Post on 19-Mar-2020
INSTITUTO NACIONAL DE PESQUISAS DA AMAZÔNIA – INPA PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA, CONSERVAÇÃO E BIOLOGIA
EVOLUTIVA – PPG GCBEv
Influência dos contaminantes ambientais Benzo[a]pireno e Roundup®
sobre Colossoma macropomum submetida à hipóxia e mudanças climáticas: respostas genéticas, fisiológicas e histológicas
GRAZYELLE SEBRENSKI DA SILVA
Manaus
Novembro, 2016
ii
GRAZYELLE SEBRENSKI DA SILVA
Influência dos contaminantes ambientais Benzo[a]pireno e Roundup®
sobre Colossoma macropomum submetida à hipóxia e mudanças climáticas: respostas genéticas, fisiológicas e histológicas Orientadora: VERA MARIA FONSECA DE ALMEIDA E VAL Agência Financiadora: INCT/ADAPTA
Tese apresentada ao Instituto Nacional de Pesquisas da Amazônia como parte dos requisitos para obtenção do título de Doutor em Genética, Conservação e Biologia Evolutiva.
* Pesquisa autorizada: CEUA/INPA, Protocolo Número 011/2013.
Manaus, Amazonas Novembro, 2016
iii
GRAZYELLE SEBRENSKI DA SILVA
Influência dos contaminantes ambientais Benzo[a]pireno e Roundup®
sobre Colossoma macropomum submetida à hipóxia e mudanças climáticas: respostas genéticas, fisiológicas e histológicas
Tese apresentada ao Programa de Pós-
Graduação em Genética, Conservação e
Biologia Evolutiva do Instituto Nacional de
Pesquisas da Amazônia, como requisito para a
obtenção do título de Doutor em Genética,
Conservação e Biologia Evolutiva.
APROVADA EM: 23 / 11 / 2016
BANCA EXAMINADORA
____________________________________________
Profa. Dr. José Fernando Marques Barcellos-UFAM
____________________________________________
Profa. Dra. Fernanda Loureiro de Almeida O’Sullivan-EMBRAPA
____________________________________________
Profa. Dra. Luciana R. Souza-Bastos-UFPR
____________________________________________
Profa. Dra. Eliana Feldberg-INPA
____________________________________________
Profa. Dr. Wuelton Marcelo-FMT
iv
FICHA CATALOGRÁFICA
S586 Silva, Grazyelle Sebrenski da
Influência dos contaminantes ambientais Benzo[a]pireno e Roundup®
sobre Colossoma macropomum submetida à hipóxia e mudanças climáticas:
respostas genéticas, fisiológicas e histológicas /Grazyelle Sebrenski da Silva . -
-- Manaus: [s.n.], 2016.
168 f.: il.
Tese (Doutorado) --- INPA, Manaus, 2016.
Orientador: Vera Maria Fonseca de Almeida e Val
Área de concentração: Genética, Conservação e Biologia evolutiva
1. Tambaqui. 2. Hipóxia. 3. Mudanças climáticas. I. Título
CDD 597.5
SINOPSE
Neste estudo foram avaliados os efeitos dos contaminantes ambientais Benzo[a]pireno e
Roundup® sobre o tambaqui (Colossoma macropomum). Primeiramente, verificou-se os
efeitos agudos do Benzo[a]pireno na expressão do oncogene ras e hif-1 e respostas
histopatológicas do fígado. A seguir, foram avaliados os efeitos do Benzo[a]pireno na
expressão do oncogene ras e do gene hif-1 em tambaquis cronicamente expostos ao
cenário extremo (A2) proposto pelo Painel Intergovernamental Sobre Mudanças Climáticas
(IPCC, 2007). Finalmente, foi avaliado o efeito agudo e conjunto da exposição ao Roundup®
mais hipóxia na expressão dos genes ras e hif-1e os efeitos histopatológicos em tambaqui.
Palavras-chave: tambaqui, Benzo[a]pireno, Roundup®, hipóxia, mudanças climáticas,
oncogene ras, hif-1 e histopatologia.
v
Dedico aos meus pais Moacir Ribeiro
da Silva e Arlete Aparecida Sebrenski
da Silva pelo apoio em todos os
sentidos da minha vida e a lição de
não ter medo de conquistar tudo com
humildade.
vi
AGRADECIMENTOS
A Jeová Deus por permitir que as coisas acontecessem na hora certa, pelo suporte
emocional e alegria de estar viva e com saúde para realizar tantas conquistas mesmo
na adversidade.
Aos meus pais Moacir Ribeiro da Silva e Arlete Aparecida da Silva por todo amor,
carinho e apoio em todos os momentos dessa longa jornada.
A todos os familiares (tios, tias, primos e primas) que vibraram por mais esta conquista,
por estarem ao meu lado incentivando nas horas do cansaço.
À minha querida orientadora Dra. Vera Val por acreditar no meu potencial e sempre ser
tão acessível e pronta para tirar dúvidas e corrigir meus trabalhos quando necessário.
Às minhas estudantes Carolina, Juliana e Julie que foram essenciais na realização dos
experimentos e me apoiaram nos momentos mais sobrecarregados do trabalho,
tornando-os mais leves. Juliana sempre positiva.
À amiga Lorena por ser sempre tão prestativa e disposta a ajudar.
À MSc. Nazaré Paula pelo apoio logístico e por ser sempre tão cuidadosa e prestativa
com os alunos e trabalhos no laboratório.
Ao Prof. Dr. Adalberto Val, pelas discussões sobre o trabalho, pelo suporte financeiro à
pesquisa e por abrir as portas do laboratório para que o trabalho fosse realizado.
À toda a equipe do LEEM: Dona Rai, Raquel, técnicos, Claudinha, Dona Val e Dona
Sônia, por sempre ajudarem quando necessário e contribuírem para o andamento
organizado da rotina no laboratório.
À minha amiga e colega Luciana Fé por sempre me ajudar, ensinar, tirar dúvidas e
estar disposta a contribuir com todo o trabalho realizado.
vii
Aos amigos do laboratório que direta e indiretamente sempre estiveram dispostos a
participar das coletas, tirar dúvidas sobre estatística, discutir resultados e dar aquela
palavra de incentivo: Helen, Viviane, Susana, Derek, Fernanda, Samara, Alzira e Carol.
Aos amigos do Departamento de Morfologia da UFAM, Maria Inês e Fernandinho, por
dividirem as responsabilidades comigo, por abraçarem a causa do Doutorado comigo e
não permitir que eu desanimasse.
Aos amigos Karen e Marcel por estarem sempre dispostos a me ouvir e consolar nas
horas de estresse e angústia.
Aos amigos que direta e indiretamente participaram dessa grande jornada.
Obrigada!
viii
“O saber a gente aprende com os
mestres e com os livros. A sabedoria
se aprende com a vida e com os
humildes.”
Cora Coralina
ix
Resumo
Esse estudo objetivou compreender os efeitos (genéticos, histológicos e fisiológicos) de
diferentes estressores ambientais como: temperatura, níveis de CO2 e O2, bem como a
ação dos contaminantes benzo[a]pireno (BaP) e Roundup® (RD) em Colossoma
macropomum. No primeiro capítulo foi avaliado o efeito agudo (96 h) do BaP (4, 8, 16,
32 mol/kg) em tambaquis. Foram observadas alterações no nível de expressão do
oncogene ras e do fator de indução à hipóxia-1 (hif-1). Os danos teciduais no fígado
aumentaram nos peixes expostos ao BaP (8, 16, 32 mol/kg) quando comparados com
o controle, sendo classificados como danos irreparáveis. Verificou-se também o
aumento no índice de danos genéticos das células sanguíneas por meio do ensaio
cometa. O segundo capítulo descreve os efeitos do BaP (8 e 16mol/kg) em
tambaquis expostos ao cenário climático A2 (cenário extremo) que prevê um aumento
médio de 4.5 °C na temperatura do ar e 850 ppm de CO2, como proposto pelo IPCC
(2007). O aumento da temperatura e dos níveis de CO2 no cenário extremo induziu
modificações nos níveis de expressão do oncogene ras e do gene hif-1. Tanto o
oncogene ras como hif-1. apresentaram aumento nos níveis de expressão nos peixes
injetados com ambas as concentrações de BaP e expostos ao cenário extremo, quando
comparados aos mesmos tratamentos no cenário atual. Por outro lado, as respostas
das enzimas glutationa-S-transferase (GST) e catalase (CAT) e nível de
lipoperoxidação (LPO) foram maiores no cenário controle. A atividade da GST e CAT
diminuiu nos peixes expostos ao BaP no cenário extremo, em relação ao cenário
controle, mostrando que um possível cenário com altas temperaturas e níveis de CO2
enfraqueceriam as respostas antioxidantes do organismo. Da mesma maneira, os
níveis de LPO diminuíram. Em consequência da falha no sistema antioxidante, o
cenário extremo teve maior influência sobre as variáveis genéticas aumentando a
expressão do oncogene ras e hif-1, bem como os danos no DNA a alterações
histológicas, causando danos irreversíveis nas células hepáticas e necrose do tecido.
No terceiro capítulo foram avaliadas as repostas toxicológicas de C. macropomum
expostos simultaneamente ao RD e hipóxia. Surpreendentemente, os animais expostos
à hipóxia e à hipóxia mais RD tiveram seus níveis de expressão de hif-1 menores do
x
que aqueles submetidos à normóxia e normóxia mais RD, sugerindo uma lesão celular
maior nesses grupos. O oncogene ras apresentou expressão relativa maior nos
animais contaminados com RD em normóxia, diminuindo sua expressão relativa nos
animais expostos à hipóxia e RD, o que também pôde ser explicado pelas lesões
celulares (vide abaixo). As enzimas de estresse oxidativo GST e CAT apresentaram
maior atividade em ambos os tratamentos sob hipóxia, sendo capazes de minimizar os
danos de estresse oxidativo nas membranas, o que foi evidenciado pela baixa taxa de
lipoperoxidação (LPO). As alterações histológicas do fígado de C. macropomum
expostos à normóxia mais RD, hipóxia e hipóxia mais RD foram similares, sendo que
os peixes tiveram massiva ocorrência de necrose. O tambaqui se mostrou um
excelente modelo para os estudos de genes relacionados ao câncer, complementado
pelos marcadores moleculares como o oncogene ras e o gene hif-1
Palavras-chave: Benzo[a]pireno, Roundup®, mudanças climáticas, hipóxia, tambaqui,
oncogene ras e gene hif-1
xi
Abstract
This study aimed to understand the effects (genetic, histological and physiological) of
different environmental stressors such as temperature, CO2 levels and O2, as well as
the action of benzo[a]pyrene (BaP) and Roundup® (RD) in Colossoma macropomum. In
the first chapter we evaluated the acute effect (96 h) of BaP (4, 8, 16, 32 mol/kg) in
tambaqui fish. Changes were observed in the expression of the ras oncogene and
hypoxia-inducible factor-1 (hif-1). Tissue damage in the liver increased in fish
exposed to BaP (8, 16, 32 mol / kg) compared with the control, being classified as
irreparable damage. There has also been an increase in genotoxic damage index in
blood cells by the comet assay. The second chapter describes the effects of BaP (8 and
16mol/kg) in tambaquis exposed to climate scenario A2 (extreme scenario) which
provides an average increase of 4.5 °C in air temperature and CO2 levels (850 ppm), as
forecasted by IPCC (2007). The increased temperature and CO2 levels in the extreme
scenario induced changes in expression of the ras oncogene and hif-1 gene. Both ras
oncogene and hif-1 showed an increase in gene expression in fish injected with both
concentrations of BaP and exposed to the extreme scenario compared to the same
treatments in the current scenario. Moreover, the responses of detoxifying enzyme and
antioxidant defense, glutathione-S-transferase (GST), catalase (CAT) and levels of lipid
peroxidation LPO were greater in the control setting. The activity of GST and CAT
decreased in fish exposed to BaP in the extreme scenario compared to the control
scenario. Extreme scenario with high temperatures and CO₂ levels weaken the body's
antioxidant response. Likewise, the LPO levels decreased. In consequence of the
failure in the antioxidant system, the extreme scenario had a greater influence on
genetic variables increasing the expression of ras oncogene and hif-1, also DNA
strand breaks in blood cells and histological damage, causing irreversible injuries to the
liver cells and tissue necrosis. In the third chapter were evaluated toxicological
responses of C. macropomum exposed simultaneously to RD and hypoxia. Surprisingly,
animals exposed to hypoxia and hypoxia more RD had their levels of expression of hif-
xii
1 smaller than those subjected to normoxic and normoxic more RD, suggesting
greater cell damage in these groups. The ras oncogene showed higher relative
expression in animals contaminated with RD in normoxic, reducing their relative
expression in animals exposed to hypoxia and RD, which could also be explained by
cellular injury (see below). The enzymes of oxidative stress GST and CAT showed
greater activity in both treatments under hypoxia, being able to minimize the damage of
oxidative stress in the membranes, which was evidenced by the low lipid peroxidation
rate (LPO). Histological changes C. macropomum liver exposed to normoxia plus RD,
hypoxia and hypoxia plus RD were similar, and the occurrence of fish had massive
necrosis. Tambaqui proved to be an excellent model for studies of genes related to
cancer, complemented by molecular markers such as ras oncogene and the hif-1
gene.
Keywords: Benzo[a]pyrene, Roundup®, climate change, hypoxia, tambaqui, ras
oncogene and hif-1 gene.
xiii
SUMÁRIO
LISTA DE TABELAS ............................................................................................................................... xv
LISTA DE FIGURAS .............................................................................................................................. xvi
1. INTRODUÇÃO GERAL ...................................................................................................................... 1
1.1. Agentes Estressores ............................................................................................................ 3
1.1.1 Hidrocarbonetos Policíclicos Aromáticos: Benzo[a]pireno ................................................ 3
1.1.2 Roundup® ................................................................................................................................ 5
1.2. Indicadores moleculares ...................................................................................................... 6
1.1.2 Fator de Indução de Hipóxia ................................................................................................. 6
1.1.3 Oncogene ras .......................................................................................................................... 8
1.2. A espécie Colossoma macropomum (tambaqui) ............................................................... 9
2. OBJETIVOS ....................................................................................................................................... 10
2.1. Objetivo Geral .................................................................................................................... 10
2.2. Objetivos Específicos (por capítulo) .................................................................................. 10
3. MATERIAL E MÉTODOS ................................................................................................................ 11
3.1 Aquisição dos espécimes de C. macropomum .................................................................. 11
3.2. Delineamento experimental ............................................................................................... 11
3.2.1 Experimento 1: Exposição aguda ao Benzo[a]pireno.................................................... 11
3.2.2 Experimento 2: Cenários Climáticos- Microcosmos ...................................................... 12
3.2.3 Experimento 2: Experimento em Microcosmos ........................................................ 13
3.2.4 Variáveis ambientais dos cenários do Microcosmos ................................................. 15
3.2.5 Experimento 3: Determinação da pressão crítica de oxigênio (PO2crit) ................. 19
3.2.6 Experimento 3: Exposição aguda ao Roundup® e hipóxia .................................... 20
3.3. Procedimentos Analíticos .................................................................................................. 21
3.3.1 Análises hematológicas e plasmáticas .............................................................................. 21
3.3.2 Ensaio Cometa ..................................................................................................................... 22
3.3.3 Análises histopatológicas .................................................................................................... 23
3.3.4 Análises genéticas ............................................................................................................... 25
3.3.5 Análises bioquímicas ........................................................................................................... 30
3.4 Análise estatística ............................................................................................................... 31
xiv
4. Bibliografia ........................................................................................................................................ 33
Capítulo I
Ras oncogene and Hypoxia-inducible factor-1 alpha (hif-1α) expression in Amazon fish
Colossoma macropomum Cuvier, 1818) exposed to benzo[a]pyrene. .................................... 41
Capítulo II
Toxicological responses of Amazon fish Colossoma macropomum contaminated with
Benzo[a]pyrene are magnified by climate change scenario. ................................................... 71
Capítulo III
Hypoxia magnifies the effects of Roundup® over tambaqui genotoxicity, physiology and gene
expression levels. .................................................................................................................... 124
5. Conclusões Gerais..............................................................................................................167
xv
LISTA DE TABELAS
Tabela 1.........................................................................................................................16
Tabela 2.........................................................................................................................29
Capitulo I
Table 1....................................................................................................................65
Capitulo II
Table 1.................................................................................................................112
Table 2............................................................................................................. ....113
Table 3.................................................................................................................114
Table 4..................................................................................................... ............115
Capitulo III
Table 1.................................................................................................................159
Table 2.................................................................................................................160
Table 3.................................................................................................................161
Table 4.................................................................................................................162
xvi
LISTA DE FIGURAS
Figura 1...........................................................................................................................17
Figura 2...........................................................................................................................18
Capitulo I
Figure 1.......................................................................................................................66
Figure 2..................................................................................................................... ..67
Figure 3..................................................................................................................... ..68
Figure 4................................................................................................................ .......69
Figure 5..................................................................................................................... ..70
Capitulo II
Figure 1.......................................................................................... ...........................116
Figure 2.....................................................................................................................117
Figure 3.....................................................................................................................118
Figure 4.....................................................................................................................119
Figure 5.....................................................................................................................120
Figure 6................................................................................................................. ....121
Figure 7.....................................................................................................................122
Figure 8.....................................................................................................................123
Capitulo III
Figure 1................................................................................................................ ......163
Figure 2..................................................................................................................... .164
Figure 3........................................................................................................ ..............165
Figure 4..................................................................................................................... ..166
Figure 5.......................................................................................................................166
1
1. INTRODUÇÃO GERAL
Nos últimos anos as alterações climáticas tornaram-se motivo de debates
científicos e geraram considerável interesse público (Karol et al., 2011). Vários estudos
interdisciplinares estão sendo realizados para determinar como a vida humana será
influenciada pelas mudanças climáticas futuras (Pryor e Barthelmie, 2010). O impacto
no clima mundial de emissões antropogênicas a longo prazo de gases de efeito estufa
está agora bem estabelecido no meio científico de acordo com o relatório do Painel
Intergovernamental sobre Mudanças Climáticas (IPCC).
O Painel Intergovernamental sobre Mudancas Climáticas (IPCC) é uma
organização científica intergovernamental das Nações Unidas. Ele foi criado em 1988
pela Organização Mundial de Meterologia (OMM) e pelo Programa das Nações Unidas
para o Meio Ambiente (UNEP). O IPCC produz relatórios que apóiam a Covenção-
Quadro das Nações Unidas sobre Mudanças Climáticas (UNFCCC), que é o principal
tratado internacional sobre mudanças climáticas. Os relatórios do IPCC também
contêm um “Sumário para os elaboradores de políticas públicas”, os documentos mais
concisos e mais citados do IPCC (Radovanovic et al., 2014).
As mudanças climáticas referem-se a mudanças no estado do clima que podem
ser identificadas (por exemplo, usando testes estatísticos) por mudanças na média e /
ou na variabilidade de suas propriedades e que persistem por décadas, ou até mesmo
por um período mais longo. Refere-se a qualquer mudança no clima ao longo do
tempo, seja devido à variabilidade natural ou como resultado da atividade humana
(IPCC, 2007).
Os condutores naturais e antropogênicos das mudanças climáticas são os gases
de efeito estufa (CO2, metano (CH4), óxido nitroso (N2O) e halocarbonetos (um grupo
de gases contendo flúor, cloro ou bromo) (IPCC, 2007). De acordo com o IPCC (2007),
a concentração atmosférica mundial de CO2 aumentou durante os últimos 10 anos
(média de 1995-2005: 1,9 ppm por ano). A prospecção para o ano 2100 no cenário
2
extremo (A2) proposto pelo IPCC (2007) inclui um aumento da temperatura do ar de
4,5 ° C e um aumento de 850 ppm de CO2 na atmosfera.
No contexto das mudanças climáticas diversos estudos tem sido desenvolvidos
considerando o impacto de tantas alterações ambientais na biogeografia das espécies
(Tishkov, 2012) e distribuição da vegetação (Gouveia et al., 2011). As alterações
climáticas podem ser uma das principais ameaças enfrentadas pelos ecossistemas
aquáticos e pela biodiversidade de água doce. Melhor compreensão, monitoramento e
previsão de seus efeitos são, portanto, cruciais para pesquisadores e formuladores de
políticas públicas (Comte et al., 2013).
Além das mudanças climáticas, existem outros fatores ambientais que afetam o
comportamento das espécies. Na Amazônia por exemplo, existe uma grande
variedade de habitats aquáticos, condições ambientais extremas tais como ácidez da
água, níveis elevados de sulfeto, hidrogênio e dióxido de carbono dissolvidos,
resultando em decomposição vegetal e condições hipóxicas e anóxicas, alta
temperatura, entre outros (Val et al., 2015).
Durante o período da cheia na Bacia Amazônica, surgem áreas inundadas e
cobertas por macrófitas, denominadas várzeas onde mudanças ambientais drásticas
na disponibilidade de oxigênio são observadas durante um único dia (Val e Almeida
Val, 1995). A variação sazonal na disponibilidade de oxigênio na água das áreas
alagadas pode resultar em períodos de hipoxia profunda (< 2 mgO2/L) (Val, 1995).
Para sobreviver a baixas tensões de oxigênio e alta temperatura, os peixes da
Amazônia desenvolveram diversas estratégias para lidar com esses desafios
ambientais. Fisiologicamente algumas espécies de peixe podem recorrer a um baixo
nível de atividade mantido pelo metabolismo anaeróbico, ou a supressão do
metabolismo, diminuindo a síntese e demanda de ATP (Boutilier, 2001; Lutz e Nilsson,
1997). Outra estratégia é a respiração superficial aquática (ASR), um ajuste
comportamental que permite que os peixes acessar a água oxigenada a partir da
interface água e ar (Hochachka e Somero, 2002).
3
A biota aquática vem sofrendo os efeitos não somente das mudanças climáticas
e oscilações no nível de oxigênio da água, mas também a ação dos contaminantes
ambientais como os derivados do petróleo (Moore et al., 1989) e pesticidas (Cattaneo
et al., 2011).
Reconhecendo a importância da manutenção da qualidade ambiental, bem
como a preservação da biota aquática, é importante verificar os efeitos das mudanças
climáticas e alteração dos níveis de oxigênio na água, combinados com a ação de
contaminantes.
A biota aquática, principalmente os peixes, tem sido usada como modelo nos
estudos de qualidade ambiental. Peixes teleósteos provaram ser bons modelos para
avaliar a toxicidade e os efeitos de contaminantes em animais, já que suas respostas
bioquímicas são semelhantes às dos mamíferos e de outros vertebrados (Sancho et al.,
2000). Adicionalmente, os peixes são os primeiros vertebrados a terem contato com os
poluentes aquáticos que podem vir a causar danos permanentes às características
genéticas.
1.1 . Agentes Estressores
1.1.1 Hidrocarbonetos Policíclicos Aromáticos: Benzo[a]pireno
Os hidrocarbonetos policíclicos aromáticos (HPAs) constituem uma classe de
compostos orgânicos com dois ou mais anéis benzênicos formados por átomos de
carbono e hidrogênio (Arey et al., 2003). HPAs constituídos por até seis anéis
aromáticos são denominados “pequenos” HPAs, e os que contêm mais de seis anéis
são classificados como “grandes” HPAs (IARC, 2010).
A maioria dos HPAs apresentam propriedades mutagênicas e carcinogênicas.
Estes compostos são considerados muito lipossolúveis e podem ser efetivamente
absorvidos pelo trato gastrointestinal em mamíferos. HPAs são rapidamente
distribuídos em uma grande variedade de tecidos, com tendência a serem depositados
no tecido adiposo (Abdel-Shafy e Mansour, 2016).
4
Os HPAs são contaminantes ambientais amplamente distribuídos no ambiente
aquático. Eles afetam a biota aquática por se depositar no sedimento ou através da
ingestão de alimento contaminado. São amplamente presentes em áreas de
urbanização costeira, oriundos da exploração e queima de combustíveis fósseis,
descarte de esgoto doméstico e industrial (Perugini et al., 2007).
Para os organismos aquáticos a toxicidade dos HPAs depende do metabolismo
e foto-oxidação. Eles são geralmente mais tóxicos na presença da luz ultravioleta e
exercem um efeito tóxico agudo nos organismos aquáticos (Abdel-Shafy e Mansour,
2016). Os HPAs são moderadamente persistentes no ambiente, podendo ser
bioacumulados. De fato, a concentração de HPAs encontrada nos peixes é, em geral,
muito maior do que a concentração desses contaminantes no ambiente onde os
animais foram coletados (Tudoran e Putz, 2012, Inomata et al., 2012).
