Vargas
VM (2002b) Differential gene expression in embryogenic and non-embryogenic
clusters from cell suspension cultures ofCoffea arabica. Journal of plant
physiology 159(11):1267-1270
![Page 33: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/33.jpg)
33
Quiroz-Figueroa FR, Rojas-Herrera R, Galaz-Avalos RM & Loyola-Vargas VM (2006)
Embryo production through somatic embryogenesis can be used to study cell
differentiation in plants. Plant cell, tissue and organ culture 86(3):285-301
Ramos L, Yokoo E & Gonçalves W Direct somatic embryogenesis is genotype specific in
coffee. In: COLLOQUE Scientifique International sur le Café, 15. Montpellier
(Francia), Juin 6-11, 1993.. 1993.
Ravindran BM, Winter S & Thangaraj M (2015) Influence of Age of Explants and
Genotype on Somatic Embryogenesis in African and Indian Cassava Cultivars.
Journal of Root Crops 40(2):21-27
Rezende JCd, Carvalho CHS, Santos ACR, Pasqual M & Teixeira JB (2012)
Multiplication of embryogenic calli in Coffea arabica L. Acta Scientiarum.
Agronomy 34(1):93-98
Ribas AF, Cenci A, Combes MC, Etienne H & Lashermes P (2011) Organization and
molecular evolution of a disease-resistance gene cluster in coffee trees. BMC
genomics 12(1):240
Ruaud JN, Bercetche J & Pâques M (1992) First evidence of somatic embryogenesis
from needles of 1 year old Picea abies plants. Plant Cell Reports 11(11):563-566
Sakai WS (1973) Simple method for differential staining of paraffin embedded plant
material using toluidine blue O. Biotechnic & Histochemistry 48(5):247-249
Santana-Buzzy N, Rojas-Herrera R, Galaz-Ávalos RM, Ku-Cauich JR, Mijangos-Cortés
J, Gutiérrez-Pacheco LC, Canto A, Quiroz-Figueroa F & Loyola-Vargas VM
(2007) Advances in coffee tissue culture and its practical applications. In vitro
Cellular & Developmental Biology-Plant 43(6):507-520
Silva AT, Barduche D, do Livramento KG, Ligterink W & Paiva LV (2014)
Characterization of a Putative Serk-Like Ortholog in Embryogenic Cell
Suspension Cultures of Coffea arabica L. Plant Molecular Biology Reporter
32(1):176-184
Smith NA, Singh SP, Wang M-B, Stoutjesdijk PA, Green AG & Waterhouse PM (2000)
Gene expression: Total silencing by intron-spliced hairpin RNAs. Nature
407(6802):319-320
van Boxtel J & Berthouly M (1996) High frequency somatic embryogenesis from coffee
leaves. Plant cell, tissue and organ culture 44(1):7-17
Vasconcellos RCdC, Almeida JASd & Silvarolla MB (2009) Indução de embriões
somáticos em explantes foliares de genótipos de Coffea arabica em presença da
citocinina 2-iP.
![Page 34: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/34.jpg)
34
Vidal BC Dichroism in collagen bundles stained with Xylidine-Ponceau 2R. In: Annales
d'histochimie, 1969. vol 15. p 289-296
Vieira LGE & Kobayashi AK (2000) Micropropagação do cafeeiro. Simpósio de
Pesquisas dos Cafés do Brasil, Consórcio Brasileiro de Pesquisa e
Desenvolvimento do Café. Brasil:147-167
von Aderkas P & Bonga JM (2000) Influencing micropropagation and somatic
embryogenesis in mature trees by manipulation of phase change, stress and
culture environment. Tree Physiology 20(14):921-928
von Arnold S, Sabala I, Bozhkov P, Dyachok J & Filonova L (2002) Developmental
pathways of somatic embryogenesis. Plant cell, tissue and organ culture
69(3):233-249
Williams E & Maheswaran G (1986) Somatic embryogenesis: factors influencing
coordinated behaviour of cells as an embryogenic group. Annals of Botany
57(4):443-462
Xu L & Huang H (2014) Genetic and epigenetic controls of plant regeneration. Curr. Top.
Dev. Biol 108:1-33
Yang X & Zhang X (2010) Regulation of somatic embryogenesis in higher plants. Critical
Reviews in Plant Science 29(1):36-57
Yasuda T, Fujii Y & Yamaguchi T (1985) Embryogenic callus induction from Coffea
arabica leaf explants by benzyladenine. Plant and Cell Physiology 26(3):595-597
![Page 35: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/35.jpg)
35
Figure 1: Scanning electron micrograph of somatic embryogenesis in Coffea arabica cv
Mundo Novo. (A-C) Direct somatic embryogenesis; (D-I) Indirect somatic
embryogenesis. (A) Beginning of pro-embryogenic mass formation. (B) Well developed
pro-embryogenic mass, presence of embryos in globular phase (gl) and heart (he). (C)
Embryo in cotyledon phase, connected to the pro-embryogenic mass by the suspensor
(su). (D) Beginning of callus formation. (E) Well developed callus. (F) Embryos in
globular phase (gl). (G) Suspensor detail (su), a structure that connects the embryo itself
to the callus. (H) Embryos in globular (gl) and torpedo (to) phases. (I) Somatic embryos
in torpedo stages (to) and cotyledon (cot). Bars: A-D, F-H = 100μm; E and I = 1mm.
![Page 36: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/36.jpg)
36
Figure 2: Somatic embryogenesis in Coffea arabica cv Mundo Novo. (A, C) Direct
somatic embryogenesis (DSE). (B, D) Indirect somatic embryogenesis (ISE). (A, B, D)
Explant of in vitro grown plants, (C) Explant of field grown plants. (A) Presence of pro-
embryogenic mass in the end of the explant. (B) Well-developed callus on the edge of
explant. (C) Somatic embryos at different stages of development, globular (gl) and
Cotyledonary (cot) connected to the pro-embryogenic mass. (D) Embryos at heart (he),
torpedo (to) and cotyledonary (cot) stages connected to callus. Bars: A-B = 1 mm; C-D =
2mm.
![Page 37: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/37.jpg)
37
![Page 38: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/38.jpg)
38
Figure 3: Process of direct somatic embryogenesis in Coffea arabica cv Mundo Novo.
(A-B) explants controls, observed in both the presence of adaxial epidermis (AD),
palisade parenchyma (Pp), spongy parenchyma (Sp), vascular bundle (Vb), abaxial
epidermis (AB) and stomata (St). (A; C; E; G, I) Foliar explants of field plants (B, D, F, H,
J) Leaf explants from in vitro plants. (C-J) Direct somatic embryogenesis: (C) 8 days,
field, early cell division in the spongy parenchyma (*); (D) 8 days, in vitro, high mitotic
activity in the spongy parenchyma (*); (E) 18 days, field, high mitotic activity in the
spongy parenchyma (*); (F) 18 days, in vitro, presence of pro-embryogenic mass (Pm)
with meristematic cells (Mc) in the mass peripheral region; (G) 28-day, field, beginning
the formation of pro-embryogenic mass (Pm); (H) 28 days, in vitro, pro-embryogenic
mass (Pm) is formed, the presence of surface meristematic cells (Mc). (I) 62 days, field,
pro-embryogenic mass (Pm) formed, presence of sparse meristematic cells (Mc). (J) 62
days, in vitro, pro-embryogenic mass (Pm) with large size compared to the field,
presence of meristematic cells (Mc) on the surface. Arrow: indicates the edge of the
explant with the palisade parenchyma and epidermis without anatomical changes. Bars:
A - F, H = 50μm; E, G, I, J = 100μm.
![Page 39: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/39.jpg)
39
![Page 40: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/40.jpg)
40
Figure 4: Process of indirect somatic embryogenesis in Coffea arabica cv Mundo Novo:
(AB) 2 days, in the field explants (A) and in vitro (B), there is the presence of adaxial
epidermis (AD), palisade parenchyma (Pp), spongy parenchyma (Sp), vascular bundle
(Vb), abaxial epidermis (AB) and stomata (St) .; (C) 8 days, field, early cell division in the
spongy parenchyma (*); (D) 8 days, in vitro, high mitotic activity in the spongy
parenchyma (*); (E) 12 days, field, mitotic activity in scattered cells of the spongy
parenchyma (*). (F) 12 days, in vitro, beginning of callus formation (CI) the palisade
containing meristem cells inside. (G) Explant 16 days, field, presence of well-defined
callus (cl). (H) 16 days, in vitro, callus (Cl) formed with peripheral regions containing
meristematic cells (Mc). Arrow: indicates the edge of the explant with the palisade
parenchyma and epidermis without anatomical changes. Bars: A- G = 50μm; H = 100μm.
![Page 41: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/41.jpg)
41
![Page 42: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/42.jpg)
42
Figure 5: Process of indirect somatic embryogenesis in Coffea arabica cv Mundo Novo.
(A) 28 day, field, callus (C) formed originated near a vascular bundle (Vb); (B) 28 days, in
vitro , callus (C) with a band of meristematic cells (Mc); (C) 62 days, field, callus in
advanced stage of development (Cl), with fusiform cells, vacuolated and with few
intercellular spaces (D) 62 days, in vitro , callus (Cl) in an advanced stage of
development, containing cell mass with denser and smaller cells, has meristematic cells
(Mc) in the outer callus; (E) 72 days, field, callus (Cl) in an advanced stage of
development, containing spindle cells with large intercellular spaces; (F) 72 days, in vitro
, callus (Cl) with spindle and spaced cells, in the central part of callus, presence of
meristematic cells (Mc) in different regions. Arrow: indicates the edge of the explant with
the palisade parenchyma and epidermis without anatomical changes. Bars: A-C = 50μm;
D-F = 100μm.
![Page 43: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/43.jpg)
43
Figure 6: Process of indirect somatic embryogenesis in Coffea arabica cv Mundo Novo,
embryo development detail during ontogenesis of explants from in vitro plants. (A) 30
days, has a meristematic tissue (Mc), containing small cells with dense cytoplasm; (B)
Detail of the meristem region (Mc), with intense cell divisions; (C) 62 days, beginning of
embryo development, presence of suspensor (su); (D) 72 days, detail, presence of
globular embryo in the callus end, has protoderm (Pd) and suspensor (su) well defined;
(E, F, G) 172 days, at (E) in the presence of embryonic transition stage between globular
and heart, has protoderm (Pd) well-defined; (F) Presence of embryos in stages heart
and torpedo present protoderm (Pd) and procambium well developed; (G) suspender
detail (su) at the base of the torpedo embryo. Arrow: indicates the edge of the explant
with the palisade parenchyma and epidermis without anatomical changes. Bars: A-D =
50μm; E = 100μm; F-G = 100μm.
