Quais são os procedimentos básicos para inferir filogenias? 

FASTA DNA (unaligned)

>CowATGGCATATCCCATACAACTAGGATTCCAAGATGCAACATCACCAATCATAGAAGAACTACTTCACTTTCATGACCACACGCTAATAATTGTCTTCTTAATTAGCTCATTAGTACTTTACATTATTTCACTAATACTAACGACAAAGCTGACCCATACAAGCACGATAGATGCACAAGAAGTAGAGACAATCTGAACCATTCTGCCCGCCATCATCTTAATTCTAATTGCTCTTCCTTCTTTACGAATTCTATACATAATAGATGAAATCAATAACCCATCTCTTACAGTAAAAACCATAGGACATCAGTGATACTGAAGCTATGAGTATACAGATTATGAGGACTTAAGCTTCGACTCCTACATAATTCCAACATCAGAATTAAAGCCAGGGGAGCTACGACTATTAGAAGTCGATAATCGAGTTGTACTACCAATAGAAATAACAATCCGAATGTTAGTCTCCTCTGAAGACGTATTACACTCATGAGCTGTGCCCTCTCTAGGACTAAAAACAGACGCAATCCCAGGCCGTCTAAACCAAACAACCCTTATATCGTCCCGTCCAGGCTTATATTACGGTCAATGCTCAGAAATTTGCGGGTCAAACCACAGTTTCATACCCATTGTCCTTGAGTTAGTCCCACTAAAGTACTTTGAAAAATGATCTGCGTCAATATTATAA

NEXUS DNA

#nexus begin data;dimensions ntax=10 nchar=705;format datatype=dna interleave=yes gap=- missing=?;matrixCow ATGGCATATCCCATACAACTAGGATTCCAAGATGCAACATCACCAATCATAGAAGAACTACarp ATGGCACACCCAACGCAACTAGGTTTCAAGGACGCGGCCATACCCGTTATAGAGGAACTTChicken ATGGCCAACCACTCCCAACTAGGCTTTCAAGACGCCTCATCCCCCATCATAGAAGAGCTCHuman ATGGCACATGCAGCGCAAGTAGGTCTACAAGACGCTACTTCCCCTATCATAGAAGAGCTT

PIR DNA

>DL; CowCowATGGCATATCCCATACAACTAGGATTCCAAGATGCAACATCACCAATCATAGAAGAACTACTTCACTTTCATGACCACACGCTAATAATTGTCTTCTTAATTAGCTCATTAGTACTTTACATTATTTCACTAATACTAACGACAAAGCTGACCCATACAAGCACGATAGATGCACAAGAAGTAGAGACAATCTGAACCATTCTGCCCGCCATCATCTTAATTCTAATTGCTCTTCCTTCTTTACGAATTCTATACATAATAGATGAAATCAATAACCCATCTCTTACAGTAAAAACCATAGGACATCAGTGATACTGAAGCTATGAGTATACAGATTATGAGGACTTAAGCTTCGACTCCTACATAATTCCAACATCAGAATTAAAGCCAGGGGAGCTACGACTATTAGAAGTCGATAATCGAGTTGTACTACCAATAGAAATAACAATCCGAATGTTAGTCTCCTCTGAAGACGTATTACACTCATGAGCTGTGCCCTCTCTAGGACTAAAAACAGACGCAATCCCAGGCCGTCTAAACCAAACAACCCTTATATCGTCCCGTCCAGGCTTATATTACGGTCAATGCTCAGAAATTTGCGGGTCAAACCACAGTTTCATACCCATTGTCCTTGAGTTAGTCCCACTAAAGTACTTTGAAAAATGATCTGCGTCAATATTA---------------------TAA*

Classes de Métodos:

Algoritmos Uma seqüência específica de passos que leva a um determinado resultado

2 + 2 = 4

UPGMA

Distância

Take a look at the following 3 sequences of 3 nucleotides

1.AGC2.AAC3.ACC

Sequences 1 and 2 differs at 1 out of 3 positions = 1/3Sequences 1 and 3 differs at 1 out of 3 positions = 1/3Sequences 2 and 3 differs at 1 out of 3 positions = 1/3

and we obtain this matrix:

1. 2. 3.1. - 0.333 0.3332. 0.333 - 0.3333. 0.333 0.333 -

Jukes Cantor

A simple model of sequence evolution is the Jukes-Cantor model (JC). Under this model the distance between two sequences is given by

Where P is the proportion of nucleotides that are different (the observed differences above) in the two sequences and ln is the natural log function. To calculate the JC distances from the observed differences above:

The Jukes-Cantor matrix for the sequences above looks like this:

1. 2. 3.1. - 0.441 0.4412. 0.441 - 0.4413. 0.441 0.441 -

Kimura's Two Parameter model

Kimura's Two Parameter model (K2P) incorporates the observation that the rate of transitions per site (a) may differ from the rate of transversions (b), giving a total rate of substitiutions per site of (a + 2b)(there are three possible substitutions: one transition and two transversions). The transition:transversion ratio a/b is often represented by the letter kappa (k).

In the K2P model the number of nucleotide substitutions per site is given by:

1. 2. 3.1. - 0.549 0.4772. 0.549 - 0.5493. 0.477 0.549 -

Classes de Meetodos:Otimização por critérios, o que prevê uma escolha do pesquisador1- definir uma função2- usar um algoritmo para escolha de um modelo que descreva uma filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores.

Parsimony (MP)

Maximum likelihood (ML)

Minimum evolution (ME)

Termos utilizados para definir árvores

Sobre arvores filogenéticas: o formato da filogenia

Cladograma

FilogramaDendrogram

((A, B), (C, D)), E), or if one wishes to add information on branch lengths ((A:0.1, B:0.2):0.2, (C:0.15, D:0.3):0.4):0.3, E:0.4).

Models of evolution represent rate changes along the arrows changing a nucleotide from one to another. Often these rates are different and there is often a difference between transitions (changes within pyrimidines or purines) and transversions (changes among class).

position1 2 3

Sequence1 T G CSequence2 T A CSequence3 A G GSequence4 A A G

* Position 1: Only one change is introduced if sequences 1 and 2 are grouped, while two changes will be necessary if sequences 1 and 3 or 1 and 4 are grouped.

* Position 2: Only one change is introduced if sequences 1 and 3 are grouped, while two changes will be necessary if sequences 1 and 2 or 1 and 4 are grouped.

* Position 3: Only one change is introduced if sequences 1 and 2 are grouped, while two changes will be necessary if sequences 1 and 3 or 1 and 4 are grouped.Then, from the three possible unrooted trees,try to find the tree that needs the fewest changes to explain the data:

* If 1 and 2 are grouped a total of four changes are needed.* If 1 and 3 are grouped a total of five changes are needed.* If 1 and 4 are grouped a total of six changes are needed.

Hence, the shortest tree is ((1,2)(3,4)).

The use of maximum likelihood (ML) algorithms in developing phylogenetic hypotheses requires a model of evolution