O benzo[a]pireno (BaP) é um hidrocarboneto policíclico aromático amplamente
distribuído no ambiente (Thompson et al., 2010). Ele é composto por cinco anéis
benzênicos e, entre os HPAs, é o mais estudado; é classificado como hepatotóxico,
mutagênico, carcinogênico e imunossupressor pela Agência Internacional de Pesquisa
em Câncer (IARC, 2012). Para exercer seu efeito carcinogênico, o BaP é
metabolicamente ativado via citocromo P450 a BaP diolepóxido (BPDE), podendo
interagir com macromoléculas e formar adutos com o DNA. A formação e a persistência
dos adutos de BPDE-DNA são críticas para os eventos de iniciação tumoral (Háll e
Grover, 1990, Varanasi et al., 1989).
BaP vem sendo utilizado em diversos estudos toxicológicos (Modesto e Naidu
2000, Karami et al., 2012) e os peixes têm sido utilizados como modelos para melhor
compreender os efeitos desse contaminante, principalmente na biota aquática (Oliveira
Ribeiro et al., 2007, Banni et al., 2010, Sadauskas-Henrique et al., 2016).
5
1.1.2 Roundup®
Os herbicidas, assim como os derivados de petróleo, são usados
sistematicamente em ecossistemas terrestres e aquáticos para controlar ervas
daninhas indesejáveis e seu uso tem gerado sérias preocupações sobre os potenciais
efeitos adversos no meio ambiente e à saúde humana (Marchand et al., 2006).
O glifosato N-fosfometilglicina é um herbicida pós-emergente e não seletivo,
amplamente utilizado em vários tipos de culturas. Numerosas formulações comerciais
contendo glifosato como ingrediente ativo tornaram-se populares em todo o mundo
devido a eficácia e baixa toxicidade para os mamíferos (Corbera et al., 2005). A
formulação comercial mais conhecida é o Roundup® (RD), aquela em que o glifosato é
formulado como um sal de isopropilamina (IPA) e um surfactante polioxietileno amina
(POEA), que aumentam sua eficácia como herbicida (Martin e Chu, 2003). O amplo
alcance do herbicida Roundup® o torna uma das formulações comerciais mais
distribuídas e utilizadas na agricultura, jardinagem e controle de ervas daninhas
aquáticas (Giesy et al., 2000).
O uso de glifosato como um herbicida foi proposto pela primeira vez por
cientistas da Empresa Monsanto em 1970. Ele é um herbicida que inibe o crescimento
de plantas através da interferência com a produção de aminoácidos aromáticos
essenciais por meio da inibição da enzima fosfato enolpiruvil succinato sintase. Esta
enzima é responsável pela biossíntese de corismato, um intermediário na biossíntese
dos aminoácidos fenilalanina, tirosina e triptofano (Williams et al., 2000).
Houve um crescente aumento na utilização do glifosato nos últimos anos, o que
aumenta a preocupação com os impactos ambientais que o uso deste herbicida pode
causar (Kolpin et al., 2006). Devido à alta solubilidade do glifosato na água tem
ocorrido um aumento da sua presença no ambiente aquático, aumentando sua
relevância nos estudos de ecotoxicologia aquática (WHO, 1994). O glifosado tem sido
encontrado em muitos rios, tanto em áreas agrícolas como urbanas, representando
sérios riscos para os organismos aquáticos (Çavas e Konen, 2007). Recentemente, a
literatura tem demonstrado os efeitos genotóxicos do Roundup® para os peixes
6
(Cavalcante et al., 2008; Çavas e Konen, 2007; Grisolia, 2002; Guilherme et al., 2010,
Braz-Mota et al., 2015).
O Roundup® é tóxico para os peixes e pode causar mudanças morfofuncionais
nesses animais (Modesto e Martinez, 2010). Braz-Mota et al. (2015) demonstraram os
efeitos agudos do RD em concentrações sub-letais na espécie de peixe amazônico
Colossoma macropomum (tambaqui), onde patologias branquiais e hepáticas foram
identificadas. Jiraungkoorskul et al. (2002) também demonstraram que a exposição ao
RD induz alterações histológicas das brânquias, fígado e rins na tilápia do Nilo
(Oreochromis niloticus).
1.2. Indicadores moleculares
1.1.2 Fator de Indução de Hipóxia
Para todos os tipos de organismos a hipóxia afeta uma complexa rede de
interações celulares e desenvolvimento. Alguns estudos sugerem que a hipóxia é
considerada a maior força fisiológica delineadora da evolução dos animais,
promovendo mudanças na abundância das espécies e alterando a composição das
comunidades (Dauer, 1993; Val e Almeida-Val, 1995; Rytkonen et al., 2007; Weisberg
et al., 2008).
Os fatores de indução de hipóxia (HIFs) são uma grande família de fatores de
transcrição altamente conservados, que agem principalmente como reguladores na
homeostase do oxigênio em respostas adaptativas a hipóxia (Semenza, 1999). Eles
são heterodímeros constituídos por duas subunidades HIF-1 e HIF- 1, este último
também conhecido como receptor nuclear translocador de aril-hidrocarboneto (ARNT),
uma família de fatores de transcrição Per-Arnt-Sim (PAS) com formato hélice-alfa-
hélice (bHLH) (Sogawa e Fujii-Kuriyam, 1997; Wang e Zhang, 1995; Wengert et al.,
1997). Em condição de normóxia, HIF-1 tem uma meia vida muito curta, sendo
rapidamente ubiquitinado e degradado via proteossomal (Wang et al., 1995). Contudo,
7
em hipóxia HIF-1 é acumulado pela célula, liga-se a seu heterodímero HIF-1,
interagindo com os elementos de resposta a hipóxia (HER) na região promotora de
genes alvo no núcleo celular (Wang e Semenza, 1993).
As rotas fisiológicas sensíveis à variação nos níveis de oxigênio envolvem vias
de ativação e inibição de diversos fatores de transcrição. O fator de indução de hipóxia
(HIF-1) é um dos principais fatores de transcrição de resposta a hipóxia (Schofield e
Ratcliffe, 2004; Dunwoodie, 2009). Em hipóxia, HIF-1 é produzido e responsável pela
regulação de diversos outros genes relacionados à angiogênese, eritropoiese,
transporte de glicose e glicólise anaeróbica (Harris, 2002; Treinin et al., 2003; Soñanez-
Organis et al., 2012).
Em humanos, a maioria dos estudos envolvendo HIF-1 está relacionado ao
desenvolvimento tumoral (Passam et al., 2009, Melstrom et al., 2011). HIF-1é
superexpresso em câncer de cólon, pulmões, próstata e mama (Zhong et al., 1999;
Costa et al., 2001). HIF-1 tem maior expressão nas áreas hióxicas dos tumores,
influenciando a expressão de genes que têm relação com o processo de angiogênese
e crescimento tumoral (Maxwell et al., 1997). HIF-1 é o fator chave para o processo de
carcinogênese, desenvolvimento tumoral, invasão e metástase em condição de hipóxia
(Semenza, 2003).
Comparados com os estudos com mamíferos, as pesquisas com HIF em
vertebrados como peixes são muito escassas. A primeira sequência de RNAm de hif-
1 para peixe a ser caracterizada foi a de truta arco íris (Oncorhynchus mykiss)
(Soitamo et al., 2001). Posteriormente hif-1 já foi caracterizado para diversas outras
espécies de peixes como: Fundulus heteroclitus, Gymnocypris przewalskii,
Ctenopharyngodon idella, Danio rerio, Micropogonias undulatus e Dicentrarchus labrax
(Cao et al., 2005; Law et al., 2006; Powell e Hahn, 2002; Rahman e Thomas, 2007;
Rytkönen et al., 2007; Terova et al., 2008). Recentemente Baptista et al. (2016)
descreveram a sequência de RNAm de hif-1 para espécie de peixe da Amazônia,
Oscar (Astronotus ocellatus), a qual é tolerante a ambientes com baixas concentrações
de oxigênio. Em peixes, uma série de ajustes metabólicos é utilizada para sobreviver à
hipóxia. Estas estratégias incluem diminuição das rotas metabólicas, aumento da
8
ventilação, aumento dos níveis de hematócrito e hemoglobina, bem como da
respiração anaeróbia (Dalla Via et al., 1994; Jensen et al., 1993; Virani e Rees, 2000).
Em anos recentes, por causa das atividades humanas e das mudanças no
ambiente natural, à duração, severidade e aumento da hipóxia têm resultado em um
aumento da mortalidade de organismos aquáticos como peixes, camarões e moluscos,
causando grandes perdas para a aquicultura e sistemas ecológicos (Diaz e Rosenberg,
2008). Sendo assim, o estudo dos níveis de expressão do gene hif-1em peixes irá
contribuir para o melhor entendimento do comportamento deste gene, principalmente
diante de um desafio ambiental que é a hipóxia e seu efeito combinado com a ação de
um contaminante. Também faz-se necessário a melhor compreensão das respostas do
gene hif-1em peixes adaptados a regiões com baixos níveis de oxigênio, como é o
caso das áreas de várzea na Amazônia, bem como os efeitos da ação de
contaminates, como pesticidas e derivados do petróleo.
1.1.3 Oncogene ras
Os oncogenes mais frequentes identificados em neoplasmas malignos em
humanos são os genes da família ras (Barbacid, 1987). Convencionalmente, esta
família gênica é composta pelos genes Ha-ras (Harvey sarcoma vírus), K-ras gene,
derivado do sarcoma viral Kirsten e N-ras do neuroblastoma. Suas funções estão
intimamente relacionadas aos locais em que seus produtos se ligam na membrana
interna da célula e suas rotas são GTPase dependente (Reuther e Der, 2000). As
mutações no gene ras que levam ao câncer mantém as proteínas Ras em seu estado
GTP-ligado, tornando-as constitutivamente ativas (Pratilas e Solit, 2010).
Ras genes foram identificados em diversas espécies de peixes (Rotchell et al.,
2001). A primeira sequencia para o oncogene ras a ser caracterizada em peixes foi a
do peixe dourado (Carassius auratus) (Nemoto et al., 1986). Depois, outras espécies
tiveram as sequências para os genes ras caracterizadas: truta arco-íris (Oncorhynchus
mykiss) (Mangold et al., 1991), Rivulus (Rivulus marmoratus) (Lee et al., 1998), e peixe
zebra (Danio rerio) (Cheng et al., 1997). Estudos descreveram maior incidência de
mutações do gene ras em peixes de ambientes poluídos (McMahon et al., 1988).
9
Mutações nos códons 12, 13 e 61 do gene ras foram observadas em embriões de
salmão rosa expostos ao óleo cru da baia de Prudhoe, Alasca (Roy et al., 1999).
Mutações do oncogene ras também já foram descritas para peixes expostos a HPAs
(Fong et al., 1993, Vincent et al., 1998). Estas alterações são observadas tanto em
tumores espontâneos como naqueles quimicamente induzidos, em uma grande
variedade de espécies (Bos, 1989).
1.2 . A espécie Colossoma macropomum (tambaqui)
O tambaqui é uma espécie de peixe pertencente à ordem Characiformes e
família Serrasalmidae (Mirande, 2010). No Norte do Brasil, é um dos peixes de água
doce mais importantes, sendo encontrado principalmente em rios, lagos e várzeas da
Amazônia (Almeida et al., 2006). Esta espécie é normalmente exposta a oscilações da
qualidade da água e disponibilidade de nutrientes (Val e Honczaryk, 1995).
São algumas características do tambaqui: (a) alta longevidade (até 15 anos); (b)
complexo comportamento migratório sazonal para fins reprodutivos e de alimentação;
(c) tolerância relativamente alta à hipóxia (Saint-Paul, 1984). O tambaqui também é
tolerante a mudanças de pH, mostrando ausência de distúrbios iônicos em uma faixa
de pH entre 4 e 8 (Costa, 1995, Val et al., 1998). As características do tambaqui podem
torná-lo um modelo adequado para ser usado como espécie indicadora em programas
de biomonitoramento (Salazar-Lugo et al., 2011). Seu uso como espécie modelo tem
sido demonstrado em diversos estudos descritos na literatura (Marcuschi et al., 2010;
Corrêa et al., 2007; Braz-Mota et al., 2015; Sadauskas-Henrique et al., 2016).
Diante da potencialidade no uso do tambaqui como modelo para estudos de
impacto ambiental na região Amazônica e das lacunas existentes sobre os efeitos dos
contaminantes BaP e Roundup® a seguir apresentamos os objetivos da presente tese
bem como os trabalhos resultantes para atingir os mesmos.
10
2. OBJETIVOS
2.1. Objetivo Geral
Avaliar os efeitos genéticos, histológicos e fisiológicos dos estressores
ambientais benzo[a]pireno e Roundup® em espécimes de Colossoma macropomum.
2.2. Objetivos Específicos (por capítulo)
Capítulo I: Verificar a relação entre a expressão do oncogene ras e do Fator de
indução de hipóxia (hif-1) e a ocorrência de alterações histológicas em C.
macropomum submetidos à ação aguda do benzo[a]pireno.
Capítulo II: Verificar o efeito conjunto da exposição ao benzo[a]pireno no cenário
extremo (A2) proposto pelo Painel Intergovernamental sobre Mudanças Climáticas
(IPCC) para 2100 na expressão dos genes ras e Fator de indução de hipóxia (hif-1),
respostas histológicas e fisiológicas do fígado de Colossoma macropomum.
Capítulo III: Investigar os efeitos agudos do herbicida Roundup® na expressão do
oncogene ras e do Fator de Indução de hipóxia (hif-1), respostas histológicas e
fisiológicas em C. macropomum expostos a normoxia e hipóxia.
11
3. MATERIAL E MÉTODOS
3.1. Aquisição dos espécimes de C. macropomum
Para a realização de todos os experimentos, espécimes de Colossoma
macropomum (tambaqui) foram adquiridos em pisciculturas próximas à cidade de
Manaus. Foi adquirido para a realização dos experimentos um total de três lotes (com
1mil espécimes) de peixes sendo o lote para os experimentos 1 e 3 da fazenda Santo
Antônio (02º44'802''S; 059º28'836''W), e o lote para o experimento 2 da Secretaria de
Estado da Produção Rural (Sepror) (Estação Experimental de Balbina - Balbina,
Presidente Figueiredo, AM*1°55'54.4"S; 59°24'39.1"W). Após a aquisição, os peixes
foram transportados ao Laboratório de Ecofisiologia e Evolução Molecular (LEEM)
situado no Instituto Nacional de Pesquisas da Amazônia, onde passaram por um
período de aclimatação de 30 dias.
Durante o período de aclimatação, os peixes foram mantidos em tanques com
circulação de água e aeração constante e alimentados três vezes ao dia com ração
comercial contendo 36% de proteína bruta. Os parâmetros físico-químicos da água
foram monitorados semanalmente.
Antes do início de cada experimento, a alimentação dos peixes foi suspensa por
um período de 24 h e os animais foram dispostos nos tanques experimentais, de
acordo com as características de cada experimento.
3.2 . Delineamento experimental
3.2.1 Experimento 1: Exposição aguda ao Benzo[a]pireno
Após o período de 30 dias de aclimatação, espécimes de tambaqui foram
colocados em tanques com capacidade para 70 litros de água, circulação fechada e
aeração constante. Quinze peixes (n=15) foram colocados em cada tanque, de acordo
com seus respectivos tratamentos. A escolha dos animais foi aleatória, e os mesmos
12
foram pesados e medidos (24.76 g ± 5.45; 10.50 cm ± 0.64) antes de serem
distribuídos em cada tanque.
O período de aclimatação nos tanques experimentais foi de 7 dias. Durante esse
tempo a qualidade da água dos tanques foi monitorada e as trocas de água eram
realizadas em dias alternados. No período de aclimação os peixes foram alimentados
com ração comercial de 36% de proteína bruta, uma vez ao dia e até a saciedade
aparente.
A alimentação foi suspensa 24 h antes dos animais receberem as injeções
intraperitoneais de BaP. Previamente, os animais foram anestesiados em gelo e em
seguida os espécimes receberam as injeções intraperitoneais de acordo com seus
respectivos tratamentos. Os animais do grupo controle receberam somente injeção de
óleo de milho (0,01 ml/g) de acordo com o peso do animal. Nos demais tratamentos os
animais receberam injeção intraperitoneal de óleo de milho, mais contaminante nas
concentrações de 4mol/kg, 8mol/kg, 16mol/kg e 32mol/kg de BaP.
Decorridas 96 h após as injeções, os animais foram anestesiados em gelo e
amostras de sangue foram coletadas com o auxílio de seringas previamente
heparinizadas para a avaliação das quebras do DNA das células sanguíneas, as quais
foram quantificadas por meio do ensaio cometa. Em seguida, os animais foram
sacrificados por secção da espinha dorsal e amostras de fígado foram coletadas para a
avaliação histológica e quantificação da expressão gênica.
3.2.2 Experimento 2: Cenários Climáticos- Microcosmos
O Quarto Relatório do IPCC (IPCC, 2007) descreve cenários climáticos (A1, A2,
B1 e B2) para o ano de 2100 com variações na umidade do ar, concentração de CO2 e
temperatura. Os cenários delineados pelo relatório do IPCC foram elaborados com
base em métodos alternativos de desenvolvimento, dirigidos por forças demográficas,
econômicas, tecnológicas e que envolvem as emissões de gás verde (fontes de
emissão de CO2).
Os Microcosmos construídos no LEEM são salas climatizadas que obedecem as
características de diferentes cenários propostos pelo IPCC (2007). Uma das salas do
13
Microcosmos, denominada cenário atual (ou cenário controle), simula as condições
climáticas do ambiente em tempo real. As salas são ligadas a um painel de controle
automatizado, que capta as informações do ambiente externo, equilibrando as
condições climáticas dentro do Microcosmos de acordo com as características atuais.
Uma segunda sala reflete o cenário extremo (A2) proposto pelo IPCC (2007) com um
aumento de 4,5 °C na temperatura do ar e um aumento de 850 ppm de CO2. A sala
que simula o cenário extremo tem seus parâmetros acompanhando a variação da sala
que simula o cenário atual. As salas também possuem o fotoperíodo controlado, com
12 h de luz e 12 h de escuridão.
Na área externa do Microcosmos existe um painel indicador em tempo real das
características das salas. Pelo painel é possível acompanhar a temperatura,
concentração de CO2 e umidade dentro de cada sala. Todos os parâmetros são
armazenados a cada 2 minutos em um computador.
3.2.3 Experimento 2: Experimento em Microcosmos
Antes dos espécimes serem transportados para os dois cenários do
microcosmos, os animais passaram por um período de aclimatação de 30 dias em uma
piscina com circulação aberta e aeração constante. Após este período os peixes foram
transferidos para tanques com capacidade de 70 litros de água, onde passaram por
uma segunda aclimatação de sete dias em tanques iguais aos que foram construídos
para a realização do experimento dentro do microcosmos.
Dentro de cada tanque de 70 litros, foi construído um sistema com tubos
perfurados de PVC (2,5 cm de diâmetro) dispostos no fundo do tanque e conectados a
três tubos sem perfurações, com média 35 cm de altura, os quais foram mantidos
suspensos até a superfície, como três torres. Dentro desses três tubos foram colocadas
mangueiras com pedras porosas para a aeração da água. Este sistema se mostrou
eficiente na dissipação do CO2 da atmosfera do microcosmo na água dos tanques. O
mesmo sistema já havia sido utilizado em outros trabalhos realizados por Oliveira
(2014) e Dragan (2014).
14
Foi construído um sistema com nove tanques de aclimatação na área externa
do laboratório, em cada tanque foram colocados 10 peixes da espécie C. macropomum
(31.88 g ± 0.7; 10.03 cm ± 0.08). Os nove tanques foram organizados em três baterias
experimentais, sendo cada bateria constituída por três tratamentos diferentes. Os
tratamentos foram constituídos por um grupo controle, onde os peixes receberam
injeção intraperitoneal com óleo de milho de acordo com o peso (0.01 ml/g), mais dois
grupos experimentais onde os peixes receberam injeção intraperitoneal de óleo de
milho e contaminante nas concentrações de 8 mol/kg de BaP por quilo de peixe e 16
mol/kg de BaP por quilo de peixe, cada tratamento foi realizado em triplicata.
Após o período de sete dias de aclimatação externa, a alimentação foi
suspensa, os animais foram anestesiados em gelo e cada grupo experimental recebeu
injeções intraperitoneais de acordo com seus respectivos tratamentos. Decorridas 96 h
após a realização das injeções os animais foram transportados e divididos de forma
aleatória entre as duas salas do microcosmos (cenário atual e cenário extremo).
Em cada cenário do microcosmos foram construídos tanques iguais aos
tanques utilizados para o sistema de aclimatação externa. Nove tanques foram
montados dentro de cada cenário e os tratamentos foram mantidos em triplicata (grupo
controle: óleo de milho, tratamento 1 (8 mol/kg de B[a]P) e tratamento 2 (16 mol/kg
de BaP). Em cada tanque foram colocados 5 peixes, ou seja, o total de peixes para
cada tratamento por sala foi de 15 peixes distribuídos em três tanques. Os animais
permaneceram dentro dos cenários do microcosmos por um período de 30 dias.
Durante o período experimental, os peixes foram alimentados uma vez ao dia com
ração comercial contendo 36% de proteína bruta até a saciedade aparente. A
alimentação dos peixes foi realizada sempre no mesmo horário.
Após os 30 dias do período experimental dentro do microcosmos, os
espécimes de cada tanque foram coletados. Assim que um espécime era retirado do
tanque, uma amostra de sangue era coletada utilizando uma seringa previamente
heparinizada. As amostras de sangue foram coletadas para as análises hematológicas
e teste de genotoxicidade por meio do Ensaio Cometa.
Após a coleta do sangue os peixes foram anestesiados em gelo, medidos e
pesados. Em seguida os animais foram sacrificados por secção da espinha dorsal e
15
amostras de fígado foram coletadas, alíquotadas e devidamente armazenadas para as
análises histopatológicas, genéticas e fisiológicas.
3.2.4 Variáveis ambientais dos cenários do Microcosmos
Durante o andamento do experimento a água de cada tanque foi trocada em
dias alternados em ambos os cenários. Os parâmetros da água foram monitorados três
vezes por semana em cada tanque experimental; foram monitorados o pH, a
temperatura, o oxigênio dissolvido e o CO2 dissolvido na água, sempre nos mesmos
horários.
Os valores de pH foram obtidos com auxílio de um pHmetro UltraBASIC UB-10
(Denver Instrument, EUA), as medidas de temperatura e de oxigênio dissolvido na
água foram realizadas com o auxílio de um oxímetro 5512-FT (YSI, EUA) e os níveis de
CO2 foram determinados por meio de ensaio colorimétrico segundo Juhasz e e Tucker
(1992) (Tabela 1 e Figura 1).
As variáveis como temperatura e níveis de CO2 dentro das salas também foram
monitoradas para manter as características dos cenários conforme proposto pelo IPCC
(2007). Todo o monitoramento foi realizado com uma central computacional que
registra e controla a entrada de CO2 e calor dentro das salas. Na sala controle (cenário
atual) um sensor instalado dentro da sala foi conectado a um segundo sensor
construído dentro da floresta do INPA para fazer o controle das condições dentro da
sala em tempo real. A captação das informações das variáveis ambientais foi realizada
a cada dois minutos emitindo os dados para o sistema eletrônico, que se encarrega de
liberar ou retirar a quantidade de gás carbônico e calor necessários para a manutenção
das características do cenário extremo (A2). Todos os valores captados e os valores de
cada sala corrigidos para manter as simulações são armazenados em um computador
exclusivo para esta finalidade (Figura 2).
16
Tabela 1. Parâmetros físico químicos da água e do ambiente dos cenários atual e extremo do
microcosmos, onde os espécimes de tambaqui foram mantidos por 30 dias. Os dados estão
expressos em média e ± erro padrão da média.