![Page 44: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/44.jpg)
44
Figure 7: Representation of the ontogenesis of Coffea arabica cv Mundo Novo during
the direct somatic embryogenesis (DSE) and indirect (ISE) of explants from plants
cultivated in experimental field (condition - Field) and in vitro plant genebanks (condition
- in vitro ).
![Page 45: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/45.jpg)
45
Figure 8: Somatic embryogenesis in Coffea arabica under different histochemical tests.
(A, D and F) Direct somatic embryogenesis of field grown plants; (C, E, G-I) Direct
somatic embryogenesis of in vitro grown plants; (B) Indirect embryogenesis somatic of
field grown plants. (A, B) Ferric chloride 3% positive of phenols, brown coloration; (C)
Lugol positive of starch, dark blue color; (D) Sudan IV, positive of lipids, yellow coloring;
(E) Nile Blue sulfate, positive for acid lipids, blue color; (F) Nadi reaction, positive of
terpenoid, light blue color; (G, H) Red ruthenium, pectins and mucilage, red color; (I)
Xylidine Ponceau reagent positive of protein, pink color. Bars: A,B = 100µm; C-I =
50µm.
![Page 46: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/46.jpg)
46
Capítulo II
CARACTERIZAÇÃO MOLECULAR DOS GENES BBM, LEC E WOX DURANTE A
EMBRIOGÊNESE SOMÁTICA DIRETA E INDIRETA DE COFFEA ARABICA CV.
MUNDO NOVO.
Resumo:
A embriogênese somática (ES) é um importante meio de multiplicação do cafeeiro, que
permite a produção de plantas geneticamente idênticas à planta matriz, em menor
tempo e espaço físico. A ES pode ocorrer pela via indireta (ESI) ou direta (ESD).
Durante o processo de indução da embriogênese, ocorre a expressão diferencial de
genes, conferindo às células somáticas a capacidade de manifestar um potencial
embriogênico. O padrão de resposta dos genes durante a ES em Coffea ainda não está
bem definido. Sabe-se que alguns genes podem influenciar positivamente a
competência regenerativa das células durante a ES, dentre eles, os genes Baby Boom
(BBM), Leafy Cotyledon 1 (LEC1) Wuschel-Related Homeobox 4 (WOX4). Neste estudo,
foram apresentados os padrões de expressão dos genes BBM2, LEC1 e WOX4, que
durante a ESD tiveram um aumento da expressão com 28 dias de cultura in vitro,
coincidente ao inicio da formação da massa pró-embriogênica. Para os genes BBM2 e
LEC1 houve uma expressão aumentada no início do desenvolvimento do embrião. Já na
ESI, os genes BBM2 e LEC1 tiveram uma maior expressão no estádio de calo e nos
períodos próximos ao surgimento do embrião. O gene WOX4 apresentou uma
expressão aumentada no início da indiferenciação do explante. Sugerindo que os genes
estudados desempenham um papel na promoção da proliferação celular e morfogênese
durante a ES, sendo um provável regular do desenvolvimento do embrião.
Palavras chave: Embriogênses somática; Baby Boom; Leafy Cotyledon 1; Wuschel-
Related Homeobox.
![Page 47: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/47.jpg)
47
1. Introdução:
O café (Coffea arabica) é uma das plantas perenes de maior importância
agrícola no mundo, sendo considerado como segunda commodity mais valorizada
mundialmente (Conab 2016). C. arabica é a única espécie do gênero Coffea que é um
alotetraplóide (2n = 4x = 44) e autofértil com cerca de 10% de polinização cruzada, o
que torna sua base genética bastante estreita. Esta espécie teve origem mais provável
na hibridação de duas espécies ancestrais diplóides, Coffea canephora e Coffea
eugenioides, ou ecótipos relacionados a estas duas espécies (Lashermes et al. 1999). O
genoma de
C. arabica é a fusão dos genomas de seus ancestrais que passaram a ser subgenomas
nessa espécie: C. canephora (CaCc) e C. eugenioides (CaCe). Os genes homólogos
entre os subgenomas de um alopoliplóide são chamados de homeólogos (Mochida et al.
2004). Possivelmente, a diferença fenotípica em relação a seus ancestrais deve-se à
expressão diferencial dos genes homeólogos nos alopoliplóides, o que reflete na
plasticidade genômica e função dos genes em genomas duplicados (Jackson and Chen
2010).
O setor cafeeiro corresponde a uma grande fração do agronegócio brasileiro,
gerando milhões de empregos, diretos ou indiretos. O Brasil é o maior produtor e
exportador mundial de café e, segundo maior consumidor do produto (Conab 2016).
A busca por novas cultivares com maior ganho agronômico tem sido constante,
buscando um aumento da produtividade, competitividade e a qualidade do café
produzido no país. Porém são necessários 20 a 30 anos, em média, para gerar uma
nova cultivar por meio de melhoramento genético clássico (Carvalho 2008).
A embriogênese somática (ES) é uma importante ferramenta de apoio para o
melhoramento genético e fundamental para a micropropagação do café, sendo também,
largamente usada na transformação genética de plantas. A ES é a reestruturação do
desenvolvimento de células somáticas para células embriogênicas e constitui a base de
totipotência celular na maioria das plantas (Williams and Maheswaran 1986). No
entanto, em algumas plantas como o café, a falta de um método eficiente de
regeneração e a recalcitrância da planta representam um grande gargalo na ES (Etienne
2005; Ribas et al. 2011; van Boxtel and Berthouly 1996). A ES pode ocorrer pela via
direta (ESD) ou indireta (ESI). Durante a ESI há inicialmente uma re-determinação das
células que resulta na formação do calo e, a partir deste ocorre desenvolvimento dos
embriões somáticos (Williams and Maheswaran 1986). Na ESD, os embriões formam-se
![Page 48: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/48.jpg)
48
a partir da massa pró-embriogênica que apresenta células meristemáticas competentes
para o desenvolvimento embriogênico (Vasconcellos et al. 2009).
As mudanças celulares que ocorrem durante a ES, envolve a expressão
diferencial de genes, que podem ser ativados ou reprimidos, conferindo a células
somáticas a capacidade de manifestar um potencial embriogênico (Chugh and Khurana
2002; Raghavan 2000). As tentativas de compreender os mecanismos subjacentes à
indução da ES resultaram na identificação de vários genes. Sabe-se que alguns destes
genes podem influenciar positivamente a competência regenerativa das células durante
a ES, dentre eles, os genes Baby Boom (BBM), Leafy cotyledon 1 (LEC1) e Wuschel-
Related Homeobox 4 (WOX4) (Boutilier et al. 2002; Haecker et al. 2004; Lotan et al.
1998).
O gene Baby Boom codifica um fator de transcrição pertencente à família
AP2/ERF expresso preferencialmente no desenvolvimento de embriões e sementes em
plantas (Boutilier et al. 2002b). A expressão ectópica de BBM em algumas espécies
induz a formação espontânea de embriões somáticos (Boutilier et al. 2002; Deng et al.
2009; Florez et al. 2015; Passarinho et al. 2008). Estudos utilizando mutantes para
perda de função demonstraram que as plantas apresentaram incapacidade de executar
ES (El Ouakfaoui et al. 2010). Em Coffea, a expressão diferencial deste gene foi
observada somente após a indução da ESI, demonstrando um potencial uso como
marcador molecular (Nic-Can et al. 2013; Silva et al. 2015).
O gene LEC1 (Leafy cotyledon 1) apresenta uma subunidade HAP3 do fator
de transcrição CCAAT-box (Lotan et al. 1998) e desempenha um papel fundamental
conferindo competência embriogênica para as células somáticas (Lotan et al. 1998),
tanto na embriogênese zigótica, quanto na somática (Chugh and Khurana 2002). A
expressão ectópica de LEC1 nas plantas pode promover ES, sem adição de hormônios,
sendo expresso em diferentes estádios de desenvolvimento da embriogênese (Guo et
al. 2013; Nic-Can et al. 2013; Zhang et al. 2002). O gene LEC1 controla a fase de
maturação e o início da ES e pode ser usado como marcador molecular para a
totipotência celular (Braybrook and Harada 2008; Zhang et al. 2002).
Outro gene que atua na embriogênese somática é o Wuschel-Related
Homeobox 4 (WOX4), pertencente à superfamília de fatores transcrição homeobox (HB)
(Gehring et al. 1990), que atua inicio da embriogênese e no desenvolvimento de órgãos
laterais em plantas (Haecker et al. 2004). Membros da família WOX apresentam funções
![Page 49: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/49.jpg)
49
especializadas no desenvolvimento do embrião zigótico e podem estar relacionadas
com a promoção da divisão celular (van der Graaff et al. 2009; Wu et al. 2007). Estudos
indicam que alguns genes da superfamília WOX podem ser reguladores importantes da
ES, controlando a proliferação de tecido no desenvolvimento embrionário, podendo
reduzir a característica recalcitrante de algumas espécies (Gambino et al. 2010; Wu et
al. 2007).
Considerando que a indução de embriões somáticos de cafeeiro através de
técnicas de cultura de tecidos vegetais permite não apenas aplicações tecnológicas,
como também a propagação vegetativa em larga escala e a transformação genética,
o conhecimento sobre os mecanismos de genéticos e evolutivos ligados a esse
processo pode ser uma importante ferramenta de apoio aos programas de
melhoramento.
Este trabalho teve por objetivo avaliar a expressão dos genes envolvidos nos
diferentes estádios da ESD e ESI com o intuito de melhorar a compreensão sobre a
função e a origem através da separação dos homólogos dos genes envolvidos durante a
formação e diferenciação dos embriões oriundos de explantes foliares em Coffea
arabica cultivar Mundo Novo.
2. Metodologia:
2.1. Material vegetal:
Foram utilizadas folhas jovens provenientes de plantas de campo, obtidas da
matriz Coffea arabica, cultivar Mundo Novo, mantida na área experimental da Fazenda
Santa Eliza do IAC, Campinas-SP.
2.2. Embriogênese somática em Coffea:
Plantas de Coffea arabica cv Mundo Novo, foram submetidas à indução in
vitro da embriogênese somática direta (ESD) e indireta (ESI). A fim de investigar
alterações moleculares nos diferentes estádios de desenvolvimento da formação de
embriões somáticos, foram avaliados os padrões de expressão gênica relativos aos
genes que participam do processo de embriogênese.
A assepsia das folhas jovens foi realizada, lavando-as em solução de
detergente, enxaguadas em água corrente, em seguida submetidas à solução de
hipoclorito de sódio (2 %), por 25 minutos, e lavadas por três vezes em água destilada
![Page 50: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/50.jpg)
50
autoclavada dentro do fluxo laminar. As folhas desinfetadas foram mantidas em câmara
úmida (cerca de 80% de umidade) por 24 horas, e, em seguida submetidas novamente
à solução de hipoclorito de sódio (2 %), nas condições anteriores (Ramos et al. 1993).
Em câmara de fluxo laminar, as folhas foram cortadas retirando-se a nervura central e
as bordas obtendo-se explantes retangulares com 1cm2, os quais foram inoculados em
meio de indução ESD e ESI, com a face adaxial em contato com do meio de cultura,
mantidos na ausência de luz sob a temperatura de 25º C ± 2°C.
Para a indução da ESD foi utilizado o MS (Murashige and Skoog 1962)
modificado, com a metade da concentração dos macronutrientes e micronutrientes,
acrescido de 20 g L-1
sacarose e 10 µM de Isopentenil adenina (2 iP). Todos os meios
de cultura foram sólidos, com a adição de 5 g L-1
de Agar e com o pH ajustado para 5,8
utilizando NaOH ou HCl 0,1N antes da autoclavagem a 121o C e 1,5 atm por 20 minutos.
Para a indução da ESI foram utilizados dois meios de cultura. O primeiro meio de cultura
foi o MS para a indução do calo embriogênico com a adição de 30 g L-1
de sacarose, 2,5
µM de ácido 2,4-dichlorofenoxiacetico (2,4-D) e 5 µM de cinetina. Após 50 dias de
cultivo
in vitro os explantes foram repicados para o meio de indução de embriões, meio MS
modificado com a metade da concentração dos macronutrientes e micronutrientes com a
adição de 20 g L-1
de sacarose, 0,5 de µM ácido naftaleno acético (ANA) e 2,5 de µM
cinetina.
Para analise de expressão gênica, os explantes foram coletados, tanto na via
direta quanto na via indireta, no momento da inoculação in vitro (controle, 0 dias) e em
diferentes fases de desenvolvimento, nos intervalos de tempo, 8, 16, 28 e 60 dias após
a inoculação no meio de cultura. Os embriões somáticos foram coletados em duas fases
distintas de desenvolvimento, globular e torpedo, na embriogênese somática direta.
2.3. Análises in silico:
Três genes relacionados com a embriogênese foram selecionados para
avaliação de expressão gênica: Baby Boom 2 – BBM2, Leafy Cotyledon 1 - LEC1
e Wuschel-Related Homeobox 4 - WOX4. Inicialmente, as sequências desses genes
foram buscadas no banco de dados TAIR - www.arabidopsis.org/news/events.jsp, sendo
utilizadas como referência para a busca por homologia nas bases de dados NR do
gênero Coffea canephora disponível no National Center for Biotechnology Information -
NCBI - http://www.ncbi.nlm.nih.gov, utilizando a ferramenta BLASTx. Foram
![Page 51: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/51.jpg)
51
selecionados os alinhamentos com maior significância, filtrados por e-value >10-5
,
comparando as sequências traduzidas com as sequências proteicas disponíveis no
banco de dados. Uma segunda busca foi realizada a fim de identificar os homólogos dos
genes selecionados em Coffea arabica e Coffea eugenioides. As sequências transcritas
completas (CDS) de BBM2, LEC1 e WOX4 de C. canephora foram utilizadas como
‘iscas’ em busca nos bancos provenientes de sequências de ESTs do Projeto Brasileiro
do Genoma Café - PBGC (Mondego et al. 2011; Vieira et al. 2006) e no transcriptoma
de C. eugenioides (Yuyama et al. 2016).
2.4. Desenho dos iniciadores homeólogos específicos:
A fim de detectar genes homeólogos de BBM2, LEC1 e WOX4 em C.
arabica, as sequencias destes em C. canephora, C. eugenioides e C. arabica foram
alinhadas. O alinhamento foi realizado utilizando a ferramenta on
line MUSCLE disponível em http://www.ebi.ac.uk/Tools/msa/muscle/. Detectando por
meio de alinhamento os polimorfismos que diferenciam os sub-
genomas CaCc e CaCe em C. arabica.
Os genes selecionados foram utilizados para o desenho dos iniciadores
observando os alinhamentos dos reads nos contigs. Foram desenhados iniciadores nas
regiões onde existem polimorfismos entre os homeólogos (CaCc e CaCe) de acordo
com a técnica TaqMAMA descrito por Li et al. (2004). Para o gene BBM2, os iniciadores
diretos tem o polimorfismo nos dois últimos nucleotídeos a 3’, deste modo, dois
mismatches ocorrem entre o iniciador e o alelo a ser discriminado. Para o gene WOX4,
os iniciadores diretos foram desenhados nas regiões onde existia apenas um
polimorfismo entre os homeólogos (CaCc e CaCe), no último nucleotídeo a 3’ e foi
acrescentado um mismatch antes deste, a fim de aumentar o grau de discriminação
entre os homeólogos. Deste modo, dois mismatches ocorrem entre o iniciador no alelo a
ser discriminado, enquanto só um mismatch ocorre no alelo de interesse (o último
nucleotídeo na região 3’). Os mismatches adicionais foram selecionados baseados nas
combinações sugeridas por Li et al. (2004) (Fig. 1). Para o gene LEC1 não foi possível
desenhar iniciadores específicos diferenciando os genes homeólogos. Para os três
genes selecionados, BBM, LEC e WOX, foram desenhados iniciadores controles (CaFt),
fora da região com polimorfismos entre os homeólogos.
![Page 52: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/52.jpg)
52
Figura 1. Tabela adaptada de Li et al. (2004), seleção dos iniciadores otimizados para
obter uma maior força de descriminação alélica, utilizando combinações de alelos
específicos. Código de cor: G:T e A:C mismatches estão em verde; C:C mismatches
estão em azul; C:T e T:T mismatches estão em branco. Purina:purina (A: A, G: G, G: A)
mismatches estão em amarelo.
2.5. Extração de RNA total e síntese de cDNA:
Os RNAs do material vegetal foram extraídos utilizando o protocolo de
extração de RNA com o reagente Concert, realizado de acordo com manual: Concert™
Plant RNA Purification Reagent (Invitrogen). A integridade dos RNAs foi avaliada por
eletroforese em gel de agarose 1,5%, visualizada sob luz ultravioleta em
fotodocumentador (Loccus Biotecnologia) e quantificadas em espectrofotômetro
NanoVue Plus (GE Healthcare, EUA). As amostras de RNA foram tratadas com o Kit
RQ1 RNase-Free DNase (Promega), de acordo com o protocolo do fabricante, para
retirada dos vestígios de DNA genômico. Um volume referente a 3 μg de RNA total foi
utilizado para sintetizar a primeira fita de cDNA com o kit de transcriptase reversa
“SuperScrit II RT” (ThermoFisher Scientific), de acordo com as instruções do fabricante.
2.6. PCR quantitativo em tempo real (qRT-PCR):
As análises de PCR quantitativa foram realizadas no equipamento 7500 Fast
(ThermoFisher Scientific) usando Platinum®
SYBR® Green qPCR SuperMix-UDG with
ROX (Invitrogen) para acompanhar a síntese de dsDNA. As condições dos PCRs foram:
![Page 53: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/53.jpg)
53
50°C por 2 min, 95°C por 20 s, seguido por 40 ciclos de 95°C por 15 s e 60°C por 30 s.
A confirmação de especificidade do amplicon foi baseada na curva de dissociação no
final de cada corrida. A expressão dos genes alvo foi normalizada com o gene BUBI,
considerado controle endógeno eficiente para café (Barsalobres-Cavallari et al. 2009).
A normalização foi realizada utilizando-se a equação ΔCT = CT (gene alvo) - CT (controle
endógeno). A calibração foi determinada pela fórmula ΔΔCT = ΔCT (amostra) - ΔCT
(calibrador). O calibrador é uma amostra usada como base para resultados de
expressão comparativa. A quantificação relativa foi obtida pela fórmula 2–ΔΔ C
T. Os
resultados foram normalizados usando CTs (Ciclo Threshold) obtidos para controles
endógenos presentes na mesma reação. O CT foi determinado pelo número de ciclos no
qual a fluorescência gerada dentro de uma reação cruza o limiar (“Threshold”). O
método usado foi o CT comparativo (quantificação relativa). A expressão relativa foi
submetida à analise estatística ANOVA seguida por teste Tukey utilizando o software
Statistica (StatSoft).
3. Resultados:
Os genes BBM2, LEC1 e WOX4 foram selecionados por desempenharem
um papel crucial na ES. Inicialmente pretendia-se distinguir expressão diferencial dos
homeólogos (EDH) em C. arabica, visto que o seu genoma é a fusão dos genomas
ancestrais diplóides, Coffea canephora e Coffea eugenioides. Portanto, para BBM2 e
WOX4, dois iniciadores foram desenhados para cada sítio polimórfico, um que
preferencialmente amplifica um alelo 1 (homeólogo 1) e um que amplifica
preferencialmente o alelo 2 (homeólogo 2) (Tabela 1). Já para o gene LEC1, como não
havia regiões com polimorfismo entre os contigs analisados, foi desenhado um iniciador
direto (Tabela 1). Para todos os genes, os iniciadores reversos firam desenhados para
amplificar um fragmento menor que 200 bp. Além disso, para os três genes analisados
foram desenhados iniciadores sem os polimorfismos e os mismatches adicionais
(iniciadores CaFt), que teoricamente irão levar a amplificação de ambos os genes
homeólogos (Tabela 1). O iniciador utilizado como controle endógeno para todas as
reações de qPCR foi o BUBI, referentes ao gene da Ubiquitina10 (Tabela 1). Contudo, a
falta de sequencias ESTs de Coffea eugenioides aliada à baixa eficiência dos
iniciadores para o gene WOX4, não possibilitaram um separação entre os homeólogos
CaCc e CaCe em LEC1 e WOX4 (Fig. suplementar 1 - 2). Com base nos dados in silico,
foram desenhados iniciadores específicos para os homeólogos CaCc e CaCe para
BBM2 a partir da avaliação da anotação de SNPs de uma montagem híbrida de ESTs
![Page 54: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/54.jpg)
54
entre C. canephora e C. arabica (Fig. suplementar 2). Para todos os genes foram
desenhados iniciadores controle CaFt.