Cenários Climáticos
Tratamentos [O2] na água
(mg.L-1
)
[CO2] na água (ppm)
Temperatura da água (°C)
pH ToC do
ambiente CO2 do
ambiente (ppm)
Atual
Controle
6.6 ± 0.06 7.1 ± 0.28 26.3 ± 0.20 6.7 ± 0.07
8mol/kg BaP
6.7 ± 0.07 6.8 ± 0.20 26.2 ± 0.21 6.9 ± 0.03 30.6 ± 0.39 510.1 ± 5.80
16mol/kg BaP
6.7 ± 0.06 6.8 ± 0.20 26.2 ± 0.20 6.9 ± 0.03
Extremo
Controle
6.3 ± 0.07 11.7 ± 0.31 28.4 ± 0.16 7.0 ± 0.02
8mol/kg BaP
6.3 ± 0.06 11.6 ± 0.30 28.5 ± 0.16 7.0 ± 0.03 34.1 ± 0.38 1349.2 ± 7.01
16mol/kg Bap
6.3 ± 0.07 11.5 ± 0.27 28.5 ± 0.16 7.0 ± 0.03
17
Figura 1. Níveis de CO2 (A) e temperatura (B) da água dos tanques experimentais
expostos ao cenário atual e cenário extremo (A2) proposto pelo IPCC (2007). Os dados
estão expressos em média e ± desvio padrão
A
B
18
Figura 2. Níveis de CO2 (A) e temperatura (B) do ambiente dentro do cenário atual e
cenário extremo (A2) proposto pelo IPCC (2007). Os dados estão expressos em média
e ± desvio padrão.
19
3.2.5 Experimento 3: Determinação da pressão crítica de oxigênio (PO2 crit)
A PO2 crit é definida como pressão parcial de O2, abaixo da qual a taxa de
respiração do animal diminui à medida que a pressão de O2 diminui. A determinação da
pressão critica de oxigênio foi necessária para a realização do experimento com
Roundup® e hipóxia, pois com a obtenção a PO2 crit, foi determinada a concentração
de oxigênio utilizada para a condição de hipóxia para C. macropomum.
Para a determinação do PO2 crit, seis espécimes de tambaquis foram
colocados individualmente em aquários de vidro com capacidade para cinco litros de
água, circulação fechada e aeração constante. Os animais passaram por um período
de aclimatação de 24 h e a alimentação foi suspensa durante todo o experimento. A
qualidade da água foi monitorada durante todo o experimento.
Após a aclimatação, os peixes foram divididos em dois grupos experimentais;
o grupo controle (n=3) sem contaminante e o grupo experimental (n=3) com Roundup®,
na concentração nominal de 15 mg L-1, que corresponde a 75% da CL50 estabelecida
por Miyasaki et al. (2004) para C. macropomum expostos por 96 h. Os peixes foram
expostos às condições experimentais por 96 h e, em seguida, foram colocados em
câmaras individuais de respirometria para a determinação do PO2 crit.
Os peixes permanecem dentro das câmaras por um período de três horas
com a água circulando abertamente dentro de cada câmara. Após este período, a
circulação de água foi fechada e a concentração de oxigênio foi diminuindo dentro da
câmara devido à hipóxia e à respiração do peixe; como consequência a PO2 também
diminuiu. A quantidade de oxigênio dentro das câmaras foi mensurada por meio de
sensores localizados em seu interior; cabos de fibra óptica são conectados aos
sensores e aos oxímetros (OXY-4 ou Witrox 4 Loligo Systems) que captam as
informações que são armazenadas em um computador em tempo real.
O consumo de oxigênio dentro das câmaras foi calculado e a PO2 crit foi
determinada como sendo a PO2 onde a linha de regressão da taxa metabólica basal
cruza com a linha de início da supressão da taxa metabólica por regressão linear
segmentada usando o software SegReg program (www.waterlog.info) (De Boeck et al.,
20
2013). Após o estabelecimento dos valores da PO2 crit, foi realizado o experimento
com Roundup® e hipóxia.
3.2.6 Experimento 3: Exposição aguda ao Roundup® e hipóxia
Para realização do experimento com Roundup® (RD), primeiramente 40
peixes (81.10 g ± 11.8; 15.11 cm ± 0.30) foram retirados dos tanques de manutenção
onde passaram por um período de aclimação de um mês (30 dias) após aquisição da
piscicultura. Antes da troca de tanques, a alimentação foi suspensa até o término do
experimento. Em seguida, os peixes foram colocados em tanques de vidro individuais
com capacidade para 5 litros de água, em um sistema fechado e aeração constante.
Os animais passaram por um período de aclimatação de 24 h nos tanques
experimentais, antes do início do experimento.
Após o período de aclimatação, os peixes foram divididos em quatro grupos
experimentais de 10 indivíduos (n=10). A toxicidade do RD (i.e. 360 g de glifosato L-1)
foi avaliada usando uma concentração sub-letal que corresponde a 75% da CL50
(concentração nominal: 15 mg L-1), em 96 h para C. macropomum, estabelecida por
Miyasaki et al. (2004). No primeiro tratamento, os animais foram mantidos em normóxia
sem contaminante. No segundo tratamento, os animais foram mantidos em normóxia
na presença do contaminante RD (concentração nominal: 15 mg L-1). No terceiro
tratamento, os animais foram expostos à hipóxia (6 h) sem RD. No quarto tratamento,
os peixes foram expostos à hipóxia (6 h) na presença do contaminante RD
(concentração nominal: 15 mg L-1). O experimento teve duração de 96h, sendo que
nos tratamentos com hipóxia, do total de horas experimentais, 6h foram em baixa
concentração de oxigênio.
Durante o experimento, os parâmetros da água (pH, oxigênio e temperatura)
foram mensurados. Diariamente, dois litros de água de cada tanque eram trocados, e
as concentrações de RD reestabelecidas.
Ao término do experimento, todos os peixes foram retirados individualmente
dos aquários e amostras de sangue foram coletadas com auxílio de seringas
heparinizadas para as análises hematológicas e genotóxicas (Ensaio Cometa). Em
21
seguida, os peixes foram anestesiados em gelo, pesados, medidos e eutanasiados por
secção da espinha dorsal. Após a eutanásia, amostras de fígado foram coletadas para
as análises histológicas, genéticas e enzimáticas.
3.3. Procedimentos Analíticos
3.3.1 Análises hematológicas e plasmáticas
As amostras de sangue foram obtidas por punção da veia caudal, com o
auxílio de seringas heparinizadas. Os parâmetros hematológicos e plasmáticos
avaliados foram: níveis de hematócrito (Ht), hemoglobina (Hb), número de eritrócitos
circulantes (RBC), constantes corpusculares (hemoglobina corpuscular média (HCM),
volume corpuscular médio (VCM), concentração de hemoglobina corpuscular média
(CHCM) e glicose.
As técnicas utilizadas para as análises hematológicas estão descritas a
seguir:
a) Hematócrito (Ht): Para determinar o hematócrito, amostras de sangue
foram transferidas para tubos de microhematócrito e centrifugadas durante 10
minutos sendo a leitura do porcentual (%) de sedimentação feita com o auxílio de
uma escala padronizada (Navarro e Pachaly, 1994).
b) Concentração de hemoglobina (Hb): Os níveis de hemoglobina foram
mensurados utilizando-se 10µl de sangue diluído em dois ml do reagente Drabkin
segundo protocolo estabelecido por Kampen e Zijlstra (1964).
c) Contagem do número de eritrócitos (RBC): O número de eritrócito foi
estimado por meio da diluição de 10 µl de sangue em 2 ml da solução de formol
citrato. A contagem das células foi realizada em câmera de Neubauer, em
microscópio óptico aumentado em 40x (Navarro e Pachaly, 1994).
d) Determinação das constantes corpusculares: As constantes
corpusculares, volume corpuscular médio (VCM), hemoglobina corpuscular média
22
(HCM), e a concentração de hemoglobina corpuscular média (CHCM) foram
determinadas a partir dos valores correspondentes ao número de eritrócitos
circulantes, ao hematócrito e à concentração de hemoglobina, de acordo com as
fórmulas estabelecidas por Brow (1976).
e) Níveis de glicose: Os níveis de glicose foram mensurados por meio do
método enzimático colorimétrico sem desproteinização (GOD-PAP), kit InVitro®.
Nesse método a glicose é determinada após a oxidação enzimática na presença de
glicose oxidada. O peróxido de hidrogênio formado reage sob a catálise da
peroxidase com o fenol e 4-aminofenazona originando a quinoneimina que é um
cromógeno vermelho violeta. A leitura foi realizada em espectrofotômetro no
comprimento de onda de 500 nm.
3.3.2 Ensaio Cometa
Para verificação dos danos no DNA das células sanguíneas das amostras de
sangue coletadas, seguiu-se o protocolo desenvolvido por de Singh et al. (1988),
adaptado por Silva et al. (2000).
Previamente, lâminas foram cobertas com uma solução de agarose (1.5% de
agarose normal em tampão fosfato) 12 h antes da realização do experimento. No
momento da coleta, 5 l de amostra de sangue de cada peixe foram misturados em
0.75% de agarose (low melting agarose), 5% (Gibco BRL) a 37 oC e imediatamente
dispostos sobre as lâminas pré cobertas com agarose. Uma lamínula de vidro foi
utilizada para espalhar e cobrir o sangue sobre a lâmina. Após a secagem da agarose
as lamínulas foram retiradas, e as lâminas foram dispostas em uma cubeta de vidro
contendo solução de lise (2,5 M NaCl, 100 mM EDTA, 10 mM Tis: pH 10-10.5; 1% de
Triton X- 100 e 10% de DMSO). As lâminas permaneceram em solução de lise por, no
mínimo, 48h até a realização da corrida eletroforética.
Para a realização da corrida eletroforética as lâminas foram dispostas em
uma cuba de eletroforese e incubadas por 20 minutos em tampão alcalino de hidróxido
de sódio e EDTA (300 mM NaOH e 1 mM EDTA, pH>13). Posteriormente, a corrida
23
eletroforética em tampão alcalino foi realizada por um período de 20 minutos a 300 mA,
25 V a 4 oC para a formação da cauda do cometa dos eritrócitos.
Após a eletroforese, as lâminas foram lavadas três vezes em tampão Tris
(0.4 M Tris, pH 7.5) para neutralização do gel. Finalmente, as lâminas foram coradas
em uma solução de nitrato de prata (5% de carbonato de sódio, 0,1% de nitrato de
amônia, 0,1% de nitrato de prata, 0,25% de ácido tungstosilícico e 0,15% de
formaldeído). A análise das lâminas foi realizada com o auxílio de um microscópio de
luz (Leica DM2015) na objetiva de 40x de aumento. As células foram aleatoriamente
selecionadas durante a análise. Foram contadas 100 células por lâmina, sendo duas
lâminas para cada peixe.
Durante a contagem, foi utilizado o tamanho da cauda formada no eritrócito
devido ao grau de fragmentação do DNA para a classificação dos danos genéticos.
Foram utilizadas cinco classes (scores) de acordo com a caracterização do tamanho da
cauda do DNA e sua porcentagem em relação ao número total de células analisadas,
sendo o dano zero: <5%; 1: 5-20% - baixo índice de danos; o dano 2: 20-40% - índice
de danos intermediário; o dano 3: 40-75% - alto índice de danos, e dano 4: >75% -
danos extremos.
Para o cálculo do índice de danos genéticos (IDG) das células sanguíneas de
cada peixe, a soma de cada classe de dano foi multiplicada pelo valor de cada
respectiva classe de dano. Assim, a somatória do IDG pode variar de zero (100 x 0,
100 células sem danos) a 400 (100 x 4, 100 células com o máximo de danos)
(Kobayashi et al., 1995).
3.3.3 Análises histopatológicas
Amostras de fígado de todos os experimentos foram coletadas para a
avaliação histopatológica. Após a coleta, as mostras foram imediatamente fixadas em
fixador ALFAC (Etanol 80%, Formol 37% e Ácido acético) por um período de 15 h.
Depois do período de fixação, as amostras foram lavadas e mantidas em Etanol 70%
até a preparação do material histológico.
24
Para o preparo histológico, as amostras passaram por uma bateria crescente
de desidratação em etanol e xilol, com posterior diafanização, impregnação e inclusão
do material em parafina ou paraplast, seguida da preparação dos cortes histológicos.
Os cortes histológicos foram realizados em micrótomo na espessura de 5
m. Foram preparadas de 2 a 3 lâminas histológicas para cada peixe. Os cortes
histológicos foram corados com Hematoxilina de Harris & Eosina (HE) para
visualização geral da estrutura do órgão e análise histopatológica (Michalani, 1980). As
análises foram realizadas em microscópio de luz.
Os danos no fígado foram mensurados semiquantitativamente por meio do
índice de alterações histológicas (IAH). O índice não leva em consideração a
frequência de ocorrência das alterações, mas sim o grau de severidade das lesões de
acordo com seu estágio (Estágio I, II ou III). No estágio I as alterações não são
consideradas muito severas, não afetando o funcionamento do órgão. No estágio II as
alterações são moderadas comprometendo o funcionamento do órgão, mas as
alterações ainda são lesões reparáveis e se mantidas em exposição crônica podem
levar a alterações graves. No estágio III as alterações são severas comprometendo o
funcionamento do órgão sendo irreparáveis.
Os danos de estágio I para fígado são: hipertrofia nuclear, hipertrofia celular,
vacuolização citoplasmática, infiltração leucocitária, dilatação dos sinusoides e
deformação do contorno celular. Os danos de estágio II para o fígado são obstrução
dos sinusoides, vacuolização nuclear, degeneração nuclear, degeneração
citoplasmática, núcleos picnóticos e rompimento celular. O dano de estágio III é a
necrose focal.
O cálculo do IAH é realizado com base na fórmula IAH: 100 x ƩI + 101 x ƩIƩII +
102x ƩIƩIII. Onde 10 é elevado a 0 vezes a somatória de quantas alterações de estágio
I foram encontradas, mais 10 elevado a 1 vez a somatória das alterações de estágio II
encontradas, mais 10 elevado a 2 vezes (ao quadrado) a somatória das alterações de
estágio III encontradas.
25
O índice de alterações histológicas permite classificar o comprometimento do
órgão de acordo com o valor do cálculo, de maneira que um IAH de:
0 a 10 = funcionamento normal do órgão.
11 a 20 = danos leves a moderados no órgão.
21 a 50 = alterações moderadas a severas no órgão.
50 a 100 = alterações severas no órgão.
Maior que 100 danos irreparáveis no órgão.
Toda a metodologia descrita para o cálculo do IAH seguiu os protocolos estabelecidos
por Poleksic e Mitrovic-Tutundzic (1994) e Silva (2004).
3.3.4 Análises genéticas
Isolamento do RNA total
O isolamento do RNA das amostras de fígado coletadas em todos os
experimentos foi realizado utilizando protocolo Trizol®reagent (InvitrogenTM, Cat. No
15596-018) de acordo com as instruções do fabricante que segue três etapas
principais: na primeira foi realizada a lise celular, a dissolução das nucleoproteínas,
inativação das RNases e retirada dos debris celulares; na segunda etapa foi feita a
limpeza da solução, com a retirada dos solventes orgânicos e separação da fase
aquosa; e por último, a precipitação e ressuspensão do RNA total em água livre de
RNases. Após a extração, o DNA contaminante das amostras de RNA foi extraído com
DNase I (InvitrogenTM).
Avaliação quantitativa e qualitativa do RNA
A quantificação do RNA extraído, bem como a avaliação do grau de pureza de
cada amostra foram realizadas utilizando o espectrofotômetro NanoDrop®, modelo
2000 (Thermo Scientific), conforme orientações no manual do usuário (NanoDrop
26
2000/2000c Spectrophotometer, V1.0 user manual, 2009). Por meio do
espectrofotômetro foi possível determinar a concentração de RNA total presente em
cada amostra, bem como possíveis contaminações por proteínas e fenol. As análises
foram realizadas com a leitura da absorbância da luz das amostras entre os
comprimentos de onda de 260 e 280 nm.
A integridade do RNA extraído de todas as amostras foi verificada por meio de
corrida eletroforética a 4 Voltz por centímetro (V/cm) em gel de agarose 1,0% em peso
por volume (p/v). A visualização do gel ocorreu por meio do sistema de
fotodocumentação digital L.PIX (Loccus Biotecnologia).
As amostras de RNA que não apresentaram contaminação por proteína e/ou
fenol, e que possuíam as bandas de RNA ribossomal bem visíveis após a corrida
eletroforética, foram validadas e armazenadas em freezer -80oC.
Síntese de cDNA
A síntese do cDNA (RNA de fita simples) das amostras de RNA validadas foi
realizada utilizando o Kit de síntese de cDNA RevertAid H Minus First Strand cDNA
Synthesis kit (Fermentas®), seguindo as instruções do fabricante. O Tratamento
enzimático com transcriptase reversa (MMLV Reverse Transcriptase) (200U/L, USB)
foi realizado, em seguida foram misturados em um microtubo de 1,5 mL
aproximadamente 25 μg de RNA, 1,0 μL de oligonucleotídeo dT(18) (1 μg), 1,0 μL de
dNTP mix (10 mM), tampão 5X MMLV e água deionizada (q.s.p.) para um volume final
de 50 mL. Em seguida, o tubo foi incubado a 37 °C por uma hora para a conversão e
70 °C por 10 minutos para inativação da enzima. A confirmação da síntese de cDNA foi
realizada por eletroforese em gel de agarose 1% (m/v).
Determinação das sequências dos genes ras e hif-1
Primeiramente foi feita a pesquisa das sequências gênicas para os genes alvo
(ras e hif-1) existentes para diferentes espécies de peixe no NCBI
(http://www.ncbi.nlm.nih.gov). Após a busca, sequências consenso para os genes alvo
27
foram obtidas a partir de regiões preservadas das sequências do NCBI, utilizando o
software BioEdit Sequence Alignment Editor versão 7.0.5.3. A partir das sequências
consenso foram desenhados primers degenerados para os genes ras e hif-1com o
auxílio do programa Oligo Explorer 1.2 ™.
Os primers degenerados foram testados por meio de gradientes de temperaturas
em PCR (Reação em cadeia da Polimerase), utilizando o PCR master mix (Promega).
Os produtos da PCR obtidos foram sequenciados no sequenciador automático ABI
3130XL, utilizando o Kit ABI PRISM® Big DyeTM Terminator Cycle Sequencing Ready
Reaction (Applied Biosystems), para a obtenção das sequências gênicas específicas
dos genes ras e hif-1 para C. macropomum.
Confecção dos oligonucleotídeos específicos para RT-PCR dos genes ras e hif-1
As sequências para os genes ras e hif-1obtidas no sequenciamento foram
validadas utilizando o programa BLAST do NCBI. Após a validação, as sequências
foram alinhadas no programa ClustalW, disponível no Software BioEdit Sequence
Alignment Editor versão 7.0.5.3 e os oligonucleotídeos específicos de C. macropomum
para q-PCR para os genes ras e hif-1 desenhados através do Software Oligo Explorer
1.2 ™.
Além dos genes alvo (ras e hif-1) utilizados no presente trabalho, também
foram utilizados genes de referência 28S (Vasquez, 2009) e ef-1 (Brandão, 2015),
obtidos com a mesma técnica. As características do primers específicos obtidos para
C. macropomum estão descritos na Tabela 2.
Real Time RT-PCR (Transcrição Reversa seguida por Reação em Cadeia da
Polimerase em Tempo Real)
Amostras de cDNA dos fígados de C. macropomum foram utilizadas para a
quantificação dos genes transcritos por real-time PCR, utilizando o equipamento Viia7
Dx da Life Technologies (Applied Biosystems). As análises foram realizadas em placas
28
de 96 poços, onde cada amostra foi lida em triplicata. As reações foram desenvolvidas
utilizando-se 1,0 μL de cDNA, 5,0 μL de SYBR® Green PCR Master Mix (Applied
Biosystems), 1,0 μL do primer forward, 1,0 μL do primer reverse e 2,0 μL de água livre
de nucleases 192 (Ambion, Life Technologies) com um volume final de 10 μL. As
condições da reação foram: um passo inicial de 95 °C por 10 minutos, seguidos por 40
ciclos de 95 °C por 15 segundos e 60 °C por 60 segundos. As reações foram realizadas
em triplicata para a detecção de possíveis erros.
A presença de um único produto específico na temperatura de “melting” foi
confirmada utilizando a curva de melting de cada primer conforme descrito na tabela 3.
A eficiência de cada primer foi calculada em uma curva de diluição seriada obtida a
partir de um pool de amostras de cDNA de C. macropomum (com concentração entre
1000 e 1 ng de cDNA; n=4). Todos os primers apresentaram eficiência de amplificação
para PCR satisfatória (entre 98 e 105%) (Tabela 2). A eficiência de amplificação de
cada primer foi calculada de acordo com Pfaffl (2001).
Quantificação relativa da expressão gênica
Para a detecção da diferença nos níveis de expressão dos genes ras e hif-1
entre as diferentes condições experimentais que os peixes foram submetidos nos
diferentes experimentos, foi utilizado o método de quantificação relativa (Pfaffl, 2001).
Este método é uma modificação do método Ct comparativo (∆Ct) baseado na
quantificação do gene de interesse em relação a genes constitutivos denominados
genes de referência e a eficiência na transcrição reversa. A razão de expressão relativa
é baseada na eficiência de amplificação e na variação do Ct do grupo controle ou
calibrador e os outros grupos de interesse em relação ao gene constitutivo denominado
gene de referência.
29
Tabela 2. Características de cada primer específico obtido para a realização dos
experimentos. Primers para os genes endógenos (28S e ef-1) e primers para os
genes alvo (ras e hif-1).
Gene
Sequência do primer (5`-3`) forward/reverse
Comprimento (bp)
Tamanho do amplicon(bp)
Tm Ef(%)*
28S-F
CGGGTTCGTTTGCGTTAC
18 150 54.5 98.19
28S-R
AAAGGGTGTCGGGTTCAGAT
20 150 56.3 98.19
ef-1F
GTTGGTGAGTTTGAGGCTGG
20 78 60.7 99.09
ef-1R
CACTCCCAGGGTGAAAGC
18 78 60.9 99.09
Ras-F
CCAGTACATGAGGACAGGAG
20 134 60.3 99.31
Ras-R
CAAGCACCATTGGCACATCG
20 134 60.3 99.31
HIF-1F a
CTTCTGAGCTCTGATGAGGC
20 98 60.1 105.24
HIF-1R a
GAAAGCACCATCAGGAAGCC
20 98 61.2 105.24
HIF-1F b
ATCAGCTACCTGCGCATG 18 133 59.3 100.69
HIF-1R b
CTCCATCCTCAGAAAGCAC 19 133 57.3 100.69
*Eficiência do primer.
(a) Par 1 para o gene Hif-1utilizado no primeiro experimento.
(b) Par 2 para o gene Hif-1utilizado no segundo e terceiro experimento.
30
3.3.5 Análises bioquímicas
Antes de todas as análises enzimáticas as amostras de fígado que estavam
mantidas em freezer -80 oC foram alíquotadas, pesadas e homogeneizadas em tampão
com pH 7,6 (20 mM de tris-base, 1 mM de EDTA, 1 mM de dithiothreitol, 500 mM de
Sucrose e150 mM de KCL) na proporção 1: 2 massa:volume para Lipoperoxidação
Lipídica (LPO), e 1:10 massa: volume para as enzimas Glutationa-S-Transferase (GST)
e Catalase (CAT).
Após a homogeneização as amostras foram centrifugadas de acordo com os
protocolos para cada enzima, sendo que para GST e CAT a centrifugação ocorreu a
9.000 rcf, por 30 min a 4 oC e para LPO 10.000 rpm, por 10 min a 4 oC. Os
sobrenadantes foram retirados e alíquotas para cada enzima foram separadas e
analisadas conforme os protocolos descritos a seguir.
Enzima de Biotransformação: Glutationa-S-Transferase
A atividade da GST no fígado foi determinada de acordo com o método descrito
por Keen et al. (1976), que utiliza o 1-cloro-2,4-dinitrobenzeno (CDNB) como substrato.
Mudanças na absorbância foram verificadas em espectrofotômetro a 340 nm e a
atividade da enzima foi expressa em nmol de CDNB conjugado. min-1. mg proteína-1
utilizando-se o coeficiente de extinção molar de 9,6 mM cm -1.
Enzima antioxidante: Catalase
A atividade da enzima catalase foi determinada pelo método estabelecido por
Beutler (1975), onde a taxa de inibição da decomposição do H2O2 foi medida na
absorbância de 240 nm em espectrofotômetro. A atividade da CAT foi expressa como
μmol H2O2. min-1 .mg proteína-1.