Tabela 1. Sequencia dos iniciadores desenhados para avaliar a expressão diferencial
dos homeólogos (CaCc e CaCe). Em negrito as regiões com polimorfismo entre os
homeólogos.
Gene Nome Sequência (5’→ 3’)
BBM2
BBM2 CaFt ATCATCAATGGAAATGATGGGG
BBM2 CaCc GAAATGATGGGGCTGTGGGT
BBM2 CaCe GGAAATGATGGGGTTGTGGTG
BBM2 CaRv CAGTCAAGAGGGGCAAAGCA
WOX4
WOX4 CaFt AACCACAAAGCACGCGAGAG
WOX4 CaCc CACAAAGCACGCGAGACG
WOX4 CaCe CCACAAAGCACGCGAGACA
WOX4 CaRv CTAATGGTAGTGGTGGTGGTGACA
LEC1 LEC1 CaFt CGCTGCTGTTCCAATTCACA
LEC1 CaRv AGCAGCCTGGGAAGAAGTTG
UBI BUBI-F AAGACAGCTTCAACAGAGTACAGCAT
BUBI-R GGCAGGACCTTGGCTGACTATA
Analisando as diferenças nos níveis transcricionais dos homeólogos CaFt,
CaCc, CaCe de BBM2, durante a ESD e a ESI, foi possível verificar que na ESD não
houve diferença significativa entre os subgenomas (Tabela 2). Assim, não foi possível
diferenciar os homeólogos para este gene. Já durante ESI o subgenoma CaCe é
diferentemente expresso em relação aos CaFt e CaCe (Tabela 3).
Tabela 2. Níveis transcricionais dos genes homeólogos (CaFt, CaCc, CaCe) de BBM2,
expresso pela média entre os Ct ao longo da embriogênese somática direta (ESD).
Segundo o teste ANOVA seguido por teste Tukey (P<0,05), não há diferença
significativa entre a expressão dos genes.
Gene Média dos Ct – Ft Média dos Ct – Cc Média dos Ct - Ce
31,802 31,877 31,937
CaFt - 0,851410 0,625311
CaCc 0,851410 - 0,905636
CaCe 0,625311 0,905636 -
![Page 55: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/55.jpg)
55
Tabela 3. Níveis transcricionais dos genes homeólogos (CaFt, CaCc, CaCe) de BBM2,
expresso pela média entre os Ct ao longo da embriogênese somática indireta (ESI). Os
asteriscos representam diferenças significativas na expressão dos genes, segundo o
teste ANOVA seguido por teste Tukey (P<0,05).
Gene Média dos Ct - Ft Média dos Ct – Cc Média dos Ct - Ce
34,756 34,647 32,781
CaFt - 0,907658 0,000144*
CaCc 0,907658 - 0,000145*
CaCe 0,000144* 0,000145* -
De maneira geral, durante a ESD o gene BBM2 apresenta baixa expressão
nos estádios iniciais de desenvolvimento da massa pró-embriogênica, 0, 8 e 16 dias. A
partir de 28 dias, teve um incremento na expressão do gene, e no embrião globular
houve uma expressão aumentada para o homeólogo CaFt. Os dois estádios cujo gene
BBM2 foi mais diferencialmente expresso na ESD foram o globular e torpedo (Fig. 2A).
Na ESI, a expressão relativa dos genes homeólogos (CaFt, CaCc, CaCe) se manteve
baixa durante todo o desenvolvimento do calo, apresentando um aumento significativo
no calo já desenvolvido, 60 dias (Fig. 2B).
O gene LEC1, na ESD, apresentou o mesmo padrão de expressão que o
gene BBM2 no início do desenvolvimento embriogênico. Com 28 dias é possível verificar
um aumento da expressão. Porém apenas no embrião globular houve um aumento
significativo da expressão do gene (Fig. 2C). Durante a ESI a expressão relativa tem um
incremento a partir de 28 dias de cultivo in vitro (Fig. 2D).
Para o gene WOX4, a expressão relativa não teve um aumento significativo
ao longo do desenvolvimento, tanto na ESD, quanto na ESI. Observa-se que na ESD a
expressão aumenta no estádio 28 dias (Fig. 2F). Já na ESI, o aumento da expressão se
dá com 8 dias de cultura in vitro e se mantem mais elevado que a condição controle – 0
dias (Fig. 2D).
O padrão de expressão dos genes durante a embriogênise na ESD
apresentou um aumento com 28 dias para todos os genes testados (Fig. 2 A, C, E).
Durante a ESI, os genes BBM2 e LEC1 apresentaram uma expressão elevada no calo
desenvolvido
![Page 56: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/56.jpg)
56
(60 dias) já o gene WOX4 apresentou uma expressão maior no inicio do
desenvolvimento embriogênico com 8 dias de cultivo in vitro (Fig. 2 B,D,F).
Figura 2. Expressão relativa dos genes BBM2, LEC1, WOX4 durante a embriogênise
somática direta e indireta em Coffea arabica cv Mundo Novo. (A, C, E) Embriogênese
somática direta. (B, D, F) Embriogênese somática indireta. (A e B) gene Baby Boom2 –
BBM2. (C e D) gene Leafy Cotyledon 1 - LEC1. (E e F) gene Wuschel-Related
Homeobox 4 - WOX4. Os dados foram submetidos à ANOVA seguido por teste Tukey
(p< 0,05), os asteriscos representam diferenças significativas na expressão dos genes
ao longo da embriogênese somática. Barras correspondem ao erro padrão da média.
![Page 57: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/57.jpg)
57
4. Discussão:
Neste estudo, foram avaliadas as expressões diferenciais dos genes BBM2,
LEC1 e WOX4, fornecendo informações sobre o padrão de expressão durante o
desenvolvimento da ES, tanto na via direta quanto na indireta. Paralelamente, tentou-se
identificar as cópias homeólogas no genoma de C. arabica. A homeologia pode ser
estudada para o gene Baby Boom (BBM2). Durante a embriogênese somática indireta, o
homeólogo derivado do subgenoma CaCe foi predominante expresso no calo. Essa
diferença na expressão pode ter ocorrido em resposta a estresse sofrido durante a ESI,
visto que as células passam pelo processo de indiferenciação, dando origem ao calo.
Sabe-se que os genes homeólogos podem apresentar padrões de expressão desigual,
em resposta a diferentes tipos de estresse (Grover et al. 2012; Liu and Adams 2007).
As diferenças na expressão gênica podem também ser resultantes de mudanças na
regulação cis e/ou trans, que pode afetar a transcrição e a estabilidade do mRNA ou
resultar na divergência funcional de fatores de transcrição (Shi et al. 2012; Wittkopp et
al. 2004).
O perfil de expressão do gene BBM2, na ESD, apresenta uma expressão
aumentada com 28 dias de cultivo in vitro, quando o explante já apresenta uma massa
pró-embriogênica desenvolvida com presença de células meristemáticas (dados
apresentados no primeiro capítulo), indicando que o gene pode estar envolvido na
formação das regiões meristemáticas. O mesmo foi observado em C. canephora, onde a
expressão diferencial deste gene foi observada somente após o desenvolvimento da
massa pró-embriogênica, indicando que o BBM induz vias relacionadas com a
proliferação e crescimento celular (Nic-Can et al. 2013). Boutilier et al. (2002) propôs
que o gene BBM está envolvido na conversão do estado vegetativo para o estado
embriogênico, demonstrando em Brassica napus que o gene atua na diferenciação das
células embrionárias a partir de células somáticas. O gene também apresentou uma
expressão relativa aumentada, nos estádios embrionários: globular e torpedo. Durante
o desenvolvimento do embrião, a maior expressão foi observada na fase globular, o
mesmo foi descrito para Arabidopsis thaliana (Kulinska-Lukaszek et al. 2012). Os dados
obtidos no trabalho corroboram com o descrito na literatura, em que BBM parece
desempenhar um papel importante na formação e diferenciação do embrião durante a
ES (El Ouakfaoui et al. 2010; Florez et al. 2015; Galinha et al. 2007; Passarinho et al.
2008).
![Page 58: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/58.jpg)
58
Durante a ESI, a expressão diferencial do BBM2 ocorreu com 60 dias de
cultura in vitro, este pico na expressão pode ser explicado pela presença da auxina,
ácido naftaleno acético (ANA), no meio de indução de embriões, para o qual os calos
foram transferidos após 50 dias de cultura. Li et al. (2014) e Kulinska-Lukaszek et al.
(2012) comprovaram que a atividade aumentada do gene BBM pode estar relacionada à
presença de auxina no meio de cultura. Isto se deve ao fato de que o gene BBM2
apresenta um domínio AP2. Vários genes contendo esse domínio são altamente
induzidos na presença do hormônio ANA (Imin et al. 2007).
Analisando a expressão relativa do gene LEC1, observou-se que ele
apresenta um perfil de expressão parecido com o relatado para o gene BBM, inferindo
que possa haver funções complementares entre os genes (Gaj et al. 2005). Ambos
participam da aquisição da competência embriogênica nas células (Boutilier et al. 2002;
Gaj et al. 2005). LEC1 é um regulador positivo nas fases precoces e tardias da
embriogênese e sua expressão é necessária para induzir ES (Lotan et al. 1998),
enquanto BBM é essencial para a proliferação celular e morfogênese durante a
embriogênese (Passarinho et al. 2008). Durante a ESD, o gene LEC1 apresenta maior
expressão nos estádio 28 dias e no embrião globular, demonstrando sua função na
aquisição de competência embriogênica da célula e na formação do embrião.
Durante a ESI, os níveis de expressão de LEC1 foram baixos, apresentando
um aumento discreto com 28 e 60 dias de cultura in vitro. Estudos com calos de Vitis
vinífera, verificaram que o gene LEC1 é expresso durante a ES, antes do aparecimento
visível do embrião, comprovando seu envolvimento durante os processos de cultivo in
vitro (Schellenbaum et al. 2008). Mutantes nulos de Arabidopsis apresentaram uma
capacidade limitada de induzir a formação de embriões a partir de calos, sugerindo que
o gene LEC por ativar genes essenciais para a iniciação da ES (Gaj et al. 2005),
inferindo assim que este gene está envolvido na aquisição de competência
embriogênica.
A correlação entre as expressões dos genes LEC1 e BBM pode ser
explicada em parte, pela presença da marca epigenética H3K27me3 em ambos os
genes, que em condições embriogênicas, atua na reprogramação epigenética, através
de metilação do DNA e modificação das histonas nas células somáticas, para promover
a embriogênese somática e o desenvolvimento de embriões em café (Nic-Can et al.
2013).
![Page 59: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/59.jpg)
59
O perfil de expressão do gene WOX4, em ambas as vias da ES, apresentou
um discreto aumento da expressão relativa a partir do início da divisão celular, ou seja,
28 dias na ESD e a partir de 8 dias na ESI. Genes da família WOX cumprem funções
especializadas em processos chaves de desenvolvimento em plantas, como a
padronização embrionária, manutenção de células-tronco e formação de órgãos (van
der Graaff et al. 2009). Estas funções podem estar relacionadas com a promoção da
divisão e diferenciação de celular em plantas (Aichinger et al. 2012; Hirakawa et al.
2008; van der Graaff et al. 2009).
Poucos estudos relatam a atividade e função do gene WOX4 durante a ES.
Etchells et al. (2013) demonstrou que o gene WOX4 deve agir de forma redundante com
outros fatores de transcrição da família WOX que desempenham um papel importante
na coordenação da transcrição e estão envolvidos nas fases iniciais da embriogênese,
na ativação dos meristemas caulinar e radicular e, na organogênese em plantas
(Haecker et al. 2004). Estudos indicam que alguns genes da superfamília WOX podem
ser reguladores importantes da ES, reduzindo a característica recalcitrante em cultivares
de V. vinífera (videira) (Gambino et al. 2010).
Neste presente trabalho foram apresentados os padrões de expressão dos
genes BBM2, LEC1 e WOX4 que, durante a ESD, tiveram um pico de expressão com 28
dias de cultura in vitro, tempo este que culmina com o início da formação da massa
pró-embriogênica e com a presença de células meristemáticas. Já na ESI, os três genes
apresentaram um perfil de expressão parecido com o descrito na literatura, ou seja, os
genes BBM2 e LEC1 tiveram um aumento da expressão no calo e nos períodos
próximos ao surgimento do embrião. Já o gene WOX4 apresentou uma expressão
aumentada no início da indiferenciação do explante.
Considerando que na maioria dos estudos apresentados até o momento,
os genes foram avaliados apenas na ESI, pouco se sabe ainda, sobre o padrão de
expressão destes genes durante a ESD. Assim, foi possível comprovar que para Coffea
arabica os três genes estudados, podem desempenhar um papel na promoção da
proliferação celular e morfogênese durante a ESD e a ESI, sendo um provável regular
do desenvolvimento do embrião na ESD.
![Page 60: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/60.jpg)
60
5. Referências:
Aichinger E, Kornet N, Friedrich T & Laux T (2012) Plant stem cell niches. Annual review
of plant biology 63:615-636
Barsalobres-Cavallari CF, Severino FE, Maluf MP & Maia IG (2009) Identification of
suitable internal control genes for expression studies in Coffea arabica under
different experimental conditions. BMC molecular biology 10(1):1
Boutilier K, Offringa R, Sharma VK, Kieft H, Ouellet T, Zhang L, Hattori J, Liu C-M, van
Lammeren AA & Miki BL (2002a) Ectopic expression of BABY BOOM triggers a
conversion from vegetative to embryonic growth. The Plant Cell Online
14(8):1737-1749
Braybrook SA & Harada JJ (2008) LECs go crazy in embryo development. Trends in
plant science 13(12):624-630
Carvalho CHS (2008) Cultivares de café: origem, características e recomendações.
Embrapa Café - Brasília
Chugh A & Khurana P (2002) Gene expression during somatic embryogenesis-recent
advances. Current Science 83(6):715-730
Conab (2016) Acompamento da safra brasileira:café. Companhia Nacional de
Abastecimento. V1:108
Deng W, Luo K, Li Z & Yang Y (2009) A novel method for induction of plant regeneration
via somatic embryogenesis. Plant science 177(1):43-48
Denoeud F, Carretero-Paulet L, Dereeper A, Droc G, Guyot R, Pietrella M, Zheng C,
Alberti A, Anthony F & Aprea G (2014) The coffee genome provides insight into
the convergent evolution of caffeine biosynthesis. Science 345(6201):1181-1184
El Ouakfaoui S, Schnell J, Abdeen A, Colville A, Labbé H, Han S, Baum B, Laberge S &
Miki B (2010) Control of somatic embryogenesis and embryo development by
AP2 transcription factors. Plant molecular biology 74(4-5):313-326
Etchells JP, Provost CM, Mishra L & Turner SR (2013) WOX4 and WOX14 act
downstream of the PXY receptor kinase to regulate plant vascular proliferation
independently of any role in vascular organisation. Development 140(10):2224-
2234
Etienne H (2005) Somatic embryogenesis protocol: coffee (Coffea arabica L. and C.
canephora P.) Protocol for somatic embryogenesis in woody plants. Springer, p
167-179
![Page 61: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/61.jpg)
61
Florez SL, Erwin RL, Maximova SN, Guiltinan MJ & Curtis WR (2015) Enhanced somatic
embryogenesis in Theobroma cacao using the homologous BABY BOOM
transcription factor. BMC plant biology 15(1):1
Gaj MD, Zhang S, Harada JJ & Lemaux PG (2005) Leafy cotyledon genes are essential
for induction of somatic embryogenesis of Arabidopsis. Planta 222(6):977-988
Galinha C, Hofhuis H, Luijten M, Willemsen V, Blilou I, Heidstra R & Scheres B (2007)
PLETHORA proteins as dose-dependent master regulators of Arabidopsis root
development. Nature 449(7165):1053-1057
Gambino G, Minuto M, BocCaCci P, Perrone I, Vallania R & Gribaudo I (2010)
Characterization of expression dynamics of WOX homeodomain transcription
factors during somatic embryogenesis in Vitis vinifera. Journal of Experimental
Botany:349
Gehring W, Müller M, Affolter M, Percival-Smith A, Billeter M, Qian Y, Otting G &
Wüthrich K (1990) The structure of the homeodomain and its functional
implications. Trends in Genetics 6:323-329
Grover C, Gallagher J, Szadkowski E, Yoo M, Flagel L & Wendel J (2012) Homoeolog
expression bias and expression level dominance in allopolyploids. New
Phytologist 196(4):966-971
Guo F, Liu C, Xia H, Bi Y, Zhao C, Zhao S, Hou L, Li F & Wang X (2013) Induced
expression of AtLEC1 and AtLEC2 differentially promotes somatic embryogenesis
in transgenic tobacco plants. PloS one 8(8):e71714
Haecker A, Groß-Hardt R, Geiges B, Sarkar A, Breuninger H, Herrmann M & Laux T
(2004) Expression dynamics of WOX genes mark cell fate decisions during early
embryonic patterning in Arabidopsis thaliana. Development 131(3):657-668
Hirakawa Y, Shinohara H, Kondo Y, Inoue A, Nakanomyo I, Ogawa M, Sawa S, Ohashi-
Ito K, Matsubayashi Y & Fukuda H (2008) Non-cell-autonomous control of
vascular stem cell fate by a CLE peptide/receptor system. Proceedings of the
National Academy of Sciences 105(39):15208-15213
Imin N, Nizamidin M, Wu T & Rolfe BG (2007) Factors involved in root formation in
Medicago truncatula. Journal of Experimental Botany 58(3):439-451
Jackson S & Chen ZJ (2010) Genomic and expression plasticity of polyploidy. Current
opinion in plant biology 13(2):153-159
Kulinska-Lukaszek K, Tobojka M, Adamiok A & Kurczynska E (2012) Expression of the
BBM gene during somatic embryogenesis of Arabidopsis thaliana. Biologia
plantarum 56(2):389-394
![Page 62: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/62.jpg)
62
Lashermes P, Combes M-C, Robert J, Trouslot P, D'hont A, Anthony F & Charrier A
(1999) Molecular characterisation and origin of the Coffea arabica L. genome.
Molecular and General Genetics MGG 261(2):259-266
Li B, Kadura I, Fu D-J & Watson DE (2004) Genotyping with TaqMAMA. Genomics
83(2):311-320
Li K-p, Sun X-m, Han H & Zhang S-g (2014) Isolation, characterization and expression
analysis of the BABY BOOM (BBM) gene from Larix kaempferi× L. olgensis
during adventitious rooting. Gene 551(2):111-118
Liu Z & Adams KL (2007) Expression partitioning between genes duplicated by
polyploidy under abiotic stress and during organ development. Current Biology
17(19):1669-1674
Lotan T, Ohto M-a, Yee KM, West MA, Lo R, Kwong RW, Yamagishi K, Fischer RL,
Goldberg RB & Harada JJ (1998) Arabidopsis LEAFY COTYLEDON1 is sufficient
to induce embryo development in vegetative cells. Cell 93(7):1195-1205
Mochida K, Yamazaki Y & Ogihara Y (2004) Discrimination of homoeologous gene
expression in hexaploid wheat by SNP analysis of contigs grouped from a large
number of expressed sequence tags. Molecular Genetics and Genomics
270(5):371-377
Mondego JM, Vidal RO, Carazzolle MF, Tokuda EK, Parizzi LP, Costa GG, Pereira LF,
Andrade AC, Colombo CA & Vieira LG (2011) An EST-based analysis identifies
new genes and reveals distinctive gene expression features of Coffea arabica and
Coffea canephora. BMC plant biology 11(1):30
Murashige T & Skoog F (1962) A Revised Medium for Rapid Growth and Bio Assays with
Tobacco Tissue Cultures. Physiologia Plantarum 15(3):473-497
doi:10.1111/j.1399-3054.1962.tb08052.x
Nic-Can GI, López-Torres A, Barredo-Pool F, Wrobel K, Loyola-Vargas VM, Rojas-
Herrera R & De-la-Peña C (2013) New insights into somatic embryogenesis:
LEAFY COTYLEDON1, BABY BOOM1 and WUSCHEL-RELATED HOMEOBOX4
are epigenetically regulated in Coffea canephora. PloS one 8(8):e72160
Passarinho P, Ketelaar T, Xing M, van Arkel J, Maliepaard C, Hendriks MW, Joosen R,
Lammers M, Herdies L & den Boer B (2008) BABY BOOM target genes provide
diverse entry points into cell proliferation and cell growth pathways. Plant
molecular biology 68(3):225-237
Raghavan V (2000) Developmental Biology of Flowering Plants. SpringerVerlagNew
York. Inc
![Page 63: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/63.jpg)
63
Ramos L, Yokoo E & Gonçalves W Direct somatic embryogenesis is genotype specific in
coffee. In: COLLOQUE Scientifique International sur le Café, 15. Montpellier
(Francia), Juin 6-11, 1993.. 1993.