31
Peroxidação Lipídica das membranas (LPO)
A determinação da peroxidação lipídica foi realizada pelo método conhecido
como ensaio FOX, estabelecido por Jiang et al. (1991). O ensaio FOX corresponde à
reação química de auto oxidação de lipídios (LH) que conduz a lipoperoxidação
(LOOH). O método está baseado na oxidação do Fe (II) por LOOH em pH ácido na
presença de um pigmento complexador de Fe (III), o xilenol laranja. A formação deste
complexo foi quantificada pelo aumento da absorção em 560 nm e expressa em μM
CHP (hidroperóxido de cumeno) por mg de proteína hepática.
Quantificação da proteína hepática
A proteína total de cada amostra de fígado foi mensurada de acordo com
Bradford (1976) por espectrometria, e albumina bovina (BSA) foi utilizada como padrão.
A leitura foi realizada em 595 nm.
3.4 Análise estatística
Capítulo I
Todos os dados estão apresentados como média e ± erro padrão da média
(SEM). A expressão gênica, histopatologia e o ensaio cometa foram analisados por
meio da análise de variância, ANOVA de um fator para determinar as diferenças entre
os diferentes tratamentos com benzo[a]pireno e o controle. Quando os dados violaram
as premissas do teste ANOVA de um fator (normalidade e variância), o teste não
paramétrico de Kruskal-Wallis foi aplicado. A significância estatística foi considerada
para valores de P< 0.05. A análise estatística foi realizada utilizando o programa Sigma
Stat 3.5.
Capítulo II
Os dados estão expressos como média e ± erro padrão da média. Previamente
a distribuição e a homogeneidade dos dados foram verificadas. Os danos
apresentaram distribuição normal e passaram no teste de variância, sendo aplicado o
teste estatístico ANOVA de dois fatores seguido do teste de Tukey para múltiplas
32
comparações. Os fatores considerados foram os diferentes cenários dos microcosmos
(cenário atual e cenário extremo proposto pelo IPCC, 2007), e os diferentes
tratamentos (controle (óleo de milho), 8 e 16 mol/kg de BaP). A diferença estatística
foi considerada para valores de P< 0.05. As análises foram realizadas utilizando o
programa estatístico Sigma Stat 3.5. Outro teste estatístico realizado foi à análise dos
componentes principais (PCA) utilizando o programa Statistica.
Capitulo III
Os dados estão descritos como média ± erro padrão da média (SEM). Antes dos
testes comparativos a distribuição e homogeneidade dos dados foram verificadas.
Todos os dados foram analisados por meio to teste estatístico ANOVA de dois fatores,
seguido do teste Tukey tendo como fatores a concentração de oxigênio (normóxia e
hipóxia) e a contaminação da água ou não com Roundup®. A significância estatística
foi considerada para valores de P< 0.05. A análise estatística foi realizada utilizando o
programa Sigma Stat 3.5.
33
4. Bibliografia
Abdel-Shafy, H.I. e Mansour, M.S.M. (2016). A review on polycyclic aromatic hydrocarbons: Source, environmental impact, effect on human health and remediation. Egyptian Petroleum Research Institute Egyptian Journal of Petroleum. Egyptian Journal of Petroleum, 25: 107-123. Almeida, L.C., Lundstedt, L.M., & Moraes,G. (2006). Digestive enzyme responses of tambaqui (Colossoma macropomum) fed on different levels of protein and lipid. Aquaculture Nutrition, 12(6): 443-450. Arey, J.,e Atkinson, R. (2003). Photochemical reactions of PAHs in the atmosphere. PAHs: An Ecotoxicological Perspective, 47-63. Barbacid, M. (1987). Ras genes. Annual review of biochemistry, 56(1): 779-827. Banni, M., Negri, A., Dagnino, A., Jebali, J., Ameur, S., Boussetta, F. (2010). Acute effects of benzo[a]pyrene on digestive glande nzymatic biomarkers and DNA damage on mussel Mytilus galloprovincialis. Ecotoxicology and Environmental Safety, 73: 842-848.
Baptista, R. B., Souza-Castro, N., & Almeida-Val, V. M. F. (2016). Acute hypoxia up-regulates HIF-1α and VEGF mRNA levels in Amazon hypoxia-tolerant Oscar (Astronotus ocellatus). Fish Physiology and Biochemistry, 1-12.
Beutler, E. (1975). Red Cell Metabolism: A manual of biochemical methods. Grune & Straton, New York.
Bos, J.L. (1989). Ras oncogenes in human cancer: a review. Cancer Research, 49: 4682-4689.
Boyd, C.E. e Tucker, C.S. (1992). Water quality and pond soil analysis for aquaculture. Auburn: Auburn
University. 183p.
Bradford, M.M. (1976). A rapid and sensitive method for the quantification of microgram quantities of
protein utilizing the protein-dye binding. Analytical Biochemistry, 72:248-254.
Brandão, R.M.L. Efeitos do hormônio do crescimento recombinante bovino (rbgh lactotropin
®) na
expressão do gene igf-i e parâmetros fisiológicos em juvenis de tambaqui (Colossoma macropomum)/ Rúbia Maielli Lima Brandão. Dissertação (mestrado) Newton Lins, Manaus, 2015. Orientador: Dra.Vera Maria Fonseca de Almeida e Val. Área de concentração: Aquicultura. Braz-Mota, S., Sadauskas-Henrique, H., Duarte, R. M., Val, A. L., & Almeida-Val, V. M. (2015). Roundup
®
exposure promotes gills and liver impairments, DNA damage and inhibition of brain cholinergic activity in the Amazon teleost fish Colossoma macropomum. Chemosphere, 135: 53-60. Boutilier, R. G. (2001). Mechanisms of cell survival in hypoxia and hypothermia. Journal of Experimental Biology, 204(18): 3171-3181. Brow, B.A. (1976). Hematology: principles and procedures. 2ª ed. Philadelphia. Lea & Febiger.
Cao, Y.B., Chen, X.Q., Du, J Z., & Wang, Y.X. (2005). Molecular cloning of hypoxia-inducible factor 1 alpha from brain of scale-less carp (Gymnocypris przewalskii) in Lake Qinghai of China. Comparative Biochemichal and Physiology A, 140: 257-273.
34
Cattaneo, R., Clasen, B., Loro, V.L., de Menezes, C.C., Pretto, A., Baldisserotto, B., & de Avila, L.A. (2011). Toxicological responses of Cyprinus carpio exposed to a commercial formulation containing glyphosate. Bulletin of Environmental Contamination and Toxicology, 87(6): 597-602.
Cavalcante, D.G.S.M., Martinez, C.B.R., & Sofia, S.H. (2008). Genotoxic effects of Roundup
® on the fish
Prochilodus lineatus. Mutation Research/Genetic Toxicology and Environmental Mutagenesis, 655(1): 41-46. Çavaş, T., e Könen, S. (2007). Detection of cytogenetic and DNA damage in peripheral erythrocytes of goldfish (Carassius auratus) exposed to a glyphosate formulation using the micronucleus test and the comet assay. Mutagenesis, 22(4): 263-268. Cheng, R., Bradford, S., Barnes, D., Williams, D., Hendricks, J., & Bailey, G. (1997). Cloning, sequencing, and embryonic expression of an N-ras proto-oncogene isolated from an enriched zebrafish (Danio rerio) cDNA library. Molecular Marine Biology and Biotechnology, 6(1): 40-47.
Comte, L., Buisson, L., Daufresne, M., & Grenouillet, G. (2013). Climate‐induced changes in the
distribution of freshwater fish: observed and predicted trends. Freshwater Biology, 58(4): 625-639. Corbera, M., Hidalgo, M., Salvado, V., & Wieczorek, P. P. (2005). Determination of glyphosate and aminomethylphosphonic acid in natural water using the capillary electrophoresis combined with enrichment step. Analytica Chimica Acta, 540(1): 3-7. Corrêa, C.F., Aguiar, L.H., Lundstedt, L.M., Moraes, G. (2007). Responses of digestive enzymes of tambaqui (Colossoma macropomum) to dietary cornstarch changes and metabolic inferences. Comparative Biochemistry and Physiology, Part A, 147: 857-862. Costa, A., Coradini, D., Carrassi, A., Erdas, R., Sardella, A., & Daidone, M. G. (2001). Re: Levels of Hypoxia-Inducible Factor-1α During Breast Carcinogenesis. Journal of the National Cancer Institute, 93(15): 1175-1177. Costa, O.T.F. Efeito do pH da água sobre os parâmetros hematológicos, eletrólitos e equilíbrio ácido-base do sangue arterial de Colossoma macropomum (Characiformes, Serrasalmidae). Master Thesis, INPA: FUA, Manaus, 1995. Dalla Via, J., Thillart, G.V.D., Cattani, O., de Zwaan, A., (1994). Influence of long-term hypoxia exposure on the energy metabolism of Solea solea. II. Intermediary metabolism in blood, liver, and muscle. Marine Ecology Progress Series, 111: 17-27. Dauer, D.M. (1993). Biological criteria, environmental health and estuarine macrobenthic community structure. Marine Pollution Bulletin, 26(5): 249-257. De Boeck, G.,C.M. Wood, F.I. Iftikar, V. Matey, G.R. Scott, K. A. Sloman, M.N. Paula-Silva, V.M.F. Almeida-Val & A.L. Val. (2013). Interactions between hypoxia tolerance and food deprivation in Amazonian oscars, Astronotus ocellatus. Journal of Experimental Biology, 216: 4590–4600. Diaz, R.J. e Rosenberg, R. (2008). Spreading dead zones and consequences for marine ecosystems. Science, 21: 926-929. Dragan, F.G. Respostas fisiológicas e metabólicas do tambaqui (Colossoma macropomum, Cuvier 1818) às alterações climáticas previstas pelos diferentes cenários do IPCC para o ano de 2100 / Fernanda Garcia Dragan. --- Manaus : [s.n], 2014. xiv, 82 p. Dissertação (Mestrado) INPA, Manaus, 2015.
35
Orientador : Vera Maria Fonseca de Almeida e Val. Área de concentração: Biologia de Água Doce e Pesca Interior. Dunwoodie, S. L. (2009). The role of hypoxia in development of the Mammalian embryo. Developmental cell, 17(6): 755-773. Fong, A.T., Dashwood, R.H., Cheng, R., Mathews, C., Ford, B., Hendricks, J.D., Bailey, G.S. (1993). Carcinogenicity, metabolism and Ki-ras proto-oncogene activation by 7,12-dimethylbenz[a]anthracene in rainbow trout embryos. Carcinogenesis, 14(4): 629-635. Giesy, J.P., Dobson, S., & Solomon, K.R. (2000). Ecotoxicological risk assessment for Roundup
®
herbicide. In Reviews of Environmental Contamination and Toxicology (pp. 35-120). Springer New York. Gouveia, C., Liberato, M.L.R., DaCamara, C.C., Trigo, R.M., & Ramos, A. M. (2011). Modelling past and future wine production in the Portuguese Douro Valley. Climate Research, 48(2-3): 349-362. Grisolia, C. K. (2002). A comparison between mouse and fish micronucleus test using cyclophosphamide, mitomycin C and various pesticides. Mutation Research/Genetic Toxicology and Environmental Mutagenesis, 518(2): 145-150. Guilherme, S., Gaivão, I., Santos, M.A., Pacheco, M. (2010) European eel (Anguilla anguilla) genotoxic and pro-oxidant responses following short-term exposure to Roundup
®: a glyphosate-based herbicide.
Mutagenesis, 25(5): 523-530. Hall, M. e Grover, P.L. (1990). Polycyclic aromatic hydrocarbons: metabolism, activation and tumour initiation, in: Cooper, C.S., Grover, P.L. (Eds.), Chemical Carcinogenesis and Mutagenesis, Springer, Heidelberg, Germany, pp. 327-372. Harris, A. L. (2002). Hypoxia-a key regulatory factor in tumour growth. Nature Reviews Cancer, 2(1): 38-47. Hochachka, P.W., e Somero, G.N. (2002). Biochemical Adaptation, Mechanism and Process in Physiological Evolution. Oxford University Press. USA, New York, 480pp. Inomata, Y., Kajino, M., Sato, K., Ohara, T., Kurokawa, J.I., Ueda, H., & Akimoto, H. (2012). Emission and atmospheric transport of particulate PAHs in Northeast Asia. Environmental science & technology, 46(9): 4941-4949. Intergovernmental Panel on Climate Change (IPCC). (2007). Summary for Policymakers. In: Solomon, S.;
Qin, D.; Manning, M., Chen, Z.; Marquis, M.; Averyt, K.B.; Tignor, M.; Miller, H.L. (Eds). Climate Change 2007: The 117 Physical Science Basis. Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change. Cambridge University Press, Cambridge, United Kingdom and New York, United States of America. p. 1-17. International Agency for Research on Cancer (IARC), (2010). Some non-heterocyclic polycyclic aromatic hydrocarbons and some related exposures, Monogr Eval Carcinog Risks Hum 92: 765-771. International Agency for Research on Cancer (IARC), (2012) .Chemical Agent sand Related Occupations: A Review of Human Carcinogens .IARC Monographs on the Evaluation of Carcinogenic Risks to Humans 100F,111-138. Jensen, F.B., Nikinmaa, M., Weber, R.E., (1993). Environmental, perturbations of oxygen transport in teleost fishes: causes, consequences and compensations. In: Rankin, J.D., Jensen, F.B. (Eds.), Fish Ecophysiology. Chapman and Hall, London, pp. 161-179.
36
Jiang, Z.Y., Woolland, A.C.S., Wolf, S.P. (1991). Lipid hydroperoxide measurement by oxidation of Fe2+ in the presence of xylenol orange-comparison with TBA assay and on iodometric method. Lipids, 26:777-860.
Jiraungkoorskul, W., Upatham, E. S., Kruatrachue, M., Sahaphong, S., Vichasri-Grams, S., & Pokethitiyook, P. (2002). Histopathological effects of Roundup, a glyphosate herbicide, on Nile tilapia (Oreochromis niloticus). Science Asia, 28: 121-127. Juhasz, A.L., e Naidu, R. (2000). Bioremediation of high molecular weight polycyclic aromatic hydrocarbons: a review of the microbial degradation of benzo [a] pyrene. International Biodeterioration & Biodegradation, 45(1): 57-88. Kampen, E.J.; Zijlstra, W.G. 1964. Standartization of haemoglobinometry. In: Boroviczény, C. G. (Ed.) Erythrocytometric Methods and their standardization. Bibliotheca Haematologica, p.68-72.
Karami, A., Christianus, A., Ishak, Z., Shamsuddin, Z.H., Masoumian, M., & Courtenay, S.C. (2012). Use of intestinal Pseudomonas aeruginosa in fish to detect the environmental pollutant benzo [a] pyrene. Journal of Hazardous Materials, 215: 108-114.
Karol, I.L., Kiselev, A.A. and Frolkis, V.A. (2011). Indices of the Factors that Form Climate Changes of Different Scales. Atmospheric and Oceanic Physics, 47(4): 415–429.
Keen, J.H.,Habig, W.H., Jakoby, W.B. 1976. Mechanism for the several activities of the glutathione S-transferase. The Journal of Biological Chemistry, 251:6183-6188.
Kobayashi, S.C., Morikawa, Y., Hayashi, M., Sofuni, T. (1995). A comparison between manual microscopic analysis and computerized image analysis in the single cell gel electrophoresis assay MMS Community, 2 pp. 103-115. Kolpin, D.W., Thurman, E.M., Lee, E.A., Meyer, M.T., Furlong, E.T., Glassmeyer, S.T., (2006). Urban contributions of glyphosate and its degradate AMPA to streams in the United States. Science of the Total Environment, 354: 191-197. Law, S. H., Wu, R. S., Ng, P. K., Richard, M. K., & Kong, R. Y. (2006). Cloning and expression analysis of two distinct HIF-alpha isoforms–gcHIF-1alpha and gcHIF-4alpha–from the hypoxia-tolerant grass carp, Ctenopharyngodon idellus. BMC Molecular Biology, 7(1): 1. Lee, J. S., Park, E. H., & Choe, J. (1998). Nucleotide Sequence of Exon 2 to 4 of the R-ras Gene in the Hermaphroditic Fish Rivulus marmoratus. DNA Sequence, 8(4): 229-234. Lutz, P. L. and Nilsson, G. E. (1997). Contrasting strategies for anoxic brain survival – glycolysis up or down. Journal of Experimental Biology, 200: 411-419. Mangold, K., Chang, Y. J., Mathews, C., Marien, K., Hendricks, J., & Bailey, G. (1991). Expression of ras genes in rainbow trout liver. Molecular Carcinogenesis, 4(2): 97-102. Marchand, J., Tanguy, A., Charrier, G., Quiniou, L., Plee-Gauthier, E., & Laroche, J. (2006). Molecular identification and expression of differentially regulated genes of the European flounder, Platichthys flesus, submitted to pesticide exposure. Marine Biotechnology, 8(3): 275-294. Marcuschi, M., Espósito, T.S., Machado, M. F., Hirata, I.Y., Machado, M. F., Silva, M.V., ... & Bezerra, R. S. (2010). Purification, characterization and substrate specificity of a trypsin from the Amazonian fish
37
tambaqui (Colossoma macropomum). Biochemical and Biophysical Research Communications, 396(3): 667-673. Martin, T.K. e Tsui, L.M. Chu. (2003). Aquatic toxicity of glyphosate-based formulations: comparison between different organisms and the effects of environmental factors. Chemosphere, 52: 1189–1197. Maxwell, P.H., Dachs, G. U., Gleadle, J. M., Nicholls, L. G., Harris, A. L., Stratford, I. J., ... & Ratcliffe, P. J. (1997). Hypoxia-inducible factor-1 modulates gene expression in solid tumors and influences both angiogenesis and tumor growth. Proceedings of the National Academy of Sciences, 94(15): 8104-8109. McMahon, G., Huber, L. J., Stegeman, J. J., & Wogan, G. N. (1988). Identification of a c-Ki-ras oncogene in a neoplasm isolated from winter flounder. Marine Environmental Research, 24(1): 345-350.
Melstrom, L.G., Salabat, M. R., Ding, X.Z., Strouch, M.J., Grippo, P. J., Mirzoeva, S., ... & Bentrem, D. J. (2011). Apigenin down-regulates the hypoxia response genes: HIF-1α, GLUT-1, and VEGF in human pancreatic cancer cells. Journal of Surgical Research, 167(2): 173-181.
Michalani, Y.J. (1980). Técnica histológica em Anatomia Patológica, com instruções para o cirurgião, enfermeira e citotécnico. São Paulo: EPU. 277.
Mirande, J.M. (2010). Phylogeny of the family Characidae (Teleostei: Characiformes): from characters to taxonomy. Neotropical Ichthyology, 8(3): 385-568. Miyazaki, D.M.Y., Machado Neto, J.G., Castagnolli, N., (2004). Toxicidade aguda de triclorfon, partion metílico e glifosato para alevinos de tambaqui (Colossoma macropormum) e tambacu (C. macropormum X Piaractus mesopotamicus). In: Anais Encontro Brasileiro de Patologistas de Organismos Aquáticos (ENBRAPOA), Laguna. Maringá: Biblioteca Setorial da UEM. 8, 203. Modesto, K.A. e Martinez, C.B.R. (2010). Roundup
® causes oxidative stress in liver and inhibits
acetylcholinesterase in muscle and brain of the fish Prochilodus lineatus. Chemosphere, 78: 294–299. Moore, M. J., Smolowitz, R., Stegeman, J. J. (1989). Cellular alterations preceding neoplasia in Pseudopleuronectes americanus from Boston Harbor. Marine Environmental Research, 28(1-4): 425-429. Navarro, C.E.K.G. e Pachaly, J.R. 1994. Manual de hematologia veterinária. São Paulo: Varela. p. 74-75.
Nemoto, N., Kodama, K., Tazawa, A., Prince Masahito, Ishikawa, T. (1986). Extensive sequence homology of the goldfish ras gene to mammalian ras genes. Differentiation, 32: 17-23. Oliveira Ribeiro, C.A., Padrós, J., Valdez Domingos, F.X. , Akaishi, F.M., Pelletier, É. (2007). Histopathological evidence of antagonistic effects of tributyltin on benzo[a]pyrene toxicity in the Arctic charr (Salvelinus alpinus). Science of the Total Environment, 372: 549-553. Oliveira, A. M. Influência da temperatura ambiental e dos cenários climáticos futuros sobre os ácidos graxos ω-3 e ω-6 e desempenho zootécnico do tambaqui (Colossoma macropomum)/Alzira Miranda de Oliveira. Manaus: AM, 2014. xi+127p. Tese (doutorado) INPA, Manaus, 2014.Orientador: Dr. Adalberto Luís Val Área de concentração: Biologia de Água Doce e Pesca Interior. Passam, F. H., Alexandrakis, M. G., Kafousi, M., Fotinou, M., Darivianaki, K., Tsirakis, G., ... & Siafakas, N. M. (2009). Histological expression of angiogenic factors: VEGF, PDGFRα, and HIF-1α in Hodgkin lymphoma. Pathology-Research and Practice, 205(1): 11-20. Perugini, M., Visciano, P., Giammarino, A., Manera, M., Di Nardo, W., Amorena, M., (2007). Polycyclic aromatic hydrocarbons in marine organisms from the Adriatic Sea, Italy. Chemosphere, 66: 1904-1910.
38
Pfaffl, M.W. (2001). A new mathematical model for relative quantification in real-time RT PCR. Nucleic Acids Research, 29(9): 2003-2007.
Poleksic, V. e Mitrovic-Tutundžic V. (1994). Fish gills as a monitor of sublethal and chronic effects of pollution. IN: Müller, R.; Lloyd, R. Sublethal and chronic effects of pollutants on freshwater fish. Oxford: Fishing News Books. 30: 339-352.
Powell, W. H., & Hahn, M. E. (2002). Identification and functional characterization of hypoxia‐inducible
factor 2α from the estuarine teleost, Fundulus heteroclitus: Interaction of HIF‐2α with two ARNT2 splice
variants. Journal of Experimental Zoology, 294(1): 17-29. Pratilas, C. A. e Solit, D.B. (2010). Targeting the mitogen-activated protein kinase pathway: physiological feedback and drug response. Clinical Cancer Research, 16(13): 3329-3334. Pryor, S.C., e Barthelmie, R.J. (2010). Climate change impacts on wind energy: a review. Renewable and Sustainable Energy Reviews, 14(1): 430-437.
Rahman, M.S. e Thomas, P. (2007). Molecular cloning, characterization and expression of two hypoxia inducible factor alpha subunits, HIF-1a and HIF-2a, in a hypoxia tolerant marine teleost, Atlantic croaker (Micropogonias undulates). Gene, 396: 273-282. Reuther, G.W. e Der, C.J. (2000). The Ras branch of small GTPases: Ras family members don’t fall far from the tree. Current Opinion in Cell Biology, 12(2): 157-165. Radovanović, M.M., Ducić, V., & Mukherjee, S. (2014). Climate changes instead of global warming. Thermal Science, 18(3): 1055-1061. Rotchell, M.J., Lee J., Chipman, J.K. a Ostrander GK (2001) Structure, expression and activation of fish ras genes. Aquatic Toxicololy, 55:1-21.
Roy, N. K., Stabile, J., Seeb, J. E., Habicht, C., & Wirgin, I. (1999). High frequency of K‐ras mutations in
pink salmon embryos experimentally exposed to Exxon valdez oil. Environmental Toxicology and Chemistry, 18(7): 1521-1528. Rytkönen, K.T., Vuori, K. A., Primmer, C.R., & Nikinmaa, M. (2007). Comparison of hypoxia-inducible factor-1 alpha in hypoxia-sensitive and hypoxia-tolerant fish species. Comparative Biochemistry and Physiology Part D: Genomics and Proteomics, 2(2): 177-186. Sadauskas-Henrique, H., Duarte, R.M., Gagnon, M.M., & Almeida-Val, V.M.F. (2017). Validation of a suite of biomarkers of fish health in the tropical bioindicator species, tambaqui (Colossoma macropomum). Ecological Indicators, 73: 443-451. Saint-Paul, U. (1984). Physiological adaptation to hypoxia of a neotropical characoid fish Colossoma macropomum, Serrasalmidae. Environmental Biology of Fishes, 11(1): 53-62. Salazar-Lugo, R., Mata, C., Oliveros, A., Rojas, L.M., Lemus, M., Rojas-Villarroel, E. (2011). Histopathological changes in gill, liver and kidney of neotropical fish Colossoma macropomum exposed to paraquat at different temperatures. Environment Toxicology Pharmacology, 3: 490-495. Sancho, E., Cerón, J.J., Ferrando, M.D. (2000). Cholinesterase activity and hematological parameters as biomarkers of sublethal molinate exposure in Anguilla anguilla. Ecotoxicology Environment Saffety, 46: 81-86.