Ribas AF, Cenci A, Combes M-C, Etienne H & Lashermes P (2011) Organization and
molecular evolution of a disease-resistance gene cluster in coffee trees. BMC
genomics 12(1):240
Schellenbaum P, Jacques A, Maillot P, Bertsch C, Mazet F, Farine S & Walter B (2008)
Characterization of VvSERK1, VvSERK2, VvSERK3 and VvL1L genes and their
expression during somatic embryogenesis of grapevine (Vitis vinifera L.). Plant
Cell Reports 27(12):1799-1809
Shi X, Ng DW, Zhang C, Comai L, Ye W & Chen ZJ (2012) Cis-and trans-regulatory
divergence between progenitor species determines gene-expression novelty in
Arabidopsis allopolyploids. Nature communications 3:950
Silva AT, Barduche D, do Livramento KG & Paiva LV (2015) A putative BABY BOOM-like
gene (CaBBM) is expressed in embryogenic calli and embryogenic cell
suspension culture of Coffea arabica L. In vitro Cellular & Developmental Biology-
Plant 51(1):93-101
van Boxtel J & Berthouly M (1996) High frequency somatic embryogenesis from coffee
leaves. Plant cell, tissue and organ culture 44(1):7-17
van der Graaff E, Laux T & Rensing SA (2009) The WUS homeobox-containing (WOX)
protein family. Genome Biol 10(12):248
Vasconcellos RCdC, Almeida JASd & Silvarolla MB (2009) Indução de embriões
somáticos em explantes foliares de genótipos de Coffea arabica em presença da
citocinina 2-iP.
Vieira LGE, Andrade AC, Colombo CA, Moraes AHdA, Metha Â, Oliveira ACd, Labate
CA, Marino CL, Monteiro-Vitorello CdB & Monte DdC (2006) Brazilian coffee
genome project: an EST-based genomic resource. Brazilian Journal of Plant
Physiology 18(1):95-108
Williams E & Maheswaran G (1986) Somatic embryogenesis: factors influencing
coordinated behaviour of cells as an embryogenic group. Annals of Botany
57(4):443-462
Wittkopp PJ, Haerum BK & Clark AG (2004) Evolutionary changes in cis and trans gene
regulation. Nature 430(6995):85-88
![Page 64: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/64.jpg)
64
Wu X, Chory J & Weigel D (2007) Combinations of WOX activities regulate tissue
proliferation during Arabidopsis embryonic development. Developmental biology
309(2):306-316
Yuyama PM, Júnior OR, Ivamoto ST, Domingues DS, Carazzolle MF, Pereira GAG,
Charmetant P, Leroy T & Pereira LFP (2016) Transcriptome analysis in Coffea
eugenioides, an Arabica coffee ancestor, reveals differentially expressed genes in
leaves and fruits. Molecular Genetics and Genomics 291(1):323-336
Zhang S, Wong L, Meng L & Lemaux PG (2002) Similarity of expression patterns of
knotted1 and ZmLEC1 during somatic and zygotic embryogenesis in maize (Zea
mays L.). Planta 215(2):191-194
![Page 65: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/65.jpg)
65
6. Material Suplementar:
Figura suplementar 1. Alinhamento das sequências transcritas traduzidas do gene
BBM2 em Coffea arabica (CA_Contig16339), Coffea canephora (CC_Contig4935) e da
sequência genômica do gene em C. canephora (G_Cc09_g04020). Em cinza estão os
polimorfismos encontrados e sublinhadas estão as regiões onde foram desenhados os
iniciadores, para diferenciação dos homeólogos.
CA_Contig16339 AACCAAGAACCAAAACTAGAAAACTTCCTAGGAGTTGGTGGACAAAACTCCTTGCACCTT 420
G_Cc09_g04020 AACCAAGAACCAAAACTAGAAAACTTCCTTGGAGTTGGTGGACAAAACTCCTTGCACCTT 420
CC_Contig4935 ----------------------------------------GACAAAACTCCTTGCACCTT 20
********************
CA_Contig16339 CCTTCACAAACTGTTGAGGCTTCTTCTTCCAATGGTAATGGTACCATAGGTCTCTCAATG 480
G_Cc09_g04020 CCTTCACAAACTGTTGAGGCTTCTTCTTCCAATGGTAATGGTACCATAGGTCTCTCAATG 480
CC_Contig4935 CCTTCACAAACTGTTGAGGCTTCTTCTTCCAATGGTAATGGTACCATAGGTCTCTCAATG 80
************************************************************
CA_Contig16339 ATCAAGAACTGGTTGAGGAATAATCCCAGTACATCCCAGCCTGAGAACAAGATCATCAAT 540
G_Cc09_g04020 ATCAAGAACTGGTTGAGGAATAATCCCAGTACATCCCAACCCGAGAACAAGATCATCAAT 540
CC_Contig4935 ATCAAGAACTGGTTGAGGAATAATCCCAGTACATCCCAACCCGAGAACAAGATCATCAAT 140
************************************** ** ******************
CA_Contig16339 GGAAATGATGGGGTTGTGGTGTGCTCTAATAATGCTCAAAACTTGTCACTTTCTATG-AG 599
G_Cc09_g04020 GGAAATGATGGGGCTGTGGGTTGCTCTAATAATGCTCAAAACTTGTCACTTTCTATG-AG 599
CC_Contig4935 GGAAATGATGGGGCTGTGGGTTGCTCTAATAATGCTCAAAACTTGTCACTTTCTATGAAG 200
************* ***** ************************************ **
CA_Contig16339 TATGGGGTCACAATCAACATCTGCTTTGCCCCTCTTGACTGCAGCAAGTTGCTCAGATGG 659
G_Cc09_g04020 TACGGGGTCACAATCAACATCTGCTTTGCCCCTCTTGACTGCAGCAAGTTGCTCAGATGG 659
CC_Contig4935 TACGGGGTCACAATCAACATCTGCTTTGCCCCTCTTGACTGCAGCAAGTTGCTCAGATGG 260
** *********************************************************
CA_Contig16339 TGAAGGAGGTGGTGGGGAGAGTTCCACTTCTGATAATACCAATACTAATAAGCAGCAAAA 719
G_Cc09_g04020 TGAAGGAGGCGGTGGGGAGAGTTCCACTTCTGATAATACTAATACTAATAAGCAGCAAAA 719
CC_Contig4935 TGAAGGAGGCGGTGGGGAGAGTTCCACTTCTGATAATACTAATACTAATAAGCAGCAAAA 320
********* ***************************** ********************
CA_Contig16339 CGGTGGGATTGGGATAACTAGTCTTGATAGCCAAAGCGGTGCAATTGAAGCGGTGCCTCG 779
G_Cc09_g04020 CGGTGGGATTGGGATAACTAGTCTTGACGGCCAAAGCGGTGCAATTGAAGCGGTGCCTCG 779
CC_Contig4935 CGGTGGGATTGGGATAACTAGTCTTGACGGCCAAAGCGGTGCAATTGAAGCGGTGCCTCG 380
*************************** *******************************
CA_Contig16339 AAAGTCTATCGATACTTTTGGCCAAAGGACTTCTATCTACCGTGGTGTAACAAGGCATAG 839
G_Cc09_g04020 AAAGTCTATCGATACTTTTGGCCAAAGGACTTCTATCTACCGTGGTGTAACAAGGCATAG 839
CC_Contig4935 AAAGTCTATCGATACTTTTGGCCAAAGGACTTCTATCTACCGTGGTGTAACAAGGCATAG 440
************************************************************
CA_Contig16339 ATGGACTGGAAGATACGAGGCACATCTTTGGGATAATAGTTGTAGAAGAGAGGGACAAAC 899
G_Cc09_g04020 ATGGACTGGAAGATATGAGGCACATCTTTGGGATAATAGTTGTAGAAGAGAGGGACAAAC 899
CC_Contig4935 ATGGACTGGAAGATATGAGGCACATCTTTGGGATAATAGTTGTAGAAGAGAGGGACAAAC 500
*************** ********************************************
CA_Contig16339 TCGGAAGGGAAGGCAAG------------------------------------------- 916
G_Cc09_g04020 TCGGAAGGGAAGGCAAGGTATGGTGATATATTGTCTGCCATTATTAGTTACTATTTCATT 959
CC_Contig4935 TCGGAAGGGAAGGCAAGGTATGGTGATATATTGTCTGCCATTATTAGTTACTATTTCATT 560
*****************
![Page 66: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/66.jpg)
66
Figura suplementar 2. Alinhamento das sequências transcritas traduzidas do gene
LEC1 em Coffea arabica (CA_Contig5185), Coffea canephora (CC_Contig5590) e da
sequência genômica do gene em C. canephora (G_Cc09_g00330). Nas regiões
sublinhadas foram desenhados os iniciadores específicos.
CC_Contig5590 ATGCCAATTGCTAACGTGATCAGAATCATGCGAAAGATCCTTCCCCCACATGCTAAGATC 60
G_Cc09_g00330 ATGCCAATTGCTAACGTGATCAGAATCATGCGAAAGATCCTTCCCCCACATGCTAAGATC 60
CA_Contig5185 ------------------------------------------------------------
CC_Contig5590 TCCGATGATGCCAAGGAAACTATCCAGGAATGCGTATCGGAGTACATTAGCTTCATCACC 120
G_Cc09_g00330 TCCGATGATGCCAAGGAAACTATCCAGGAATGCGTATCGGAGTACATTAGCTTCATCACC 120
CA_Contig5185 ------------------------------------------------------------
CC_Contig5590 GGAGAAGCCAATGAGCGTTGCCAGCGCGAGCAGCGAAAGACTATCACTGCTGAGGACGTG 180
G_Cc09_g00330 GGAGAAGCCAATGAGCGTTGCCAGCGCGAGCAGCGAAAGACTATCACTGCTGAGGACGTG 180
CA_Contig5185 ------------------------------------------------------------
CC_Contig5590 CTTTGGGCCATGAGTAAGCTTGGCTTCGATGACTACATTGAGCCTCTAACCCTATATCTC 240
G_Cc09_g00330 CTTTGGGCCATGAGTAAGCTTGGCTTCGATGACTACATTGAGCCTCTAACCCTATATCTC 240
CA_Contig5185 -------------GTAAGCTTGGCTTCGATGACTACATTGAGCCTCTAACCCTATATCTC 47
***********************************************
CC_Contig5590 CACCGCTTTCGCGAGTTCGACGGCGGTGAGCGTGGTGGCTCTCTAAGGGCCGCTCATCAT 300
G_Cc09_g00330 CACCGCTTTCGCGAGTTCGACGGCGGTGAGCGTGGTGGCTCTCTAAGGGCCGCTCATCAT 300
CA_Contig5185 CACCGCTTTCGCGAGTTCGACGGCGGTGAGCGTGGTGGCTCTCTAAGGGCCGCTCATCAT 107
************************************************************
CC_Contig5590 GATCTTGCAGTGGGGAAGAGGGCAAATATTGATCATCTAGCTGCAGCTGCTGGCT----- 355
G_Cc09_g00330 GATCTTGCAGTGGGGAAGAGGGCAAATATTGATCATCTAGCTGCAGCTGCTGGCTTAGGA 360
CA_Contig5185 GATCTTGCAGTGGGGAAGAGGGCAAATATTGATCATCTAGCTGCAGCTGCTGGCTTAGGA 167
*******************************************************
CC_Contig5590 ------------------------------------------------------------
G_Cc09_g00330 TTAGGAGGCGGAGGCTTTGCAACCTATCCCCCACCTCATTTTCACTTGCCTCATCACCCT 420
CA_Contig5185 TTAGGAGGCGGAGGCTTTGCAACCTATCCCCCACCTCATTTTCACTTGCCTCATCACCCT 227
CC_Contig5590 ------------------------------------------------------------
G_Cc09_g00330 CCTTTCGTCGCTGCTGGCTTCTTCACCACCGCTGCTGTTCCAATTCACATGAACGGGTTT 480
CA_Contig5185 CCTTTCGTCGCTGCTGGCTTCTTCACCACCGCTGCTGTTCCAATTCACATGAACGGGTTT 287
CC_Contig5590 ------------------------------------------------------------
G_Cc09_g00330 CTCAAAGATCCATCCTCAACTGGAGGGGGCCAAGCAACTTCTTCCCAGGCTGCTGCTGTG 540
CA_Contig5185 CTCAAAGATCCATCCTCAACTGGAGGGGGCCAAGCAACTTCTTCCCAGGCTGCTGCTGTG 347
CC_Contig5590 ------------------------------------------------------
G_Cc09_g00330 GCGGCTAGTGATGGTGGTCATCAAGAACAAGCATTTGACAACTGCGAGGAGTAA 594
CA_Contig5185 GCGGCTAGTGATGGTGGTCATCAAGAACAAGCATTTGACAACTGCGAGGAGTAA 401
![Page 67: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/67.jpg)
67
Figura suplementar 3. Alinhamento das sequências transcritas traduzidas do gene
WOX4 em Coffea arabica (CA_CA00-XX-AR1), Coffea canephora (CC_CC00-XX-LF1) e
da sequência genômica do gene em C. canephora (G_Cc10_g04700). Em cinza estão
os polimorfismos encontrados e sublinhadas estão as regiões onde foram desenhados
os iniciadores, para diferenciação dos homeólogos.
CA_CA00-XX-AR1 ATGGGAAGCATGAAGGTGCATCAGTTTGCACGTGGATTTTGGGAGCATGAACCATCCCTC 60
G_Cc10_g04700 ATGGGAAGCATGAAGGTGCATCAGTTTGCACGTGGATTTTGGGAGCATGAACCATCCCTC 60
CC_CC00-XX-LF1 ------------------------------------------------------------
CA_CA00-XX-AR1 ACGCTTGGCTGCAAGCGTTTACGCCCTCTTGCGCCCAAGCTCTCCAACACCGACAGTACT 120
G_Cc10_g04700 ACGCTTGGCTGCAAGCGTTTACGCCCTCTTGCGCCCAAACTCTCCAACACCGACAATACT 120
CC_CC00-XX-LF1 ------------------------------------------------------------
CA_CA00-XX-AR1 CCCACCACCGTCCCCCCTTTCGATCTCAAGAGCTTCATCAGACCTGAAAGCGGCCCCAGA 180
G_Cc10_g04700 CCCACCACCGTCCCCCCTTTCGATCTCAAGAGCTTCATCAGACCTGAAAGCGGCCCCAGA 180
CC_CC00-XX-LF1 ------------------------------------------------------------
CA_CA00-XX-AR1 AAGCTTGGATCCTCAGACGACAAGAGAGAAACTGCCCATGTGGATACACACCCGGGAGGG 240
G_Cc10_g04700 AAGCTCGGATCCTCAGACGACAAGAGAGAAACTGCCCATGTGGATACACACCCGGGAGGG 240
CC_CC00-XX-LF1 ---------------------------------------GTGGATACACACCCGGGAGGG 21
*********************
CA_CA00-XX-AR1 ACGAGGTGGAATCCAACCCAAGAGCAAATAGGTATACTAGAAATGCCGTACAGAGGGGGC 300
G_Cc10_g04700 ACGAGGTGGAATCCAACCCAAGAGCAAATAGGTATACTAGAAATGCTGTACAGAGGGGGC 300
CC_CC00-XX-LF1 ACGAGGTGGAATCCAACCCAAGAGCAAATAGGTATACTAGAAATGCTGTACAGAGGGGGC 81
********************************************** *************
CA_CA00-XX-AR1 ATGAGGACTCCAAATGCTCAACAAATTGAACAAATCACGGCACAGCTGGGAAAGTATGGA 360
G_Cc10_g04700 ATGAGGACTCCAAATGCTCAACAAATTGAACAAATCACGGCACAGCTGGGAAAGTATGGA 360
CC_CC00-XX-LF1 ATGAGGACTCCAAATGCTCAACAAATTGAACAAATCACGGCACAGCTGGGAAAGTATGGA 141
************************************************************
CA_CA00-XX-AR1 AAGATAGAGGGGAAAAATGTGTTTTACTGGTTCCAAAACCACAAAGCACGCGAGAGACAG 420
G_Cc10_g04700 AAGATAGAGGGGAAAAATGTGTTTTACTGGTTCCAAAACCACAAAGCACGCGAGAGGCAG 420
CC_CC00-XX-LF1 AAGATAGAGGGGAAAAATGTGTTTTACTGGTTCCAAAACCACAAAGCACGCGAGAGGCAG 201
******************************************************** ***
CA_CA00-XX-AR1 AAGCAAAAGCGCAATAATCTCGGCCTTAACCATAGTCCAAGAGCTCCTGGTGTCACCACC 480
G_Cc10_g04700 AAGCAAAAGCGCAATAATCTCGGCCTTAACCATAGTCCAAGAGCTCCTGGTGTCACCACC 480
CC_CC00-XX-LF1 AAGCAAAAGCGCAATAATCTCGGCCTTAACCATAGTCCAAGAGCTCCTGGTGTCACCACC 261
************************************************************
CA_CA00-XX-AR1 ACCACTACCATTAGTAGTTCTTTAACACACGAGTCAAGGGGAGACTTTGGGAGAGAGGAA 540
G_Cc10_g04700 ACCACTACCATTAGTAGTTCTTTAACACATGAGTCAAGGGGAGACTTTGGGAGAGAAGAA 540
CC_CC00-XX-LF1 ACCACTACCATTAGTAGTTCTTTAACACAT------------------------------ 291
*****************************
CA_CA00-XX-AR1 GATAGTCCTTA------------------------------------------------- 551
G_Cc10_g04700 GATAGTCCTTACAAGAGAAAGTGCAGGTCATGGACTTTTGAATGCTTGGAAGAGGACAAG 600
CC_CC00-XX-LF1 ------------------------------------------------------------
CA_CA00-XX-AR1 ------------------------------------------------------------
G_Cc10_g04700 AGATATTGTAGAAATGAGGGAGATAGGACCCTAGAACTCTTCCCATTGCACCCAGAGAAC 660
CC_CC00-XX-LF1 ------------------------------------------------------------
CA_CA00-XX-AR1 ------
G_Cc10_g04700 AGATGA 666
CC_CC00-XX-LF1 ------
![Page 68: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/68.jpg)
68
Conclusão geral:
A caracterização da embriogênese somática e ontogênese dos embriões
demonstrou que a utilização de explantes de plantas mantidas in vitro, via ESI, foi mais
promissora, desenvolvendo embriões em estágio cotiledonar em menor tempo, quando
comparado com todas as outras condições avaliadas. A diminuição do tempo de cultura
in vitro é essencial para garantir uma maior qualidade dos embriões, diminuindo a
variação somaclonal. Ainda, na ESI, calos vindos de explantes de plantas in vitro, são
muito semelhantes à massa pro-embriogênica, apresentando camadas de células com
características meristemáticas. Durante a ESD, os embriões não se desenvolveram
diretamente das células do explantes, como descrito na literatura, mas sim a partir da
massa pro-embriogênico. Esta parece ser essencial para a formação dos embriões, que
se desenvolvem exclusivamente a partir dela.
Os resultados de expressão gênica para os genes Baby Boom (BBM), Leafy
cotyledon 1 (LEC1) Wuschel-Related Homeobox 4 (WOX4), demonstram que estes
genes são mais expressos no início da formação dos embriões, o que sugere que eles
podem desempenhar um papel de marcador molecular, indicando o início da formação
do embrião e início do desenvolvimento da massa ou do calo, sendo uma importante
ferramenta de apoio aos programas de melhoramento.