39
Schofield, C. J., e Ratcliffe, P. J. (2004). Oxygen sensing by HIF hydroxylases. Nature Reviews Molecular Cell Biology, 5(5): 343-354. Semenza, G. L. (2003). Targeting HIF-1 for cancer therapy. Nature Reviews Cancer, 3(10): 721-732. Semenza, G.L. (1999). Regulation of mammalian O2 homeostasis by hypoxia-inducible factor 1. Annual Review of Cell and Developmental Biology, 15(1): 551-578. Silva, A.G. (2004). Alterações histopatológicas de peixes como biomarcadores da contaminação aquática. Dissertação de Mestrado. Universidade Estadual de Londrina, Paraná.
Silva, J., Freitas, T.R.O., Marinho, J.R., Speit, G., Erdtmann, B. (2000). An alkaline single-cell gel electrophoresis (comet) assay for environmental biomonitoring with native rodents. Genetic and Molecula Biology, 23(1): 241-245.
Singh, N.P.; Mccoy, M.T., Tice, R.R. & Schneider, E.L.. (1988). A simple technique for quantitation of low levels of DNA damage in individual cells. Experimental Cell Research, 175:184-191.
Sogawa, K. e Fujii-Kuriyama, Y. (1997). Ah receptor, a novel ligand-activated transcription factor. Journal of Biochemistry, 122(6): 1075-1079. Soitamo, A.J., Råbergh, C.M., Gassmann, M., Sistonen, L., & Nikinmaa, M. (2001). Characterization of a Hypoxia-inducible Factor (HIF-1α) from Rainbow Trout accumulation of protein occurs at normal venous oxygen tension. Journal of Biological Chemistry, 276(23): 19699-19705. Soñanez-Organis, J.G., Rodriguez-Armenta, M., Leal-Rubio, B., Peregrino-Uriarte, A.B., Gómez-Jiménez, S., & Yepiz-Plascencia, G. (2012). Alternative splicing generates two lactate dehydrogenase subunits differentially expressed during hypoxia via HIF-1 in the shrimp Litopenaeus vannamei. Biochimie, 94(5): 1250-1260. Terova, G., Rimoldi, S., Cora, S., Bernardini, G., Gornati, R., Saroglia, M. (2008). Acute and chronic hypoxia affects HIF-1a mRNA levels in sea bass (Dicentrarchus labrax). Aquaculture, 279: 150-159. Tishkov, A. A. (2012). Biogeographical consequences of natural and anthropogenic climate changes. Biology Bulletin Reviews, 2(2), 132-140. Treinin, M., Shliar, J., Jiang, H., Powell-Coffman, J. A., Bromberg, Z., & Horowitz, M. (2003). HIF-1 is required for heat acclimation in the nematode Caenorhabditis elegans. Physiological Genomics, 14(1): 17-24. Thompson, E. D., Burwinkel, K. E., Chava, A. K., Notch, E. G., & Mayer, G. D. (2010). Activity of Phase I and Phase II enzymes of the benzo [a] pyrene transformation pathway in zebrafish (Danio rerio) following waterborne exposure to arsenite. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 152(3): 371-378. Tudoran, M.A. e Putz, M.V. 2012. Chem Bull ‘‘Politehnica” Univ (Timisoara) 57 (71): 1 Val, A.L., Gomes, K.R.M., & de Almeida-Val, V.M.F. (2015). Rapid regulation of blood parameters under acute hypoxia in the Amazonian fish Prochilodus nigricans. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology, 184: 125-131. Val, A.L. e Honczaryk, A. (1995). Criando peixes na Amazônia. Manaus: INPA (Editor), Manaus, Brasil. p.160. Val, A.L. and Almeida-Val, V.M.F. (1995). Fishes of the Amazon and their environment: physiological and biochemical features. Heidelberg: Springer-Verlag. 244pp.
40
Val, A.L., Wood, C.M., Wilson, R.W., Gonzalez, R.J., Patrick, M.L., Bergman, H.L., & Narahara, A. (1998). Responses of an Amazonian teleost, the tambaqui (Colossoma macropomum), to low pH in extremely soft water. Physiological and Biochemical Zoology, 71(6): 658-670. Val, A.L., (1995). Oxygen transfer in fish: morphological and molecular adjustments. Brazilian Journal of Medical and Biological Research, 28: 1119-1127. Varanasi, U., Stein, J.E., Nishimoto, M., 1989. Biotransformation and disposition of polycyclic aromatic hydrocarbons (PAH) in fish, in: Varanasi, U. (Ed.), Metabolism of Polycyclic Aromatic Hydrocarbons in the Aquatic Environment, CRC, Boca Raton, FL, pp. 94-149. Vásquez, K.L. Ontogenia das enzimas digestivas do tambaqui, Colossoma macropomum (CUVIER, 1818): subsídios para a aquicultura/Katherine López Vásquez. Manaus: AM, 2009. Tese (doutorado), Manaus, 2009.Orientador: Dr. Adalberto Luís Val Área de concentração: Biotecnologia. Vincent, F., Boer, J., Pfohl-Leszkowicz, A., Cherrel, Y., Galgani, F., (1998). Two cases of ras mutation are associated with liver hyperplasia in Callionymus lyra exposed to polychlorinated biphenyls and polycyclic aromatic hydrocarbons. Molecular Carcinogenesis, 21: 121–127. Virani, N.A., Rees, B.B. (2000). Oxygen consumption, blood lactate and inter- individual variation in the gulf killifish, Fundulus grandis, during hypoxia and recovery. Comparative Biochemical and Physiology A, 126: 397-405. Wang, C.D., Zhang, F.S. (1995). Effect of enviromental oxygen deficiency on embryos and larvae of bay scallop Argopecten irradians. Chinise Journal of Oceanolgy and Limnology, 13: 362-369. Wang, G.L., Jiang, B.H., Rue, E.A., Semenza, G.L. (1995). Hypoxia-inducible factor 1 is a basic helix–loop–helix–PAS heterodimer regulated by cellular O2 tension. Proceedings of the National Academy of Science, 92: 5510-5514. Wang, G.L., Semenza, G. (1993). Characterization of hypoxia-inducible factor 1 and regulation of DNA binding activity by hypoxia. Journal of Biological Chemistry, 268: 21513-21518. Weisberg, S. B., Thompson, B., Ranasinghe, J. A., Montagne, D. E., Cadien, D. B., Dauer, D. M., …& Word, J. Q. (2008). The level of agreement among experts applying best professional judgment to assess the condition of benthic infaunal communities. Ecological Indicators, 8(4): 389-394. Wenger, R.H., Kvietikova, I., Rolfs, A., Gassmann, M., Marti, H.H. (1997). Hypoxia inducible factor-1 alpha is regulated at the post-mRNA level. Kidney International, 51: 560-563. WHO – International Programme on Chemical Safety Glyphosate, 1994. Environmental Health Criteria 159 – Glyphosate. Williams, G.M., Kroes, R., Munro, I.C. (2000). Safety evaluation and risk assessment of the herbicide Roundup and its active ingredient, glyphosate, for humans. Regulatory Toxicology and Pharmacology, 31: 11-165. Zhong, H., De Marzo, A.M., Laughner, E., et al. (1999). Over expression of hypoxia-inducible factor 1a in common human cancers and their metastasis. Cancer Research. 59: 5830-5835.
41
Capítulo I
Ras oncogene and Hypoxia-inducible factor-1 alpha (hif-1α) expression in Amazon fish
Colossoma macropomum (Cuvier, 1818) exposed to benzo[a]pyrene.
Artigo aceito pela revista Genetics and Molecular Biology
42
Title
Ras oncogene and Hypoxia-inducible factor-1 alpha (hif-1α) expression in Amazon fish
Colossoma macropomum Cuvier, 1818 exposed to benzo[a]pyrene.
Running title
Ras hif-1α gene expression in fish
Author names and affiliations
Grazyelle Sebrenski da Silva1,2, Luciana Mara Lopes Fé1, Maria de Nazaré Paula da
Silva1, Vera Maria Fonseca de Almeida e Val1
1Laboratory of Ecophysiology and Molecular Evolution (LEEM), Brazilian National
Institute for Research in the Amazon (INPA). 69067-375 André Araújo Avenue, 2936,
Petrópolis. Manaus, AM, Brazil.
2Institute of Biological Science (ICB) in Amazon Federal University (UFAM), General
Rodrigo Octávio Ave, 6200, Coroado I. AM, Brazil
E-mail address:; L.M.L. Fé (lucianamlfe@gmail.com); M.N.P. da Silva
(npaula@inpa.gov.br); V.M.F. de Almeida e Val (veraval30@gmail.com).
Corresponding author: G.S. Sebrenski
Phone number: +55 92 3643 3188
E-mail address: grazysebrenski@hotmail.com
Postal address: André Araújo Avenue, 2936, Petrópolis, 69067-375. Manaus, AM,
Brazil
43
Abstract
Benzo[a]pyrene (B[a]P) is a petroleum derivate, who is capable to induce cancer
in human and animals. In this work, under laboratory conditions, we analyzed the
responses of Colossoma macropomum to benzo[a]pyrene acute exposure through
intraperitoneal injection of corn oil (control group) and four different B[a]P
concentrations (4 mol/kg, 8 mol/kg, 16 mol/kg and 32mol/kg). We aimed to
describe the changes in expression of ras oncogene and Hypoxia-inducible factor-1
alpha (hif-1α) gene. We assessed ras and hif-1α gene expression trough quantitative
real-time PCR (RT-PCR). Additionally, we obtained the liver histopathological changes
and genotoxic effects through Comet Assay. Ras gene was overexpressed in fish
exposed to 4 mol/kg, 8 mol/kg of 16 mol/kg of B[a]P, showing 4.96-fold, 7.10-fold
and 6.78-fold increases, respectively. Also, overexpression occurred in hif-1α in fish
injected with 4 mol/kg and 8mol/kg of B[a]P showing 8.82-fold, 4.64-fold increase,
respectively. Histopathological damage on the fish liver were classified as irreparable in
fish exposed to 8mol/kg, 16mol/kg and 32mol/kg μM of B[a]P. The genotoxic
damage increased in fish injected with 8mol/kg and 16mol/kg in comparison with the
control group. In acute exposure, B[a]P was capable to disrupt the expression of ras
oncogene and hif-1α, increase the DNA breaks and tissue damage.
Key words: Ras oncogene, hif-1, Colossoma macropomum, benzo[a]pyrene (B[a]P).
44
1. Introduction
Polycyclic aromatic hydrocarbons (PAHs) belong to a class of petroleum derivates
with high carcinogenic, mutagenic, and genotoxic potential (Buhler and Williams, 1989,
Vienneau et al., 1995, Tsukatani et al., 2003). PAHs are considered relevant threats to
aquatic environments and are common contaminants in industrialized areas, mainly
affecting inland and coastal water bodies, where organically enriched sediments or
suspended particles may occur (Harris et al., 1985, Meador et al., 1995). PAHs
contaminants can arise from natural sources, such as oil seeps, volcanoes, and forest
fires, or from anthropogenic sources as burning fuel, power generation, and oil spill
(Latimer and Zheng, 2003).
Benzo[a]pyrene (B[a]P) is the most dangerous PAH, classified as Group 1
substance by the International Agency for Research on Cancer (IARC) (IARC, 2012).
BaP is an immunosuppressive and pro-inflammatory agent, known as one of the most
potent carcinogen (Pryor et al., 1993, Jaakkola et al., 1997). To accomplish its
carcinogenic action, B[a]P breaks into reactive intermediates that covalently bind to
DNA and cause a guanine (G)-thymine (T) transversion (Conney et al., 1994).
The effects of benzo[a]pyrene contamination have been studied in different groups
of organisms such as fish (Padrós et al., 2003), snail (Sánches-Arguello et al., 2012),
and mouse (Gao et al., 2008). Fish absorb PAHs from water via their body surface or
gills, and also ingesting contaminated food or sediment (Varanasi et al., 1989). In fish,
exposure to PAHs results in the induction of enzymatic systems involved in the
metabolism of xenobiotic compounds to detoxify the organism (Buhler and
Williams1989). Additionally, histological alterations in the liver of fish exposed to B[a]P
occurred too. Oliveira-Ribeiro and co-workers (2007) described degenerative lesions,
nuclear pleomorphism, pre-neoplastic proliferative conditions and necrosis as typical
lesions in the fish liver. Due to strikingly similar histopathological features between fish
and human tumors, fish have been used as models in cancer research (Lam et al.,
2006).
45
Recently, gene expression profiling has attracted researchers as a mean of
comparing the molecular features of tumors among different vertebrate species
(Grabher and Thomas, 2006). For instance, rainbow trout (Oncorhynchus mykiss) has
many advantages as study model to access human carcinogenesis. These
characteristics include the effects of polycyclic aromatic hydrocarbons (PAHs) (Bailay et
al., 1987, Bailay et al., 1996) and the responses of some genes as ras oncogenes
(Rotchell et al., 2001).
Ras genes encode proteins that play a central role in cell growth signaling
cascades. To date, several ras genes are characterized in fish, and have a high degree
of similarity with mammals nucleotide and deduced amino acid sequences. In fact,
some species of fish have been used as models to understand ras genes behavior and
their homology with human genes (Rotchell et al., 2001). Goldfish (Carassius auratus)
was the first fish to have its ras gene studied (Nemoto et al., 1986). After the goldfish,
other fish species were investigated such as rainbow trout (Mangold et al., 1991),
zebrafish (Danio rerio) (Cheng et al., 1997), and medaka (Oryzias latipes) (Rotchell et
al., 2001).
Another gene related to cancer development is the Hypoxia-inducible factor-1
alpha (hif-1α), which produces the protein (HIF-1) that is the major regulator of oxygen-
dependent gene expression (Maxwell et al., 1997, Rytkönen et al., 2008, Fraga et al.,
2009, Maxwell, 2005). The levels of hif-1α expression are associated with tumor
genesis and angiogenesis (Zhong et al., 1999). Although hif-1α has been mostly
associated with hypoxic responses in fish, tumor cells hypoxia is also a well-studied
system (Geng et al., 2014). Tumor investigation is now seen as an integral part of the
basic biological approach to elucidate the common mechanisms of cancer at different
phylogenetic levels (Van Beneden et al., 1990).
In Brazil, one of the largest freshwater fish species is the tambaqui (Colossoma
macropomum). This species belongs to the Serrasalmidae family and is endemic to the
Amazon basin. It is found mainly in rivers, and in floodplain lakes (Várzea Lakes)
(Marcuschi et al., 2010). In Amazon Basin, tambaqui is one of the most important
46
commercial fish (Val and Honczaryk, 1995); it presents many characteristics that make
it an appropriate bioindicator species in biomonitoring programs (Salasar-Lugo et al.,
2011).
Herein, we report the acute effects of B[a]P injections in tambaqui on ras oncogene
expression as well as on hif-1α gene expression. We used fish liver to investigate gene
expression and tissue histopathology damages, and peripheral blood to investigate the
genotoxic effects of B[a]P throughout the DNA damages.
2. Material an Methods
2.1 Animals
Juveniles of C. macropomum (24.76 g ± 5.45; 10.50 cm ± 0.64) were purchased
from a local fish farm nearby Manaus city (Santo Antônio Farm: 02º44'802''S;
059º28'836''W), Amazon State (Brazil). Fish were transported to the Laboratory of
Ecophysiology and Molecular Evolution at the Brazilian National Institute for Amazon
Research (LEEM - INPA). Fish were held indoors in fish tanks supplied with
recirculating aerated INPA’s groundwater ([Na+], 0.83; [K+], 0.45; [Ca2+], 0.10; [Mg2+],
0.040; [Cl-], 0.90 mgl-1; [Cu2+], 7.0 g l-1; hardness=1.33 mg CaCO3 l-1; pH= 6.80); and
fed once a day with commercial feed containing 36% protein. Fish were monitored daily
during the acclimation period (7 days).
2.2 Experimental Design
After the first acclimation period, 15 animals were transferred to each of the six
plastic tanks (70 L capacity) containing water with constant aeration. Fish were, then,
allowed to acclimate in these tanks for, at least, seven days before beginning the tests.
Physicochemical parameters were measured over the course of the experiment using a
digital oxygen meter YSI (Yellow Springs Instruments) model 55/12-155 for temperature
(26.05 oC ±0.23) and dissolved oxygen (7.45 mg/l ± 0.21). A digital pH-meter
UltraBASIC UB-10 (Denver 156 Instrument) was used to measure the pH (5.75 ± 0.16).
47
After one-week acclimation, feeding was suspended, and fish starved 24 h
before starting the acute experiment (96 h). Before the acclimation period, each fish
was weighed and measured, to calculate the amount of pollutant intraperitoneally
injected. Each fish received the volume of injection, in accordance with the weight.
Independent of the treatment, the volume of the vehicle (corn oil) injected was the same
in the fish with de same weight (0,01 ml/g). We followed the recommended protocols
described at the Brazilian Guides of Animal Care and Use, and as required by the
Ethics Committee on Animal Use of the National Institute for Research in the Amazon
(CEUA – INPA) (Protocol Number 011/2013). We used five treatments for the whole
experiment: (1) control group, where fish was injected with corn oil; and other four
treatments, where fish was injected with the solution containing corn oil as vehicle and
four concentrations of B[a]P as follows: (2) 4mol/kg B[a]P, (3) 8mol/kg B[a]P, (4)
16mol/kg B[a]P, and (5) 32mol/kg B[a]P. Before receiving the injection, animals
were anesthetized on ice, and after recover, fish were kept in the tanks for 96 h after the
injection. After this period, blood was sampled with a heparinized syringe from the
caudal vein, and then each fish was euthanized through cerebral concussion followed
by severing the anterior spinal cord. After death, the fish liver was dissected, and one
portion was snap-frozen in liquid nitrogen and stored at −80 °C. The other liver part was
fixed in Alfac solution as described below, for histopathology analysis through light
microscopy.
2.3 Histopathology analysis of liver
To prepare the samples for analyzes at light microscopy, six liver samples from
each treatment were immediately fixed in Alfac solution (70% ethanol, 5% glacial acetic
acid, and 4% formaldehyde) for 15 h, dehydrated in a graded series of ethanol, and
embedded in Paraplast Plus® (Sigma). Sections of 5 μm were obtained, stained with
Hematoxylin/Eosin and observed under the bright field microscope. Samples were
analyzed at 40x in the optical microscope.
Histopathological alterations index (HAI) were semi-quantitatively evaluated
using the method described by Poleksic and Mitrovic-Tutundsic (1994). Indexes based
48
on the severity of lesions were used to asses liver tissue changes: I = ∑ I + 10 ∑ II +
100 ∑ III, where stages I, II, and III correspond to the degree of the lesion, respectively.
The final Index was described as follows: the normal function of the organ (I = 0-10),
the mild to moderate damage (I = 11-20), the moderate to the severe (I = 21-50), severe
(I = 51-100), and irreparable damage (I >100).
2.4 Comet assay in blood cells
We quantified the DNA damage in blood cells using the comet assay as
described by Singh et al. (1988), and modified by Silva et al., (2000). Two comet
microscope slides for ten fish from each treatment were prepared with standard melting
agarose (1.5% normal melting agarose prepared in phosphate-buffer saline (PBS)) and
dried overnight. Five microliters of whole fish blood were mixed with 0.75% low melting
point agarose at 5% ratio (Gibco BRL) at 37 ºC and immediately poured on pre-covered
slides. Each slide was covered with a coverslip until the agarose solidified. After the
agarose gel has solidified the coverslip was gently removed, and the slides were placed
in a lyses solution consisting of high salts and detergents (2.5 M NaCl, 100 mM EDTA,
10 mM Tris, pH 10-10.5; 1% Triton X-100 and 10% DMSO). Before electrophoresis, the
slides were incubated for 20 min in alkaline electrophoresis buffer (300 mM NaOH and
1 mM EDTA, pH >13) to produce single stranded DNA. After alkali unwinding, the
single-stranded DNA was electrophoresed in the gels in a dark place under alkaline
conditions for 20 min at 300 mA and 25 V at 4 °C to produce the comets. After
electrophoresis, we rinsed the slides with a suitable buffer (0.4 M Tris buffer, pH 7.5) to
neutralize the alkalis in the gels. Finally, the DNA staining was revealed with silver
solution (5% sodium carbonate, 0.1% ammonia nitrate, 0.1% silver nitrate 0.25%
tungstosilicic acid and 0.15% formaldehyde). Slides were examined using an optical
microscope (Leica DM2015) at 400X of magnification. Randomly selected cells (100
cells from each of two replicate slides) were analyzed for each animal. We used the tail
sizes to score the comet assay into five classes (from undamaged (zero) to maximally
damage (four)). An overall score was obtained by summation of all cell scores from
49
completely undamaged (sum zero) to maximum damage (sum 400) according to
Kobayashi et al. (1995).
2.5 Isolation of total RNA and cDNA synthesis
Isolation of total RNA from four tambaqui liver of each treatment followed the
TRIzol® reagent protocol (InvitrogenTM, Cat. No 15596-018) according to the
manufacturer’s instructions. Contaminating genomic DNA was removed using DNase I
(Invitrogen™).
First strand cDNA was reverse-transcribed from the total RNA using RevertAid H
Minus First Strand cDNA Synthesis kit (Fermentas®), and following the manufacturer's
instructions. Enzymatic treatment with reverse transcriptase (MMLV Reverse
Transcriptase) (200 U/μL, USB) was first done and, then, mixed in a 1.5 mL microtube
with approximately 25 μg RNA, 1,0 μL oligonucleotide dT(18) (1 μg), 1,0 μL dNTP mix
(10 mM), buffer 5X MMLV, and deionized for a 50 mL final volume. This solution was
incubated at 37 °C for 1 hour for conversion and 70 °C for 10 minutes to inactivate the
enzyme.
2.6 Determination of ras and hif-1sequences
Degenerate primers were designed based on the conserved regions of 28S, ef-
1α hif-1α and ras genes described in NCBI for other fish species
(http://www.ncbi.nlm.nih.gov). We used these primers to obtain partial fragments of
tambaqui hif-1α and ras cDNAs. The PCR (Polymerase Chain Reaction) was performed
using PCR master mix (Promega). All PCR products were sequenced with Kit ABI
PRISM® Big DyeTM Terminator Cycle Sequencing Ready Reaction (Applied
Biosystems) and run on an ABI 3130XL automatic DNA sequencer (Applied
Biosystems). The acquired sequences were analyzed using the BLAST program from
NCBI and then used to generate the specific primers for Colossoma macropomum q-
PCR, ras, hif-1α (target primers), 28S, and ef-1α (reference primers) showed in Table1.
50
2.6 Quantitative real-time PCR
We used the equipment Viia7 Dx from Life Technologies (Applied Biosystems) to
quantify the gene transcripts by real-time PCR. We analysed samples of four C.
macropomum liver from each treatment. We added 1.0 μL of cDNA as template, in
triplicate, to the wells of a 96-well thin-wall PCR plate. Additionally, we added to each
well 1.0 μL of each primer (concentration of ras, 2.0 pmol; hif-1α, 2.0 pmol, 28S, 2.5
pmol and ef-1α, 1.5 pmol), 2.0 μL of nuclease-free water 192 (Ambion, Life
Technologies) and 5 μL SYBR Green PCR Master Mix (Applied Biosystems) in a total
volume of 10 μL. The PCR plate was heated for 2 min at 50 °C, plus 95 °C for 10 min;
followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min (annealing temperature of all
primers). The presence of a single product-specific melting temperature was confirmed
using melting curve analysis, as follows: 28S (slope -3.36/ R2 0.99), ef-1α (slope -.3.34/
R2 0.99), ras (slope -3.33/ R2 0.97) and hif-1α (slope -3.20/ R2 0.99). In addition, PCR
amplification efficiency for each primer set was calculated by serial dilution curve
obtained from a pool of experimental samples (1000 to 1 ng cDNA concentration; n=4).
All primer pairs showed high PCR efficiency (between 98-105%). The efficiency of
primer amplification was calculated. Serial dilutions of a cDNA standard were amplified
in each run to determine amplification efficiency according to Pfaffl (2001).