Este estudo apresenta dados consistentes sobre a ontogênese de embriões
somáticos, regenerados pela via indireta e direta, a partir de explantes foliares de Coffea
arabica cultivar Mundo Novo, além de abordar mecanismos subjacentes da
embriogênese, como a regulação gênica que podem afetar a capacidade embriogênica
da célula.
![Page 69: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/69.jpg)
69
Referências:
Ahmed W, Feyissa T & Disasa T (2013) Somatic embryogenesis of a coffee (Coffea
arabica L.) hybrid using leaf explants. Journal of Horticultural Science and
Biotechnology(88):469-475
Alemanno L, Ramos T, Gargadenec A, Andary C & Ferriere N (2003) Localization and
identification of phenolic compounds in Theobroma cacao L. somatic
embryogenesis. Annals of Botany 92(4):613-623
Almeida J, Leal R, Carmazini V, Salomon M & Guerreiro Filho O (2014) Effect of
temperature and cytokinin on the capacity of direct somatic embryogenesis in
Coffea arabica L. genotypes. Coffee Science 9(3):394-399
Bandeira FS (2008) Cultivo in vitro e embriogênese somática de embriões zigóticos de
macaúba (Acrocomia aculeata (Jacq.) Loddiges). Viçosas
Benson EE (2000) Sepecial symposium: In vitro plant recalcitrance in vitro plant
recalcitrance: An introduction. In vitro Cellular & Developmental Biology-Plant
36(3):141-148
Berthouly M & Michaux-Ferriere N (1996) High frequency somatic embryogenesis in
Coffea canephora. Plant cell, tissue and organ culture 44(2):169-176
Boutilier K, Offringa R, Sharma VK, Kieft H, Ouellet T, Zhang L, Hattori J, Liu C-M, van
Lammeren AA & Miki BL (2002a) Ectopic expression of BABY BOOM triggers a
conversion from vegetative to embryonic growth. The Plant Cell 14(8):1737-1749
Braybrook SA & Harada JJ (2008) LECs go crazy in embryo development. Trends in
plant science 13(12):624-630
Carvalho CHS (2008) Cultivares de café: origem, características e recomendações.
Embrapa Café - Brasília
Chugh A & Khurana P (2002) Gene expression during somatic embryogenesis-recent
advances. Current Science 83(6):715-730
Conab (2016) Acompamento da safra brasileira : café. Companhia Nacional de
Abastecimento. V1:108
Davis AP, Govaerts R, Bridson DM & Stoffelen P (2006) An annotated taxonomic
conspectus of the genus Coffea (Rubiaceae). Botanical Journal of the Linnean
Society 152(4):465-512
Deng W, Luo K, Li Z & Yang Y (2009) A novel method for induction of plant regeneration
via somatic embryogenesis. Plant science 177(1):43-48
![Page 70: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/70.jpg)
70
El Ouakfaoui S, Schnell J, Abdeen A, Colville A, Labbé H, Han S, Baum B, Laberge S &
Miki B (2010) Control of somatic embryogenesis and embryo development by
AP2 transcription factors. Plant molecular biology 74(4-5):313-326
Florez SL, Erwin RL, Maximova SN, Guiltinan MJ & Curtis WR (2015) Enhanced somatic
embryogenesis in Theobroma cacao using the homologous BABY BOOM
transcription factor. BMC plant biology 15(1):1
Gaj MD (2004) Factors influencing somatic embryogenesis induction and plant
regeneration with particular reference to Arabidopsis thaliana (L.) Heynh. Plant
Growth Regulation 43(1):27-47
Gaj MD, Zhang S, Harada JJ & Lemaux PG (2005) Leafy cotyledon genes are essential
for induction of somatic embryogenesis of Arabidopsis. Planta 222(6):977-988
Gambino G, Minuto M, BocCaCci P, Perrone I, Vallania R & Gribaudo I (2010)
Characterization of expression dynamics of WOX homeodomain transcription
factors during somatic embryogenesis in Vitis vinifera. Journal of Experimental
Botany:erq349
Gaspari-Pezzopane C, Maluf MP, Favarin JL & Guerreiro O Caracterização de genes
expressos durante o crescimento e maturação de frutos de café. In: Embrapa
Café-Artigo em anais de congresso (ALICE), 2011. In: SIMPÓSIO DE PESQUISA
DOS CAFÉS DO BRASIL, 5., 2007, Águas de Lindóia. Anais. Brasília, DF:
Embrapa Café, 2007.,
Gatica AM, Arrieta G & Espinoza AM (2013) Direct somatic embryogenesis in Coffea
arabica L. cvs. Caturra and Catuaí: effect of tricontanol, light condition, and
medium consistency.
Gehring W, Müller M, Affolter M, Percival-Smith A, Billeter M, Qian Y, Otting G &
Wüthrich K (1990) The structure of the homeodomain and its functional
implications. Trends in Genetics 6:323-329
Guo F, Liu C, Xia H, Bi Y, Zhao C, Zhao S, Hou L, Li F & Wang X (2013) Induced
expression of AtLEC1 and AtLEC2 differentially promotes somatic embryogenesis
in transgenic tobacco plants. PloS one 8(8):e71714
Haecker A, Groß-Hardt R, Geiges B, Sarkar A, Breuninger H, Herrmann M & Laux T
(2004) Expression dynamics of WOX genes mark cell fate decisions during early
embryonic patterning in Arabidopsis thaliana. Development 131(3):657-668
Harborne A (1998) Phytochemical methods a guide to modern techniques of plant
analysis. Springer Science & Business Media
![Page 71: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/71.jpg)
71
Hatanaka T, Arakawa O, Yasuda T, Uchida N & Yamaguchi T (1991) Effect of plant
growth regulators on somatic embryogenesis in leaf cultures of Coffea canephora.
Plant Cell Reports 10(4):179-182
Ibrahim MSD, Hartati RS, Rubiyo R, Purwito A & Sudarsono S (2013) Direct and indirect
somatic embryogenesis on Arabica Coffee (Coffea arabica). Indonesian Journal
of Agricultural Science 14(2):79-86
Lotan T, Ohto M-a, Yee KM, West MA, Lo R, Kwong RW, Yamagishi K, Fischer RL,
Goldberg RB & Harada JJ (1998) Arabidopsis LEAFY COTYLEDON1 is sufficient
to induce embryo development in vegetative cells. Cell 93(7):1195-1205
Mishra M & Slater A (2012) Recent advances in the genetic transformation of coffee.
Biotechnology research international 2012
Mordhorst AP, Hartog MV, El Tamer MK, Laux T & de Vries SC (2002) Somatic
embryogenesis from Arabidopsis shoot apical meristem mutants. Planta
214(6):829-836
Nic-Can GI, Galaz-Ávalos RM, De-la-Peña C, Alcazar-Magaña A, Wrobel K & Loyola-
Vargas VM (2015) Somatic embryogenesis: Identified factors that lead to
embryogenic repression. A case of species of the same genus. PloS one
10(6):e0126414
Nic-Can GI, López-Torres A, Barredo-Pool F, Wrobel K, Loyola-Vargas VM, Rojas-
Herrera R & De-la-Peña C (2013) New insights into somatic embryogenesis:
LEAFY COTYLEDON1, BABY BOOM1 and WUSCHEL-RELATED HOMEOBOX4
are epigenetically regulated in Coffea canephora. PloS one 8(8):e72160
Ohme-Takagi M & Shinshi H (1995) Ethylene-inducible DNA binding proteins that
interact with an ethylene-responsive element. The Plant Cell 7(2):173-182
Passarinho P, Ketelaar T, Xing M, van Arkel J, Maliepaard C, Hendriks MW, Joosen R,
Lammers M, Herdies L & Den Boer B (2008) BABY BOOM target genes provide
diverse entry points into cell proliferation and cell growth pathways. Plant
molecular biology 68(3):225-237
Rezende JCd, Carvalho CHSd, Santos ACR, Pasqual M & Teixeira JB (2012)
Multiplication of embryogenic calli in Coffea arabica L. Acta Scientiarum.
Agronomy 34(1):93-98
Rose RJ & Nolan KE (2006) Invited review: genetic regulation of somatic embryogenesis
with particular reference to Arabidopsis thaliana and Medicago truncatula. In vitro
Cellular & Developmental Biology-Plant 42(6):473-481
![Page 72: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/72.jpg)
72
Sakuma Y, Liu Q, Dubouzet JG, Abe H, Shinozaki K & Yamaguchi-Shinozaki K (2002)
DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs,
transcription factors involved in dehydration-and cold-inducible gene expression.
Biochemical and biophysical research communications 290(3):998-1009
Sondahl M, Nakamura T & Sharp W (1985) Propagation of coffee Tissue culture in
Forestry and Agriculture. Springer, p 215-232
Srinivasan C, Liu Z, Heidmann I, Supena EDJ, Fukuoka H, Joosen R, Lambalk J,
Angenent G, Scorza R & Custers JB (2007) Heterologous expression of the
BABY BOOM AP2/ERF transcription factor enhances the regeneration capacity of
tobacco (Nicotiana tabacum L.). Planta 225(2):341-351
van der Graaff E, Laux T & Rensing SA (2009) The WUS homeobox-containing (WOX)
protein family. Genome Biol 10(12):248
Vasconcellos RCdC, Almeida JASd & Silvarolla MB (2009) Indução de embriões
somáticos em explantes foliares de genótipos de Coffea arabica em presença da
citocinina 2-iP.
Wann S (1988) Somatic embryogenesis in woody species. Horticultural Reviews,
Volume 10:153-181
Williams E & Maheswaran G (1986) Somatic embryogenesis: factors influencing
coordinated behaviour of cells as an embryogenic group. Annals of Botany
57(4):443-462
Wu X, Chory J & Weigel D (2007) Combinations of WOX activities regulate tissue
proliferation during Arabidopsis embryonic development. Developmental biology
309(2):306-316
Zhang S, Wong L, Meng L & Lemaux PG (2002) Similarity of expression patterns of
knotted1 and ZmLEC1 during somatic and zygotic embryogenesis in maize (Zea
mays L.). Planta 215(2):191-194
![Page 73: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/73.jpg)
73
![Page 74: UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA · para o estudo molecular e de mecanismos celulares envolvidos nos processo de desenvolvimento in vivo , que vai do zigoto](https://reader034.fdocumentos.tips/reader034/viewer/2022042920/5f658821538c24391b534beb/html5/thumbnails/74.jpg)
74