2.7 Statistic analysis
All data is presented as mean ± S.E.M. (Standard Errors of Means); gene
expression, histopathology and Comet Assay were analyzed by one-way analysis of
variance (ANOVA) to determine the differences between the treatments and control
group. When the data violated the premises of one-way ANOVA test, Kruskal-Wallis
One Way Analysis of Variance on Ranks test was applied. Statistical significance was
accepted at the level of P< 0.05. Statistic analysis was performed using the statistical
program Sigma Stat 3.5.
51
3. Results
The liver of C. macropomum has similar morphological structure presented by
other fish species, as observed in liver slides of fish from the group control. This group
exhibited mild to moderate damage as the classification in histopathological analyses
recommends (Figure 1A) (Poleksic and Mitrovic-Tutundsic, 1994). A healthy liver
presents polygonal hepatocytes with very prominent central nuclei. Hepatocytes are
arranged into two cells thick cords surrounded by sinusoidal epithelial cells (Figure 1 B)
(Genten et al., 2009). Damage classes of all fish groups exposed to 8, 16, and 32
mol/kg of BaP were irreparable, HAI (Poleksic and Mitrovic-Tutundsic, 1994).
We observed cytoplasm vacuolization, cell hypertrophy, nuclei hypertrophy, and
parenchyma disorganization in all treatments with B[a]P (Figure 1). Severe cytoplasm
vacuolization occurred in the liver of fish exposed to 32mol/kg of B[a]P; small
vacuoles appeared in the cellular cytoplasm and subsequently fused to form a larger
vacuole. As a consequence, the cell vacuoles forced cytoplasm and nuclei to the
periphery of the cell. We also observed infiltration of leucocytes as an inflammatory sign
in all exposed fish. Altered hepatocytes presented cytoplasm degeneration
accompanied by an alteration in shape and size, losing their characteristic polyhedric
shape and frequently showing hypertrophy (Figure 1F). Plasmatic membrane rupture
was common in fish submitted to B[a]P injection. This was evident in fish exposed to 8,
16, and 32mol/kg of B[a]P. These groups also presented focal necrosis in almost all
animals (Figure 1D).
Observing the HAI (Histopathological Alteration Index) described by Poleksic and
Mitrovic-Tutundsic (1994), the occurrence of tissue liver damage was evident in fish
exposed to the higher B[a]P concentrations; 8, 16, and 32mol/kg of B[a]P (HAI=
142.80 ± 2.6, 146.16± 3.09, and 102.16 ± 20.89, respectively) (Figure 2).
Genetic Damage Index (GDI), measured throughout the Comet Assay, was
induced in the acute experiment (96 h) with B[a]P. Exposure to B[a]P caused a
significant genotoxic effect in C. macropomum exposed to 8mol/kg (GDI = 264% ±
5.66 ) and 16mol/kg (GDI = 266% ± 27.31), in comparison with control. No difference
52
occurred in fish exposed to 32mol/kg of B[a]P (112.35%± 12.16) compared to the
control group (Figure 3).
We observed an increase in the gene expression of ras oncogene in C.
macropomum exposed 96h to 4mol/kg, 8mol/kg, and 16mol/kg B[a]P in
comparison to the control (Figure 4). Ras oncogene was overexpressed approximately
4.96-fold in fish exposed to 4mol/kg of B[a]P, 7.10-fold in fish exposed to 8mol/kg
and 6.78-fold in fish exposed to 16mol/kg of B[a]P. No difference was observed in the
expression of ras in 32mol/kg of B[a]P.
The expression of hif-1α increased in the lowest concentrations of the
contaminant, approximately 8.82-fold in fish injected with 4mol/kg of B[a]P and
approximately 4.64-fold in fish injected with mol/kg of B[a]P in comparison with the
control group (Figure 5). However in the higher concentration of B[a]P (16 mol/kg and
32mol/kg), the expression of hif-1 was similar with the control group.
3. Discussion
Histopathological liver damage caused by exposure to B[a]P and petroleum
derivates are largely described in the literature (Costa et al., 2010, Moller et al., 2014).
In this context, liver is one of the most important organ to be addressed, since it is
responsible for the detoxification process in the organism, and it is the primary organ of
biotransformation of organic xenobiotics (Health, 1995, Hinton et al., 2001, Rojo-Nieto
et al., 2014).
The liver histopathology of C. macropomum fish exposed to different
concentrations of B[a]P shows an increase of tissue injuries in fish according with the
rise of the levels of the pollutant (8mol/kg 16mol/kg and 32mol/kg of B[a]P). In all
treatments was observed cellular vacuolization , and these damage were also observed
in the liver of the juvenile rabbit fish (Siganus canaliculatus) exposed to water soluble
fraction (WAF) of light Arabian crude oil (Agamy, 2012). Many investigations have
showed that focal, multifocal and diffuse vacuolar degeneration of hepatocytes can be a
result of fish exposure to a variety of different carcinogenic agents (Couch, 1975,
53
Mathur, 1975, Stehr et al., 1998, Nero et al., 2006, Stendiford et al., 2014). We also
detected cell hypertrophy, followed by the loss of polyedric shape, inflammatory focus
with leucocytes infiltration, cytoplasmic degeneration, and parenchyma disorganization
in these fish. Agamy (2012) described hepatocytes with marked nuclear enlargement
and moderate cellular enlargement, accompanied by an alteration in shape and size,
losing their common polyedric shape and frequently presenting hypertrophy in the liver
of juvenile rabbit fish exposed to the oil water accommodated fraction (WAF).
Malmstrom et al. (2004) verified a massive infiltration with inflammatory cells in rainbow
trout (Oncorhynchus mykiss) and cytoplasmic vacuolization in flounder (Platichthys
flesus) injected intraperitoneally with B[a]P. Multifocal inflammatory lesions on the liver
were recognized in other two teleosts, Atlantic cod (Gadus morhua) and flounder
(Platichthys flesus), caged for three months on contaminated sediments in a Norwegian
fjord (Husoy et al., 1996).
Liver hepatic parenchyma disorganization observed appears to be correlated with
the majority of PAHs (Rojo-Nieto et al., 2014). In our study, the lesions observed in C.
macropomum liver were, once more, associated with PAH injection, indicating the
extreme toxic potential of this compound to aquatic animals. This is more evident with
the hepatocytes focal necrosis observed in most of C. macropomum livers after
treatments with B[a]P. Agamy and colleagues (2012), studying rabbit fish (Siganus
canaliculatus) exposed to dispersed oil for six days found hepatocyte necrosis and
cellular swelling on the fish liver, which became larger with increased time of exposure.
In another study with eelpout (Zoarces viviparus) collected in different polluted areas,
necrosis and degeneration were observed and the cellular structure was no longer
maintained, with eosinophilic cytoplasm elements and free pyknotic nuclei being visible
within the liver section (Fricke et al., 2012). As observed in the present work, Albedel-
Moneim et al. (2012) also described the foci of local hepatic tissue necrosis
characterized by entirely destroyed hepatic tubules and, in most cases, no hepatic
cellular structure. Concerning this study, we observed that some fish also contained
lysed hepatocytes remnants. Thus, we can suggest that acute exposure to this pollutant
induced liver damages impairing liver normal function in these animals.
54
The analysis of DNA damage in aquatic organisms has been considered a highly
suitable method for evaluating the genotoxic contamination of environments. In general,
this method is considered advantageous because it detects and quantifies the genotoxic
impact without requiring a detailed knowledge of the identity or the physical/chemical
properties of the contaminants (Frenzilli et al., 2009). Numerous studies show DNA
strand break using the Comet Assay in different animals models (Lemiere et al., 2005,
Lacaze et al., 2010, Michel et al., 2013). In this study, the Comet Assay indicates DNA
damage (Genetic Damage Index –GDI) in C. macropomum blood cells in fish injected
with 8mol/kg and 16mol/kg of B[a]P in comparison with the control. No significant
differences were found among groups injected with corn oil, 4mol/kg, and 32mol/kg
B[a]P. This less of difference between the highest dose of B[a]P in comparison with the
control group can be explained by the release of new erythrocyte cells due to the high
concentration of the pollutant, which is a more costly defense for the body. Also,
mechanisms of DNA repair in erythrocyte may have been activated. Our results are in
accordance with those of Jeong et al. (2015). These authors examined the degree of
DNA damage caused by three fractions (aliphatic hydrocarbons, aromatic
hydrocarbons, and polar compounds) of the organic extract of sediments taken from
Taean (Korea) in beakfish (Oplegnathus fasciatus). The DNA damage level was the
highest in cells exposed to 1.00 mg/g dry weight (dw) followed by the 1.09 mg/g dw and
0.72 mg/g dw to PAH. Studying DNA damage in gill and liver of carp and rainbow trout,
Kim and Hyun (2006) observed similar results. In their study the level of damage was
very low during the initial 24 h exposure to B[a]P and increased dramatically during the
next 24 h and, then, gradually decreased until 96h. The same results were observed by
Curtis et al (2011) in rainbow trout exposed to B[a]P, where damage to blood cell DNA
increased in fish fed a diet contaminated with BaP after 14 and 28 days compared to
controls. In our study the DNA damage in fish injected with intermediary concentration
of B[a]P was higher, so future investigation concerning gene repair mechanisms will
help to understand the decrease in DNA damage in fish injected with higher amounts of
B[a]P.
Another way to evaluate the effects of some pollutants as carcinogenic inducers
is through the alteration on the expression of some genes or mutation (Ostrander and
55
Rotchell, 2005). The oncogene ras is considered one of the most important genes
involved in carcinogenesis. Such gene was characterized in several fish species, and
the presence of ras mutations has already been described in fish populations inhabiting
hydrocarbon contaminated areas, and following experimental exposure to specific
contaminants (Nogueira et al., 2006). In the present study, the changes in the
expression of ras oncogene transcripts in C. macropomum revealed an overexpression
of the gene in livers of fish treated with 4, 8, and 16mol/kg of B[a]P. When we
compare these data with DNA damage in erytrocytes, we observed significant
differences in the DNA damage only at concentrations of 8mol/kg and 16 mol/kg of
B[a]P. This suggests that the oncogene ras is expressed even at low concentration of
the contaminant and the DNA damage are more significant only when animals are
subjected to higher concentrations. However, at concentrations of 8 and 16 mol/kg
DNA damage and oncogene ras respond similarly to the presence of the contaminant.
Nogueira et al. (2010), studying Dicentrarchus labrax and Liza aurata in a contaminated
coastal lagoon polluted by PAH, observed no differences in the expression levels of ras
oncogene among fish from different sites. Similar results were found in Anguilla anguilla
exposed to 0.1 and 0.3 μM of B[a]P, where the analysis of ras oncogene in the same
samples revealed no differences in levels of expression between control and exposed
fish (Nogueira et al., 2006). In another study with mussels (Mytilus galloprovencialis)
collected in sites with different levels of petrochemical contamination along the NW
coast of Portugal, the expression of ras oncogene in digestive gland and gonads
decreased in PAH-contaminated animals. These authors also found similar results in
fish exposed to 100% water accommodated fraction (WAF) (Lima et al., 2008).
According to Rotchell et al. (2001), the pattern and incidence of ras oncogene mutations
in environmentally induced tumors also appear to be species-specific in fish. Tumors
wasn`t observed in tissue liver analyzes in this study, but we described in
histopathology analizes characteristics that with longer exposure may lead to tumor
formation as inflammatory focus (Grivennikov et al., 2010). Moreover, overexpression of
the ongene ras is one of the mechanisms that implicates carcinogenesis (Nogueira et
al., 2006).
56
Another gene related with cancer is the hypoxia-inducible factor 1 alpha (hif-1α),
which has been identified as a key regulator of angiogenesis, inflammation, and
anaerobic metabolism (Dehne and Brune, 2009). Importantly in the past few years, hif-
1α has been implicated in the development of a range of liver pathologies such as liver
fibrosis, activation of the immune system, hepatocellular carcinoma, and others in
humans, as well as in rodents (Semenza et al., 2012, Nath et al., 2012). In humans,
many studies have emphasized the metastasis process in solid tumors induced by the
expression of hif-1α (Schweiki et al., 1992, Melstrom et al., 2011). Most hypoxia studies
have been focused on mammalian systems (Taylor and Sivakumar, 2005). However,
hypoxia is a common phenomenon for fish. In fish, the majority of the studies describe
the behavior of hif-1α in hypoxic environmental condition, not considering the combined
effect of hypoxia and pollution (Terova et al., 2008).
In the present study, the hypoxia would not be an extra challenge to C.
macropomum, but the challenge was the contaminant (B[a]P). We observed that hif-1α
expression increased 8.82-fold and 4.62-fold in fish exposed to 4mol/kg and 8mol/kg
of B[a]P, respectively, in comparison with fish injected with corn oil. The greatest
expression of hif-1α was in the lowest concentration of B[a]P, showing that the
hepatocytes was capable to activate the transcription of this gene, helping to maintain
cell survival machinery, one evidence of this is that the literature relate hif-1α involved
in cell proliferation and survival (Siddiq et., 2007). At the highest concentration of B[a]P
the cellular machinery was already compromised with the cell damage, not being able to
increase the expression of hif-1, since the normal functioning of the liver was
committed by necroses. Yu et al. (2008) suggested that the application of xenobiotics
such as B[a]P to hypoxia-stressed fish induces the increase in HIF-1-mediated
transcription, particularly in xenobiotic-metabolizing organs such as liver. The orange-
spotted grouper (Epinephelus coioides) was examined upon single and combined
exposures to hypoxia and benzo[a]pyrene (BaP). The responses for the four hypoxia-
responsive (HIF-1-mediated) genes – igfbp (insulin-like growth factor binding protein),
epo (erythropoietin), ldh-a (lactate dehydrogenase a isoform) and vegf (vascular
endothelial growth factor) – in fish liver tissues were monitored at four different time
intervals using real-time qPCR. The authors showed that B[a]P did not alter the
57
expression of these four genes throughout the course of the exposure to normoxic
conditions, although when combined with hypoxia, the pollutant caused the activation of
these genes in some concentrations. Under hypoxia, these genes were very
responsive. In fact, hif-1α gene is the transcription factor of more than 100 genes,
including genes responsible for immune processes and inflammation of cells (Yu et al.,
2008).
This is the first time that one study combines the one oncogene ras and hif-1α
gene, in a neotropical freshwater fish (C. macropomum) under acute exposure to B[a]P
at normoxic conditions. In gene expression and Comet Assay analyzes the results
showed a full bell shape dose-response, where we observed an increase of the gene
expression and DNA breaks in erytrocytes in 4mol/kg, 8mol/kg and 16mol/kg of
B[a]P, and a decrease of this responses in the higher concentration (32mol/kg of
B[a]P). This response to PAHs was showed by Bosveld and collaborators (2002) in their
study with ethoxy resorufin dealkylase (EROD) activity measured in the H4IIE rat
hepatoma in vitro bioassay. This authors observed a category of compounds
(indeno[1,2,3-cd]pyrene (IP), benz[a]anthracene (BaA), benzo[a]pyrene (B[a]P),
chrysene (Chr) and benzo[k]fluoranthene (BkF) who consists of strong responders that
show a full bell shaped dose–response relationship over a wide dose-range and with a
strong increase of EROD activity. Lu et al. (2009) also observed a bell-shape dose
response in their study with Carassius auratus in response to PAH, indeno[1,2,3-
cd]pyrene via intraperitoneal injection at dosages of 0.1, 1.0, 2.0, 5.0 and 10.0 (or 8.0)
mg/kg. The EROD activity at the highest dosage of indeno[1,2,3-cd]pyrene (10,0mg/kg)
resulted a decrease of fold induction, and glutathione S-transferase (GST) activity had
the same behavior. Bell-shaped curves have been reported for various in vitro and in
vivo systems after exposure to PAHs (Kennedy et al., 1996, Delesclue et al., 1997).
The majority of the works with ras genes is described for human (Maertens and
Cichowski, 2014). The studies with hif-1α are not different, they describe the expression
of the gene in human solid tumors, and in metastasis (Fraga and Medeiros, 2009), or
when they study this gene in fish species they explain its behavior in hypoxia condition
without a pollutant (Rissanen et al., 2006, Rimoldi et al., 2012). Ongoing studies in our
58
laboratory combining pollutants and hypoxia exposure, and exposure to different climate
scenarios will help to respond how these genes will behave under synergistic effects.
4. Conclusion
Amazonian fish have proven to be versatile as bioindicators of environmental
pollution, using both toxicology and genotoxicity markers. In the present work, we could
observe that the species C. macropomum is sensible to the B[a]P under acute
exposure. However, further studies are necessary to understand better the behavior of
the genes ras and hif-1α on the effects of contaminant as B[a]P. Thus, the exposure of
this species to this pollutant for a longer time and along with other environmental threats
is under development. This work contributed to essential data to further understand
these genes play a significant role in cell machinery especially when a contaminant is
involved. The mechanisms related in the overexpression of ras and hif-1α genes on the
intermediary concentration of B[a]P needs further explanation.
Acknowledgments
FAPEAM and CNPq supported this study through INCT-ADAPTA. We thank
Carolina Dultra Abrahim for her assistance in comet assay analyses. Thanks are also
due to the personnel of the Functional Histology Laboratory of the Federal University of
Amazonas for their support with the preparation of histological material.
59
References
Abdel-Moneim AM, Al-Kahtani MA and Elmenshawy OM (2012) Histopathological biomarkers in gills and liver of Oreochromis niloticus from polluted wetland environments, Saudi Arabia. Chemosphere 88: 1028–1035.
Agamy E (2012) Histopathological liver alterations in juvenile rabbit fish (Siganus canaliculatus) exposed to light Arabian crude oil, dispersed oil and dispersant. Ecotoxicol Environ Saf 75:171-179.
Bailey GS Selivonchick D and Hendricks J (1987) Initiation, promotion, and inhibition of carcinogenesis in rainbow trout. Environ Health Persp 71: 147–153. Bailey GS, Williams DE and Hendricks JD (1996). Fish models for environmental carcinogenesis. Environ Health Persp 104 (Suppl 1): 5–21. Bosveld ATC, de Bie PAF, van den Brink NW, Jongepier H, Klomp AV (2002) In vitro EROD induction equivalency factors for the 10 PAHs generally monitored in risk assessment studies in The Netherlands. Chemosphere 49:75–83.
Buhler DR and Williams DE (1989) Enzymes involved in metabolism of PAH by fish and other aquatic animals: oxidative enzymes (or phase I enzymes). In: Varanasi, U. (Ed.), Metabolism of Polyciclic Aromatic Hidrocarbons in the Aquatic Environment. CRC Press, Boca Raton, pp. 151–184. Cheng R, Bradford S, Barnes D, Williams D, Hendricks J and Bailey G (1997) Cloning, sequencing and embryonic expression of an N-ras proto-oncogene isolated from an enriched zebrafish (Danio rerio) cDNA library. Mol Mar Biol Biotechnol 6; 40–47. Costa PM, Chicano-Gálvez E, López Barea J, DelValls TA and Costa MH (2010) Alterations to proteome and tissue recovery responses in fish liver caused by a short term combination treatment with cadmium and benzo[a]pyrene. Environ Pollut 158: 3338-3346. Conney, A.H., Chang, R.L. , Jerina, D.M. Wei, , S.J. (1994). Studies on the metabolism of benzo[a]pyrene and dose-dependent differences in the mutagenic profile of its ultimate carcinogenic metabolite. Drugs Metabolism Reviews. 26 ,125–163. Couch JA (1975) Histopathological effects of pesticides and related chemicals on the livers of fishes. In: Ribelin, W.E., Migaki, G. (Eds.), The Pathology of Fishes. The University of Wisconsin Press, Madison, Wisconsin, pp. 559–584. Curtis LR, Garzon CB, Arkoosh M, Collier T, Myers MS Buzitis J and Hahn ME (2011) Reduced cytochrome P4501A activity and recovery from oxidative stress during subchronic benzo[a]pyrene and benzo[e]pyrene treatment of rainbow trout. Toxicol Appl Pharmacol 254: 1–7. Dehne N and Brüne B (2009). HIF-1 in the inflammatory microenvironment. Exp Cell Biol 315:1791 – 1797. Delesclue C, Ledirac N, de Sousa G, Pralvorio M, Botta-Fridlund D, Letreut Y, Rahmani R (1997) Comparative study of CYP1A1 induction by 3-methylcholanthrene in various human hepatic and epidermal cell types. Toxicol In Vitro 11:443–450.
Fraga A, Ribeiro R and Medeiros R (2009) Revisión – OncologíaHipoxia tumoral. Papel del factor inducible por hipoxia. Actas Urol Esp 33(9): 941-951. Frenzilli G, Nigro M and Lyons BP (2009) The Comet assay for the evaluation of genotoxic impact in aquatic environments. Mutat Res 681: 80–92.
60
Fricke NF, Stentiford G, Feist SW and Lang T (2012) Liver histopathology in Baltic eelpout (Zoarces viviparus) A baseline study for use in marine environmental monitoring. Mar Environ Res 82:1-14. Gao M, Li Y, Sun Y, Long J, Kong Y, Yang S and Wang Y (2011) A common carcinogen benzo[a]pyrene causes p53 overexpression in mouse cervix via DNA damage. Mutat Res 724: 69–75 Geng X, Feng J, Liu S, Wang Y, Arias C, Liu Z (2014) Transcriptional regulation of hypoxia inducible factors alpha (HIF-α) and their inhibiting factor (FIH-1) of channel catfish (Ictalurus punctatus) under hypoxia. Comp Biochem Physiol Part B 169: 38–50. Genten F, Terwinghe E and Dangy A (2009) Atlas of fish histology. Published by Science Publishers, Enfi eld, NH, USA, pp 92-98. Grivennikov SI, Greten FR, and Karin M (2010) Immunity, Inflammation, and Cancer. Cell 140: 883–899. Grabher C and Thomas AL (2006) Fishing for cancer models. Nat Biotechnol 24: 45 – 46. Harris CC, Vahakangas K, Newman MJ, Trivers GT, Shamsuddin A, Sinopoli N, Mann DL and Wright WE (1985). Detection of benzo[a]pyrene diol epoxide-DNA adducts in peripheral blood lymphocytes and antibodies to the adducts in serum from coke oven workers. Proceedings of the National Academy of Sciences of the USA 82: pp. 6672 - 6676. Health AG (1995) Water Pollution and Fish Physiology, vol. 2. CRC Lewis Publishers, Boca Raton, pp. 125–140. Hinton DE and Lauren OJ (1990) Liver Structural Alterations Accompanying Chronic Toxicity in Fishes: Potential Biomarkers of Exposure. Biomarkers of Environ- mental Contamination. Lewis Publishers, MI, pp. 12–68. Hinton DE, Segner H and Braunbeck T (2001) Toxic responses of the liver. In: Schlenk, D., Benson, W.H. (Eds.), Target Organ Toxicity in Marine and Fresh- water Teleosts, Taylor and Francis, London, pp. 224–268. Husøy A., Myers MS, and Goksøyr, A. (1996) Cellular localization of cytochrome P450 (CYP1A) induction and histology in Atlantic cod (Gadus morhua L.) and European flounder (Platichthys flesus) after environmental exposure to contaminants by caging in Sørfjorden, Norway. Aquat Toxicol 36(1): 53-74. IARC, International Agency for Research on Cancer (2012) A review of human carcinogens: chemical agents and related occupations. In: IARC Monographs on the Evaluation of Carcinogenic Risks to Humans, vol. 100 F, pp. 111-114. http:// monographs.iarc.fr/ENG/Monographs/vol100F/. Jaakkola MS and Jaakkola JJ (1997) Assessment of exposure to environmental tobacco smoke. Eur Respir J 10: 2384–2397. Jeong HJ, Lee HJ, Hong S, Khim JS, Shim WJ and Kim GB (2015) DNA damage caused by organic extracts of contaminated sediment, crude, and weathered oil and their fractions recovered up to 5 years after the 2007 Hebei Spirit oil spill off Korea. Mar Pollut Bull 95(1):452-7. Kennedy SW, Lorenzen A, Jones SP, Hahn ME, Stegeman JJ (1996) Cytochrome P4501A induction in avian hepatocyte cultures: a promising approach for predicting the sensitivity of avian species to toxic effects of halogenated aromatic hydrocarbons. Toxicol Appl Pharmacol 141:214–230. Kim II-Y and Hyun CH (2006) Comparative evaluation of the alkaline comet assay with the micronucleus test for genotoxicity monitoring using aquatic organisms. Ecotoxicol Environ Saf 64: 288–297.
61
Kobayashi, Sugiyama C, Morikawa Y, Hayashi M and T. Sofuni (1995) A comparison between manual microscopic analysis and computerized image analysis in the single cell gel electrophoresis assay MMS Community, 2 pp. 103–115. Lacaze E, Geffard O, Bony S, and Devaux, A. (2010) Genotoxicity assessment in the amphipod Gammarus fossarum by use of the alkaline Comet assay. Mut Res/Gen Toxicol Environ Mut 700(1): 32-38.
Lam SH et al. (2006) Conservation of gene expression signatures between zebrafish and human liver tumors and tumor progression. Nat Biotechnol 24: 73–75.
Latimer JS and Zheng J, (2003) The sources, transport, and fate of PAHs in the marine environment. In: Peter, E.T.D. (Ed.), Pahs: An Ecotoxicological Perspective, pp. 7–33. Lemiere S, Cossu-Leguille C, Bispo A, Jourdain M-J, Lanhers M-C, Burnel D and Vasseur P (2005) DNA damage measured by the single-cell gel electrophoresis (Comet) assay in mammals fed with mussels contaminated by the ‘Erika’ oil-spill. Mutat Res 581:11–21. Lima I, Peck MR, Rendón-Von Osten J, Soares AMVM, Guilhermino L and Rotchell JM 2008) Ras gene in marine mussels: A molecular level response to petrochemical exposure. Mar Pollut Bull 56: 633–640. Lu GE, Wang E-C, Zhu Z (2009) The Dose–Response Relationships for EROD and GST Induced by Polyaromatic Hydrocarbons in Carassius auratus Bull Environ Contam Toxicol 82:194–199. Maertens O and Cichowski K (2014) An expanding role for RAS GTPase activating proteins (RAS GAPs) in cancer. Adv Biol Regul 55:1–14. Malmstrom CM, Koponen K, Lindstrom-Seppa P and Bylund G (2004) Induction and localization of hepatic CYP4501A in flounder and rainbow trout exposed to benzo[a]pyrene. Ecotoxicol Environ Saf 58: 365–372.
Mangold K, Chang, YJ, Mathews C, Marien K, Hendricks J, and Bailey G (1991) Expression of ras genes in rainbow trout liver. Mol Carcin 4(2): 97-102.
Marcuschi M et al. (2010) Purification, characterization and substrate specificity of a trypsin from the Amazonian fish tambaqui (Colossoma macropomum). Biochem Biophys Res Commun 396: 667–673 Mathur DS (1975) Histopathological changes in the liver of fishes resulting from exposure to dieldrin and lindane. Toxicology 13: 109–110. Maxwell PH (2005) The HIF pathway in cancer Seminars. Cell Dev Biol 16: 523–530. Maxwell PH, Dachs GU, Gleadle JM, Nicholls LG, Harris AL, Stratford IJ, Hankinson O, Pugh CW and Ratcliffe PJ (1997) Hypoxiainducible factor-1 modulates gene expression in solid tumors and influences both angiogenesis and tumor growth, Proc. Natl. Acad. Meador JP, Stein, JE Reichert WL, and Varanas, U (1995) Bioaccumulation of polycyclic aromatic hydrocarbons by marine organisms. Rev Environ Contam Toxicol 143:79–165. Melstrom LG, Salabat MR, Ding X-Z, Strouch MJ, Grippo PJ, Mirzoeva S, Pelling JC, David J and Bentrem M (2011) Association for academic surgery Apigenin Down-Regulates the Hypoxia Response Genes: HIF-1a, GLUT-1, and VEGF in Human Pancreatic Cancer Cells. J Surg Res 167: 173–181.
62
Michel C, Bourgeault A, Palais F, Geffard A and Vincent-Hubert F (2013) Seasonal and PAH impacton DNA strand-break levels in gill softransplanted zebra mussels. Ecotoxicol Environ Saf 92: 18–26.
Moller AM, KorytarˇT, Kollner B, Schmidt-Posthaus H and Segner H (2014) The teleostean liver as an immunological organ: Intrahepatic immune cells (IHICs) in healthy and benzo[a]pyrene challenged rainbow trout (Oncorhynchus mykiss). Dev Comp Immunol 46: 518–529. Nath B and Szabo G (2012) Hypoxia and hypoxia inducible factors: diverse roles in liver diseases. Hepatol 55: 622–633. Nemoto N, Kodama K, Tazawa A, Masahito P and Ishikawa T (1986) Extensive sequence homology of the goldfish ras gene to mammalian ras genes Differentiation 32: 17-23. Nero V, Farwell A, Lister A, Van Der Kraak G, Lee LEJ Van Meer T MacKinnon MD and Dixon DG (2006) Gill and liver histopathological changes in yellow perch (Perca flavescens) and goldfish (Carassius auratus) exposed to oil sands process-affected water. Ecotoxicol Environ Saf 63: 365–377. Nogueira P, Pacheco M, Pereira ML, Mendo S and Rotchell JM (2010) Anchoring novel molecular biomarker responses to traditional responses in fish exposed to environmental contamination. Environ Pollut 158: 1783–1790. Nogueira PR, Lourenço J, Mendo S and Rotchell JM (2006) Mutation analysis of ras gene in the liver of European eel(Anguilla anguilla L.) exposed to benzo[a]pyrene. Mar Pollut Bull 52:1611–1616.
Oliveira Ribeiro CA, Padrós J, Valdez Domingos FX, Akaishi FM and Pelletier É (2007) Histopathological evidence of antagonistic effects of tributyltin on benzo[a]pyrene toxicity in the Arctic charr (Salvelinus alpinus). Sci Total Environ 372: 549–553. Ostrander GK and Rotchell JM (2005) Fish models of carcinogenesis. Biochemistry and Molecular Biology of Fishes. Elsevier B.V vol. 6, pp 255-288.
Padrós J, Pelletier É and Ciro Oliveira Ribeiro CA (2006) Metabolic interactions between low doses of benzo[a]pyrene and tributyltin in arctic charr (Salvelinus alpinus): a long-term in vivo study. Toxicol Appl Pharmacol 192:45–55
Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT PCR. Nucleic Acids Res 29(9): 2003-2007.
Poleksic V and Mitrovic-Tutundžic V (1994) Fish gills as a monitor of sublethal and chronic effects of pollution. IN: Müller, R.; Lloyd, R. Sublethal and chronic effects of pollutants on freshwater fish. Oxford: Fishing News Books. 30: 339-352.
Pryor WA and Stone K (1993). Oxidants in cigarette smoke. Radicals, hydrogen peroxide, peroxynitrate, and peroxynitrite. NY Acad. Sci. 68: 12–27. Rimoldi S, Terova G, Ceccuzzi P, Marelli S, Antonini M and Saroglia M (2012) HIF-1a mRNA levels in Eurasian perch (Perca fluviatilis) exposed to acute and chronic hypoxia Mol Biol Rep 39:4009–4015. Rissanen E, Tranberg HK, Sollid J, Nilsson GE and Nikinmaa M (2006) Temperature regulates hypoxia-inducible factor-1 (HIF-1) in a poikilothermic vertebrate, crucian carp (Carassius carassius). J Exp Biol 209: 994-1003. Rojo-Nieto E, Oliva, M, Sales D and Perales JA (2014) Feral finfish, and their relationships with sediments and seawater, as a tool for risk assessment of PAHs in chronically polluted environments. Sci Total Environ 470–47/ 1030–1039.
63
Rotchell MJ, Lee J, Chipman JK and Ostrander GK (2001) Structure, expression and activation of fish ras genes. Aquat Toxicol 55:1–21. Rytkönen TK, Ryynänen HJ, Nikinmaa M and Primmer CR (2008) Variable patterns in the molecular evolution of the hypoxia-inducible factor-1 alpha (HIF-1α) gene in teleost fishes and mammals. Gene 420: 1–10. Salazar-Lugo R, Mata C, Oliveros A, Rojas LM, Lemus M and Rojas-Villarroel E (2011) Histopathological changes in gill, liver and kidney of neotropical fish Colossoma macropomum exposed to paraquat at different temperatures. Environ Toxicol Pharmacol 3: 490–495. Sanchez-Arguello P, Aparicio N and Fernández C (2012) Linking embryo toxicity with genotoxic responses in the freshwater snail Physa acuta: Single exposure to benzo(a)pyrene, fluoxetine, bisphenolA, vinclozolin and exposure to binary mixtures with benzo(a)pyrene. Ecotoxicol Environ Saf 80: 152–160. Schweiki D, Itan A, Soffer D and Keshet E (1992) Vascular endothelial growth factor may mediate hypoxia-initiated angiogenesis. Nat 359: 843– 845. Semenza G L (2012) Hypoxia-inducible factors in physiology and medicine. Cell 148: 399–408. Siddiq A, Aminova LR, Ratan RR (2007) Hypoxia Inducible Factor Prolyl 4-Hydroxylase Enzymes: Center Stage in the Battle Against Hypoxia, Metabolic Compromise and Oxidative Stress Neurochem Res 32:931–946. Silva J, Freitas TRO, Marinho JR, Speit G and Erdtmann B (2000) An alkaline single-cell gel electrophoresis (comet) assay for environmental biomonitoring with native rodents. Gen Mol Biol 23(1): 241-245.
Singh NP, McCoy MT, Tice RR and Schneider EL (1988) A Simple technique for quantitation of low levels of DNA damage in individual cells. Exp Cell Res 175: 184-191.
Stehr CM, Johnson LL and Myers MS (1998) Hydropic vacuolation in the liver of three species of fish from the US West Coast: lesion description and risk assessment associated with contaminant exposure. Dis Aquat Org 32:119–135. Stentiford GD, Massoud MS, Al-Mudhhi S, Al-Sarawi M, Al-Enezi M and Lyons BP (2014) Histopathological survey of potential biomarkers for the assessment of contaminant related biological effects in species of fish and shellfish collected from Kuwait Bay, Arabian Gulf. Mar Environ Res 98: 60-67 Taylor PC and Sivakumar B (2005) Hypoxia and angiogenesis in rheumatoid arthritis. Curr Opin Rheumatol 17:293–298. Terova G, Rimoldi S, Corà S, Bernardini G, Gornati R and Saroglia M (2008) Acute and chronic hypoxia affects HIF-1α mRNA levels in sea bass (Dicentrarchus labrax). Aquaculture 279: 150–159. Tintos A, Gesto M, Miguez JM and Soengas JL (2008) b-Naphthoflavone and benzo(a)pyrene treatment affect liver intermediary metabolism and plasma cortisol levels in rainbow trout Oncorhynchus mykiss. Ecotoxicol Environ Saf 69:180–186. Tsukatani H, Tanaka Y, Sera N, Shimizu N, Kitamori S, Inoue N (2003) Validity of mutagenic activity as an indicator of river water pollution. Environ Health Prev Med 8: 133-138.
64
Val AL and Honczaryk A (1995). Criando peixes na Amazônia. Manaus: INPA (Editor), Manaus, Brasil. pp160. Van Beneden R J, Henderson KW, Blair DG, Papas TS and Gardner HS (1990) Oncogenes in hematopoietic and hepatic fish neoplasms. Cancer Res, 50(17 Supplement):5671s-5674s.
Varanasi U, Stein JE and Nishimoto (1989) Biotransformation and disposition of PAH in fish. In: Varanasi, U. (Ed.), Metabolism of Polycyclic Aromatic Hydrocarbon in the Aquatic Environment. CRC Press, Boca Raton, Florida, pp. 93–150. Vienneau DS, DeBoni U and Wells PG (1995) Initiation of micronuclei by benzo(a)pyrene and benzo(e)pyrene in UDP-glucuronosyltransferase-deficient cultured rat skin fibroblasts. Cancer Res 55: 1045-1051.
Yu RMK, Ng PKS, Tan T, Chu DLH, SunWu RS and Kong RYC (2008) Enhancement of hypoxia-induced gene expression in fish liver by the aryl hydrocarbon receptor (AhR) ligand, benzo[a]pyrene (BaP). Aquat Toxicol 90: 235–242.
Zhong H, De Marzo AM, Laughner E, et al. (1999) Over expression of hypoxia-inducible factor 1 in common human cancers and their metastasis. Cancer Res. 59: 5830– 5835.
65
Table 1. Details of each primer designed for candidate reference genes (28S and ef-1) and the two
target genes (ras and hif-1).
Gene
Symbol
Primer sequence (5`-3`) forward/reverse Length (bp)
Amplicon length(bp)
Tm Eff(%)a
28S-F
CGGGTTCGTTTGCGTTAC
18 150 54.5 98.19
28S-R
AAAGGGTGTCGGGTTCAGAT
20 150 56.3 98.19
ef-1F
GTTGGTGAGTTTGAGGCTGG
20 78 60.7 99.09
ef-1R
CACTCCCAGGGTGAAAGC
18 78 60.9 99.09
Ras-F
CCAGTACATGAGGACAGGAG
20 134 60.3 99.31
Ras-R
CAAGCACCATTGGCACATCG
20 134 60.3 99.31
HIF-1F
CTTCTGAGCTCTGATGAGGC
20 98 60.1 105.24
HIF-1R
GAAAGCACCATCAGGAAGCC
20 98 61.2 105.24
a. Primer efficiency
66
Figure 1. C. macropomum liver exposed to corn oil (control group). (A) Hepatocytes are organized in one
or two layers surrounded by sinusoides (black arrows). (B) Normal liver parenchyma, highlighting a vase
with red blood cells (asterisk). (C) Image of liver exposed to 8 mol/kg B[a]P evidencing the
hepatopancreas (asterisk) and sinusoide obstruction (white arrow). (D) Image of fish liver exposed to 8
mol/kg B[a]P, showing necrotic area (asterisk). (E) Image of liver exposed to 16mol/kg B[a]P showing
some hepatocytes without nucleus (white asterisk), sinusoidal dilatation (black arrows) and hemosiderin
(white arrow). (F) Image of vacuolated hepatocytes of fish exposed to 32 mol/kg B[a]P; the cytoplasm
degeneration (black asterisks) and picnoti nucleous (black arrow) are evident. Slides were stained with
Hematoxylin and Eosin.
67
Figure 2. Histopathological Alteration Index (HAI) of C. macropomum liver after exposure to different
injections of B[a]P. Indexes are in accordance with Poleksic and Mitrovic-Tutundsic (1994). *Indicates
significant differences compared to control group (corn oil) (P< 0.05).
68
Figure 3. Genetic Damage Index (GDI) in erythrocytes of C. macropomum after 96h of injection of
different concentrations of B[a]P. *Indicates significant differences compared to control group (corn oil)
(P< 0.05).
69
Figure 4. Relative expression of the oncogene ras in liver of C. macropomum after 96h of injection of
different concentrations of B[a]P. *Indicates significant difference in comparison to control group (P<0.05).
70
Figure 5. Relative expression of gene hif-1 gene in C. macropomum after 96h of injection of different
concentrations of B[a]P. *Indicates significant difference in comparison to control group (corn oil)
(P<0.05).
71
Capítulo II
Toxicological responses of Amazon fish Colossoma macropomum contaminated with
Benzo[a]pyrene are magnified by climate change scenario.
72
Title
Toxicological responses of Amazon fish Colossoma macropomum contaminated with
Benzo[a]pyrene are magnified by climate change scenario.
Running title
Climate Change, C. macropomum, Benzo[a]pyrene
Author names and affiliations
Grazyelle Sebrenski da Silva1,2, Luciana Mara Lopes Fé1, Lorena V. de Matos2,
Adalberto L. Val2 and Vera Maria Fonseca de Almeida e Val1
1Laboratory of Ecophysiology and Molecular Evolution (LEEM), Brazilian National
Institute for Research in the Amazon (INPA). 69067-375 André Araújo Avenue, 2936,
Petrópolis. Manaus, AM, Brazil.
2Institute of Biological Science (ICB) in Amazon Federal University (UFAM), General
Rodrigo Octávio Ave, 6200, Coroado I. AM, Brazil
E-mail address:; L.M.L. Fé (lucianamlfe@gmail.com); A.L. Val (dalval@inpa.gov.br),
V.M.F. de Almeida e Val (veraval30@gmail.com).
Corresponding author: G.S. Sebrenski
Phone number: +55 92 3643 3188
E-mail address: grazysebrenski@hotmail.com
Postal address: André Araújo Avenue, 2936, Petrópolis, 69067-375. Manaus, AM,
Brazil
73
Abstract
The Intergovernmental Climate Change (IPCC, 2007) forecasted for A2 scenario an
increase of 4.5 °C in the air temperature and an increase of 850 ppm CO2 in
atmosphere. Given the effects of these changes, as well as the action of the
carcinogenic contaminant benzo[a]pyrene (BaP), the present work main goal was to
verify the effects of a climate change scenario (A2 - as proposed by the IPCC)
combined to the action of BaP on the expression of ras oncogene and hif-1gene,
histopatological damages, anti-oxidant enzymes, DNA damage, and hematological
parameters in the species Colossoma macropomum. For that, animals were divided into
three different treatments and received injection of corn oil (control) 8 and 16 mol/kg of
BaP and were, then, separated and exposed to two scenarios: the current scenario that
simulates the current temperature and CO2 levels, and the extreme scenario that
simulate the A2 scenario forecasted by IPCC, during 30 days. After the exposure, fish
were bleed to evaluate hematological parameters and DNA strand breaks (by Comet
Assay) and liver was sampled for histopathology analysis (light microscopy), ras
oncogene and hif-1 gene expression (by PCR: RT-PCR), as well as enzymatic
analizes of glutathione-S-transferase (GST), catalase (CAT) and lipid peroxidation
(LPO). Ras oncogene was overexpressed 2.86-fold in fish exposed to 8mol/kg of BaP
and 2.46-fold in fish exposed to 16mol/kg of BaP in extreme scenario, compared to
fish kept in the current scenario. Hif-1was overexpressed 11.82-fold (8 mol/kg) and
9.81-fold (16 mol/kg) in the extreme scenario, in comparison with the same treatments
in the current scenario. No differences were observed in liver histopathological
damages comparing the two scenarios. However, all fish exposed to BaP presented
irreparable tissue damage compared to control fish injected with corn oil. GST and CAT
activities decreased, and LPO levels were lower in fish exposed to the extreme scenario
in all treatments. DNA strand breaks were higher in fish injected with BaP in both
scenarios compared to control fish injected with corn oil. Erythrocytic DNA damages
increase in BaP injected fish in extreme scenario in comparison with the control. There
No alteration was detected in hematological parameters (Hb, Ht, RBC, MCV, MCHM
and glucose) in any fish, excepted by MCH, which increased in fish injected with
74
16mol/kg of BaP and exposed to the extreme scenario. We concluded that the effects
of the contaminant (BaP) were magnified by the climate change scenario, what is an
alert for global change effects in fish under threat of polluted waters.
Key-words: Climate change, Benzo[a]pyrene, and Colossoma macropomum.
75
1. Introduction
Climate change is a critical issue that raised heated scientific debates and
generated considerable public interest. Numerous interdisciplinary studies are being
carried out to determine how human life will be influenced by future climate changes
(Karol et al., 2011, Pryor and Barthelmie, 2010). In this context, the Intergovernmental
Panel on Climate Change (IPCC) summarizes the observed changes in climate and
their effects on natural and human systems and presents projections of future climate
change and related impacts under different scenarios (IPCC, 2007). According to IPCC
(2007) the global atmospheric concentration of CO2 increased during the last 10 year
(1995-2005 average: 1.9 ppm per year). The prospection for the year 2100 in the
extreme scenario (A2) proposed by IPCC (2007) includes an increase in the air
temperature of 4.5 °C and an increase of 850 ppm CO2 in atmosphere.
Climate change has influenced the studies involving the impacts of climate
variability and changes on vegetation dynamics, agricultural production (Gouveia et al.,
2008, Gouveia et al., 2011), and so on. Other studies have focused on understanding
the biogeographical (biotic) zoning based on the actual differentiating characteristics of
biotic complexes and biotic regions, which are formed under the influence of rapid
climate changes (Tishkov 1994, Tishkov, 2005). New methodologies have improved our
ability to forecast how species will respond to climate change, and this includes
freshwater fish species. Climate change might be one of the main threats faced by
aquatic ecosystems and freshwater in the near future (Elith et al., 2010, Comte et al.,
2013).
In addition to the effects of climate change, the advanced technologies and
human development have also increased the release of pollutant products in the nature,
contaminating many ecosystems, including air, ground and water pollution. Today’s
industrialized society is threating the water, releasing a vast amount of harmful
xenobiotics, including heavy metals, pesticides, petroleum derivates, and industrial
chemicals, which bio-accumulate in organisms and cause toxicity to aquatic fauna and
flora. Freshwater ecosystems are under the pressure of multiple stressors, such as
organic and inorganic pollutants, geomorphological alterations, land use changes, water
76
abstraction, invasive species, and pathogens (Vörösmarty et al., 2010). A group of
environmental contaminants that has been widely studied in the aquatic environment is
the polycyclic aromatic hydrocarbons (PAHs) (González-Doncel et al., 2008; Hong et
al., 2016; Lucas et al., 2016).
Polycyclic aromatic hydrocarbons (PAHs) are defined as a group of aromatic
hydrocarbons with two or more fused benzene rings, which are one of the most
important classes of hydrophobic organic contaminants (Lotufo and Fleeger, 1997). One
of the most toxic PAH is the Benzo[a]pyrene (BaP) (IARC, 2012). BaP has its principal
source from man-made activities involving the combustion of coal, oil, wood, diesel and
petroleum (Maria and Bebianno 2011). BaP is a potent carcinogen and mutagen and is
considered as a model substance for contaminant studies (Shaw and Connel, 1994,
Manoli and Samara 1999). BaP adducts are considered to be among the leading
causes of occurence of DNA strand breaks, leading in failure of DNA- repair
mechanisms, causing either cell death due to changes in expression of critical survival
genes or transformation due to somatic mutations (Shackelford et al., 1999). The
literature has registered studies about fish from PAHs polluted areas where
approximately 33% of the fish presented hepatocellular carcinoma (Moore et al., 1989;
Vogelbein et al., 1990; Myers et al., 1992). In fish, the PAH benzo[a]pyrene (BaP) was
found to cause mutations in the oncogene ras (Rotchell et al., 2001). PAH also affected
the expression of some genes in fish, such as CYP1A and LDH (Gárcia-Tavera et al.,
2013) and AKR1A1 gene (Osorio-Yáñez et al., 2012).
Two genes related to cancer development have drawn attention in the literature:
the oncogene ras (Kolch, 2000), and the hypoxia inducible factor (hif-1) (Cui et al.,
2012). Ras are a superfamily of molecular switches that regulate a diverse range of
functions, including cell proliferation, differentiation, motility and apoptosis, in response
to extracellular signals (Kolch, 2000). Hypoxia-inducible factor-1 (HIF-1) monitors the
cellular response to the oxygen levels in solid tumors. Under hypoxic conditions, HIF-1
protein is stabilized and forms a heterodimer with the HIF-1β subunit. The HIF-1
complex activates the transcription of numerous target genes to adapt to the hypoxic
environment in human cancer cells (Kitajima and Miyasaki 2013). Both genes have
77
been studied in fish species, contributing to understand how these genes behave in the
presence of a contaminant (Nogueira et al., 2006, Yu et al., 2008).
Fish are sensitive to climate changes as temperature disturbances and CO2
concentration increases in the water. It is also sensitive to aquatic contaminants that
may compromise their health and resilience (Ficke et al., 2007, Strobel et al., 2015).
Multiple stressors (primarily organic and inorganic pollutants) can have an influence on
the DNA integrity in aquatic organisms (Jha et al., 2008). Organisms cope with and
rapidly adapt to changing conditions by modifying their physiological functions to
achieve cellular homeostasis (Hofmann and Todgham, 2010). Moreover, most
organisms adjust their gene expression patterns by switching on and off some genes
(Voolstra et al., 2009).
Colossoma macropomum (tambaqui) is an Amazonian freshwater fish with
considerable economic importance in the region (Golding and Carvalho, 1982). This
species is usually exposed to water quality oscillations and variable nutrient availability
in its environment (Val and Honczaryk, 1995). Tambaqui presents a high tolerance for
environmental changes in dissolved oxygen, temperature, and pH (Val and Almeida-
Val, 1995; Val and Kapoor, 2003).
Considering the ongoing climate changes, and considering the increase of the
freshwater pollution, it is necessary to understand how these stressors can influence the
expression of genes related with cancer development, such as the oncogene ras and
the hypoxia inducible factor (hif-1 Fish became one of the most suitable models for
estimating possible threats in the aquatic environment due to their ability to efficiently
metabolize and accumulate chemical pollutants (Cavas, 2011).
Therefore, the aim of this study was to evaluate the effects of the A2 scenario
forecasted by the Intergovernmental Panel on Climate Change (IPCC) for the year 2100
in the expression of oncogene ras and hypoxia inducible factor (hif-1) gene in
tambaqui exposed to the PAH benzo[a]pyrene, as well as to assess the histopatologic,
genotoxicity and metabolic changes.
78
2. Material and Methods
2.1 Animals acquisition
Juveniles of Colossoma macropomum (31.88 g ± 0.7; 10.03 cm ± 0.08) were
purchased from Aquaculture Production Training Center CRTPA in the Balbina fish farm
(Balbina, Presidente Figueiredo, AM*1°55'54.4"S; 59°24'39.1"W) and properly
transported by truck to Manaus town for approximately two hours drive to the facilities of
the Laboratory of Ecophysiology and Molecular Evolution (LEEM), located at Campus I
of the National Institute of Amazonian Research (INPA), Amazonas-Brazil. Once in the
lab facility, fish were held outdoors in pools with recirculating and aerated INPA’s
groundwater ([Na+], 0.83; [K+], 0.45; [Ca2+], 0.10; [Mg2+], 0.040; [Cl-], 0.90mgl-1; [Cu2+],
7.0 g l-1; hardness=1.33mg CaCO3 l-1; pH= 6.80), where they spent 30 days for
acclimatization. During this period, fish were constantly monitored and fed three times a
day with commercial food containing 36% protein. Feeding was suspended one day
prior the experimental procedure.
2.2 Climate Scenario Exposition
After 30 days acclimatization, fish (n=10) were randomly distributed in nine
indoor tanks (70L capacity) at a closed system with constant aeration, and kept there for
seven days before the experiment. Fish were, then, distributed in three experimental
groups with three different treatments; at the first treatment (control group), fish received
intraperitoneal vehicle injection (corn oil) according to animal weight (0,1ml/g); at the
second treatment, fish received intraperitoneal injection with vehicle (corn oil) plus
8mol/kg of BaP; and at the third group, injection with vehicle (corn oil) and 16mol/kg
of BaP. Fish received the injections after seven days acclimatization. Following 96h
after injection the tanks were transported to the current and extreme scenarios, feeding
was suspended one day before the injections and resumed after one day post-injection.
During the whole experimental period 50% of tank water was renewed every other day
79
to maintain the water quality; water characteristics were monitored (pH, CO2,
temperature).
After 96h of injection, fish was randomly distributed to the Climate Scenarios.
One Climate scenario was the control scenario (Current Scenario) with the current real-
time temperatures and CO2 levels, in the forest nearby the laboratory area. The other
scenario was de A2 (Extreme Scenario) as forecasted by the Fourth Assessment
Report of the IPCC for the year 2100. This extreme scenario has 4.5oC and 850 ppm
CO2 above the current scenario levels. The automatic sensors measure these
parameters every two minutes and transmit the data to the laboratory computers that
control the environmental rooms according to the respective scenario.
Nine tanks were placed in each scenario (current and extreme) and divided into
three experimental groups with three different treatments (control (corn oil), 8mol/kg,
and 16mol/kg of BaP, respectively). Fishes were distributed in each tank (final n=5) for
each treatment and Climate scenario. During the experimental time, the water quality
was monitored, and 50% of water tank was replaced in alternate days. Fish was fed
once a day ‘ad libitum’ with commercial feed containing 36% protein. After 30 days at
the Climate scenario, fish were bleed with a heparinized syringe from the caudal vein,
and then each fish was weighed, measured, and euthanized through cerebral
concussion followed by severing the anterior spinal cord. After death, the fish liver was
dissected, and one portion was snap-frozen in liquid nitrogen and stored at −80°C. The
other liver porption was fixed in Alfac solution as described below, for histopathology
analysis through light microscopy. All procedures followed the protocols described at
the Brazilian Guides of Animal Care and Use, as required by the Ethics Committee on
Animal Use of the National Institute for Research in the Amazon (CEUA – INPA)
(Protocol Number 011/2013).
80
2.3 Analytical Methods
2.3.1. Environmental Variables
Water parameters (temperature, CO2, oxygen, and pH) were monitored three
times a week in each experimental tank in both scenarios (current and extreme).
Temperature and oxygen were measured using an oximeter 5512-FT (YSI, EUA), pH
was measured with a pHmetro UltraBASIC UB-10 (Denver Instrument, EUA), and the
CO2 levels were measured by the Boyde and Tucker (1992) method (Table 2).
Environmental condition inside the scenarios (current and extreme) was
monitored and controlled by an automatic system connected with a computer whose
archives the atmospheric temperature and CO2 every two minutes. The climatic
conditions within the scenarios are kept in accordance to the characteristics described
by IPCC (2007). The current scenario has an internal sensor that is connected to an
external sensor (in INPA’s forest) and keeps the climatic conditions within the real-time.
An automatic system is responsible for balancing the temperature within the scenarios
and CO2 levels (Table 1).
2.3.2. Blood and plasma analyzes
Blood aliquots were centrifuged in microcapillary tubes and hematocrit (Ht) was
read using an appropriate card (Navarro and Pachaly, 1994). Hemoglobin concentration
[Hb] was determined using 10μl of diluted blood in 2 ml of Drabkin reagent, according to
the protocol established by (Kampen and Zijlstra, 1964). Total erythrocyte counts (RBC)
were read on a Neubauer chamber throuth a light microscopy (Leica DM2015) using
blood diluted with formaldehyde citrate. The [Hb], RBC, and Ht values were used to
calculate corpuscular parameters: mean corpuscular volume (MCV), mean corpuscular
hemoglobin concentration (MCHC), and mean corpuscular hemoglobin (MCH). Glucose
was measured using the colorimetric method without deproteinization (GOD-PAP) using
the kit InVitro®. The reading was performed in a spectrophotometer at 500nm.
81
2.3.3. Comet Assay
Comet assay was used to quantify the DNA in blood cells damage following the
protocol described by Singh et al. (1988), and modified by Silva et al. (2000). Slides
were covered with standard melting agarose (1.5% normal melting agarose prepared in
phosphate-buffer saline - PBS) and dried overnight. Blood sample (5l) were mixed with
0.75% low melting point agarose at 5% ratio (Gibco BRL) at 37oC and immediately
poured on pre-covered slides and covered with a coverslip. The coverslip was removed
after the agarose solidification, and slides were placed in a lysis solution (2.5M NaCl,
100mM EDTA, 10mM Tris, pH 10-10.5; 1% Triton X-100 and 10% DMSO). Before
electrophoresis, the slides were incubated for 20 min in alkaline electrophoresis buffer
(300mM NaOH and 1mM EDTA, pH >13). Samples were then electrophoresed in a dark
place under an alkaline condition for 20 min at 300mA and 25V at 4°C to produce the
comets. After the electrophoresis, the slides were washed with an appropriate buffer
(0.4M Tris buffer, pH 7.5) to neutralize the alkalis in the gels. A silver solution (5%
sodium carbonate, 0.1% ammonia nitrate, 0.1% silver nitrate, 0.25% tungstosilicic acid,
and 0.15% formaldehyde) was used to stain the stranded DNA. Two slides were stained
for each fish (n=3 and N=15 for each treatment). At last, the slides were examined using
an optical microscope (Leica DM2015) at 400X magnification. Randomly selected cells
(100 cells from each of two replicate slides) were analyzed for each animal. We used
the tail sizes to score the comet assay into five classes (from undamaged (zero) to
maximally damage (four)). An overall score was obtained by summation of all cell
scores from completely undamaged (sum zero) to maximum damage (sum 400)
according to Kobayashi et al. (1995).
2.3.4. Histopathological analyses
Liver samples were immediately fixed in Alfac solution (70% ethanol, 5% glacial
acetic acid, and 4% formaldehyde) for 16 h. Afterwards, samples were dehydrated in a
graded series of ethanol, and embedded in paraffin. Serial sections of 5m thickness
were prepared on glass slides using a semi-automatic microtome. Slides of eight fish
82
from each treatment were made. Liver sections were stained with Hematoxylin/ Eosin
and PAS (Shiff Periodic Ácid) and observed under the bright field microscope (Leica
DM2015) at 40x.
Histopathological Damage Index (HDI) were semi-quantitatively and qualitatively
evaluated using the method described by Poleksic and Mitrovic-Tutundsic (1994) and
Silva (2004). Indexes were based on the severity of lesions and used to asses liver
tissue damages: I = ∑ I + 10 ∑ II + 100 ∑ III, where stages I, II, and III correspond to the
degree of the lesion, respectively. The final Indexes were described as follows: normal
function of the organ (I = 0-10), mild to moderate damage (I = 11-20), moderate to
severe damage (I = 21-50), severe damage (I = 51-100), and irreparable damage (I
>100).
2.3.5. Isolation of total RNA and cDNA synthesis
Following the manufacturer`s instructions of the Trizol®reagent, total RNA from
four tambaqui liver samples were isolated for each treatment. Contaminating genomic
DNA was removed using DNAse (Invitrogem™). Using ReverAID Minus First Strand
cDNA Synthesis Kit (Fermentas®), first strand cDNA was reverse-transcribed following
the manufacturer`s instructions. Enzymatic treatment with reverse transcriptase (MMLV
Reverse Transcriptase) (200 U/μL, USB) was first done and, then, mixed in a 1.5 mL
microtube with approximately 25 μg RNA, 1,0 μL oligonucleotide dT (18) (1μg), 1,0 μL
dNTP mix (10 mM), buffer 5X MMLV, and deionized for a 50 mL final volume. This
solution was incubated at 37°C for one hour for conversion and 70°C for 10 minutes to
inactivate the enzyme. The quality of the total RNA and cDNA was verified using a
NanoDrop® spectrophotometer, model 2000 (Thermo Scientific) as recommended in the
user manual (NanoDrop 2000 / 2000c Spectrophotometer, V1.0 user manual, 2009).
2.3.6. Determination of ras and hif-1sequences
Degenerate sequences for genes 28S, ef-1α hif-1α and ras were screened for
other fish species in NCBI (http://www.ncbi.nlm.nih.gov). Degenerate primers were
83
designed based on the conserved regions of 28S, ef-1α, hif-1α, and ras genes, using
the sequences obtained at NCBI. Partial fragments of tambaqui 28S, ef-1α, hif-1α, and
ras cDNAs were obtained based in these degenerated primers.
Degenerated primers were tested in PCR (Polymerase Chain Reaction) using
PCR master mix (Promega). All PCR products obtained were sequenced with the Kit
ABI PRISM® Big DyeTM Terminator Cycle Sequencing Ready Reaction (Applied
Biosystems) and run on an ABI 3130XL automatic DNA sequencer (Applied
Biosystems). The acquired sequences were analyzed using the BLAST program from
NCBI and then used to generate the specific primers for Colossoma macropomum q-
PCR, ras, hif-1α (target primers), 28S, and ef-1α (reference primers) showed in Table 2.
2.3.7. Quantitative real-time PCR
We used the equipment Viia7 Dx from Life Technologies (Applied Biosystems) to
quantify the gene transcripts by real-time PCR. We analysed samples of four C.
macropomum liver from each treatment. We added 1.0 μL of cDNA as template in
triplicate, to the wells of a 96-well thin-wall PCR plate. Additionally, we added to each
well 1.0 μL of each primer (concentration of ras, 2.0 pmol; hif-1α, 2.0 pmol, 28S, 2.5
pmol and ef-1α, 1.5 pmol), 2.0 μL of nuclease-free water 192 (Ambion, Life
Technologies) and 5 μL SYBR Green PCR Master Mix (Applied Biosystems) in a total
volume of 10 μL. The PCR plate was heated for 2 min at 50°C, plus 95°C for 10 min;
followed by 40 cycles of 95°C for 15 s and 60 °C for 1 min (annealing temperature of all
primers). The presence of a single product-specific melting temperature was confirmed
using melting curve analysis, as follows: 28S (slope -3.36/ R2 0.99), ef-1α (slope -.3.34/
R2 0.99), ras (slope -3.33/ R2 0.97) and hif-1α (slope -3.30/ R2 0.99). In addition, PCR
amplification efficiency for each primer set was calculated by serial dilution curve
obtained from a pool of experimental samples (1000 to 1 ng cDNA concentration; n=4).
All primer pairs showed high PCR efficiency (between 98-105%). The efficiency of
primer amplification was calculated. Serial dilutions of a cDNA standard were amplified
in each run to determine amplification efficiency according to Pfaffl (2001).
84
2.3.8. Biochemical analyses
The activities of hepatic glutathione-S-transferase (GST), catalase (CAT), and
the concentration of the lipid peroxidation (LPO) were measured. For GST and CAT,
frozen (-80oC) liver samples were weighed and homogenised (1:10 w/v) in 20 mM Tris
buffer (pH 7.6), 1 mM EDTA, 1 mM dithiothreitol, 500 mM sucrose, and 150 mM KCl),
for LPO liver, we weighed and homogenized the samples at a different concentration
(1:2 w/v) in the same Tris buffer.
GST activity in liver samples was measured following the protocol established by
Keen et al. (1976), incubating, as substrates, reduced glutathione (GSH) and 1-chloro-
2,4-dinitrobenzene (CDNB) and recording the changes in the absorbance at 340 nm.
The enzyme activity was calculated as nmol of CDNB conjugate formed per min per mg
of protein, using a molar extinction coefficient of 9.6 mM cm-1.
Catalase activity was determined using the Beutler (1975) method. Tissue
homogenate was centrifuged in a refrigerated centrifuge at 9000 rcf for 30min at 4oC
and the clear supernatant was used as enzyme source. The reaction volume contained
990 ml of reaction buffer (Tris 1M, 5mM EDTA, and H2O2) and 10l of homogenate. The
decomposition of H2O2 (hydrogen peroxide) was recorded at 240nm in a
spectrophotometer. Results were expressed in μmol H2O2. min-1. mg protein-1.
LPO was assessed by Fe2+ oxidation in the presence of xylenol orange (FOX,
ferrous oxidation–xylenol orange assay) as described by Jiang et al. (1991). First, the
liver homogenate was centrifuged in a refrigerated centrifuge at 10.000 rpm for 10min at
4oC. Following, the supernatant was mixed with 12% TCA (trichloroacetic acid) 1:1 (v/v)
and centrifuged at 500 rpm for 10min at 4oC. The reaction mixture was obtained with
30l of supernatant and 270l of a reaction solution (100 M xylenol orange, 4 mM
C15H24O, 25 mM H2SO4, and 250M FeSO4 dissolved in 90% methanol). Samples plus
reaction mixture were incubated for 30 min at room temperature for color development
before colorimetric measurement at 560 nm. LPO concentration was expressed as mol
cumene hydroperoxide. mg protein-1.
85
2.3.9. Protein determination
Total protein was measured according to the method described by Bradford
(1976) using a SpectraMax M2 and bovine serum albumin (BSA) as standard at 595
nm.
2.3.10. Statistical analyses
All data are presented as mean ± SEM. Prior to the comparative statistical tests, the
distribution and homogeneity of data were checked. A two-way ANOVA followed by the
Tukey test was used to determine differences in all analyzed parameters (hematology,
ras and hif-1 gene expression, DNA damage, histopathology damage indexes, GST,
CAT, and LPO) among fish exposed to Current Scenario (control) and Extreme
Scenario (A2), and different concentration of BaP (8 ml/kg and 16 mol/kg). Statistical
significance was accepted at the level of P < 0.001. The test was performed through
Sigma Stat 3.5 software.
We used STATISTICA program to perform multivariate analysis and obtain the
principal component analysis (PCA) plots. All observations and variables were used to
produce PCA-plots. Observations (exposure groups) must be independent when
investigated applying PCA, so our data was separated based scenarios (current and
extreme) and experimental groups (control, 8 mol/kg and 16 mol/kg of BaP).
3. Results
3.1. Hematological parameters and plasma glucose
Among the evaluated hematological parameters (Ht, Hb, RBC, MCV, MCHC) and
plasma glucose, only MCH presented the differences between the two scenarios (P <
0.05). There was a significant interaction between scenarios and treatments (P =
0.010). The MCH (pg) increased in fish injected with 16 mol/kg (52.1 ± 2.5) exposed to
86
the extreme scenario in comparison with the same treatment (42.3 ± 1.9) exposed to
the current scenario. MCH was also higher in fish injected with 16 mol/kg in the
extreme scenario in comparison with control and fish injected with 8 mol/kg of BaP in
the same scenario (P<0.05) (Table 3).
3.2. Genotoxic parameters (Comet assay)
Genetic Damage Index (GDI), measured throughout the Comet Assay in blood
cells, increased in fish exposed to 8 and 16 mol/kg of BaP, respectively (130.0 ± 9.5
(P=0.003) and 150.5 ± 8.12 (p=0.033)), in the current scenario in comparison with the
control group (89.9 ± 5.0). In the extreme scenario, the GDI (107.0 ± 6.0 - no BaP)
showed a significant increase in DNA strand breaks in treatments with BaP in fish
injected with 8mol/kg (143.0 ± 4.4) (P<0.001) and 16 mol/kg (242.5 ± 18.2)
(P<0.001). In comparison with same treatments in different scenarios, the GDI was
magnified in fish group injected with 16 mol/kg of BaP (P< 0.001) and submitted to
extreme scenario. There was a significant interaction between scenarios and
treatments. (P = 0.002) (Figure 1).
Regarding DNA damage levels in blood cells, fish exposed to the current scenario
had the prevalence of damage class 1 in all treatments. Out of the 100 cells analyzed
for each fish in control group, 79.8% of blood cells were characterized as class 1. Class
1 also appeared in 53.3% of cells in fish injected with 8 mol/kg of BaP, and 63.7% of
cells in fish injected with 16 mol/kg of BaP. In the extreme scenario, the DNA damage
class 1 of was predominant in fish from control group (72.4%), followed by fish exposed
to 8 mol/kg of BaP (52%), in which class 2 in blood cells appeared at the level of
27.6%. DNA damage in fish exposed to 16 mol/kg in the extreme scenario was equally
distributed in the four classes: class 1 (23.29%), class 2 (24.7%), class 3 (27%), and
class 4 (22.2%) (Figure 7) suggesting that the extreme scenario caused higher DNA
damage in fish exposed to higher BaP concentration.
87
3.3. Biochemical parameters
There were no differences in GST activity in the liver of fish exposed to 8 and 16
mol/kg of BaP in the current scenario. The same behavior was observed in GST
activity in the groups of fish injected with BaP and exposed to the extreme scenario.
Comparing the same treatments at the two scenarios, GST activity decreased 2.0 times
(P< 0.001) in control group, 2.77 times (P< 0.001) in fish injected with 8 mol/kg of BaP
and 1.92 times (P< 0.001) in fish injected with 16 mol/kg of BaP in the extreme
scenario, suggesting a decerase in the ability of repare oxidative damages in fish
exposed to extreme scenario. There was no significant interaction between scenarios
and treatments (P = 0.604) (Figure 2).
There was no difference in Catalase (CAT) activity in all treatments of fish
exposed to the current scenario. The same behavior occurred in the extreme scenario
(Figure 3). Comparing the scenarios (current and extreme) and the same treatments
(control group, 8 mol/kg and 16 mol/kg of BaP), CAT activity decreased in all
treatments exposed to the extreme scenario, showing the same behavior of GST. CAT
activity decreased 1.27 times in control group P = 0.027), 1.47 times (P = 0.002) in fish
injected with 8 mol/kg of BaP, and 1.57 times (P < 0.001) in fish injected with 16
mol/kg of BaP in the extreme scenario in comparison with the current scenario. There
was not a significant interaction between scenarios and tratments (P = 0.299).
Hepatic LPO levels did not change after exposure to different BaP treatments in
fish exposed to the current scenario, revealing no membrane damage in the analyzed
fish (Figure 4). We observed in fish exposed to the extreme scenario a decrease in LPO
levels of fish injected with BaP in comparison with the control. Hepatic LPO levels
dropped 1.28 times in fish injected with 8 mol/kg of BaP (P = 0.008) and 1.22 times in
fish injected with 16 mol/kg of BaP (P = 0.027). LPO levels decreased in all treatments
exposed to the extreme scenario compared with the same treatments in the current
scenario. LPO levels decreased 1.21 times (P = 0.004) in control group, 1.62 times (P <
0.001) in fish injected with 8 mol/kg of BaP, and 1.44 times (P < 0.001) in fish injected
88
with 16 mol/kg of BaP (P<0.001) in the extreme scenario in comparison with the
current scenario.
3.4. Liver histology
The liver parenchyma is morphologically composed of polyhedral hepatocytes,
typically with a central nucleus, organized into two cells ticks and surrounded by
sinusoidal epithelial cells (Figure 5A and Figure 6A). Glycogen deposits and fat storage,
often dissolved during the routine histological process, produce considerable
histological variability. In the present work we observed that Colossoma macropomum
liver contains pancreatic tissue, also called “hepatopancreas”. C. macropomum from
control group exposed to current and extreme scenarios presented a typical liver
organization. The Histopathological Damage Index (HDI) (Table 4) was 36.1 ± 3.0 in the
control group from the current scenario and 36.3 ± 4.6 in the control group in the
extreme scenario. In both groups (current and extreme scenarios), no statistic
difference was observed and the HDI was classified as moderate to severe damages
according to Poleksic and Mitrovic-Tutundsic (1994). The HDI increased in fish injected
with 8 and 16mol/kg of BaP (HDI: 146.9 ± 2.11 and 144,0 ± 1.9 respectively) in the
current scenario (P<0.001). We also observed these results in fish exposed to the
extreme scenario (8 mol/kg (HDI: 147.3 ± 2.3) and 16 mol/kg (HDI: 142.6 ± 2.6)
(P<0.001). Thus, for both scenarios the fish injected with BaP had the HDI classification
as irreparable damage (Poleksic and Mitrovic-Tutundsic, 1994). No differences were
observed between fish kept at the two scenarios neither significant interation between
scenarios and treatments (Table 4).
Cellular and nuclear hypertrophies (Figure 5B) were alterations observed in low
(0+) and moderate frequency (+) for all treatments. Sinusoidal dilatation (Figure 6 B)
was frequent in fish injected with BaP (8 and 16 mol/kg). Nuclear vacuolization was
absent (0) in control group exposed in the current scenario, but appeared with low
frequence (0+) in all treatments in the extreme scenario (Figure 5C). Sinusoidal
dilatation and vessel congestion also occurred (Figure 5C and 6D). Another tissue
damage observed was pyknotic nuclei (Figure 6C). In fish injected with BaP, the
89
incidence of damages was irreparable, independent of the scenarios. The occurrence of
vacuolization (Figure 5F), cellular disrupts (Figure 5E and 6C) and necrosis was more
frequent (Figures 5D and 5E and Figure 6E and 6F).
3.5. Gene expression
The oncogene ras behaved differentially between the two studied scenarios.
However, we observed no differences in ras expression when BaP doses (0, 8 and 16
mol/kg) were considered in the current scenario. In the extreme scenario, though, BaP
doses had a positive effect on ras expression in liver. In fact, the injection of BaP at 8
mol/kg overexpressed ras oncogene was by 12.26-fold, and the injection of 16 mol/kg
overexpressed this gene by 8.23-fold (Figure 7A). The comparison of the same
treatments between the different scenarios showed an increase in the relative
expression of ras oncogene in the liver of animals exposed to the extreme scenario over
the animals at the current scenario. Ras oncogene was overexpressed 2.86-fold in fish
exposed to 8 mol/kg (P<0.001) of BaP and 2.46-fold in fish exposed to 16 mol/kg
(P<0.001) of BaP in extreme scenario compared to the current scenario (Figure 7A).
There was a statistically significant interaction between scenarios and treatments (8 and
16 mol/kg of Bap) (P <0.001).
No difference was observed in the relative expression of the gene hypoxia
inducible factor-1 in the livers of fish exposed to current scenario in all treatments.
However, in fish exposed to the extreme scenario, hif-was overexpressed 2.35-fold
in fish exposed to 8 mol/kg and 2.44-fold in fish exposed to 16 mol/kg of BaP. The
relative expression of hif- increased in C. macropomum treated with BaP at the
extreme scenario compared to current scenario. There was a significant interaction
between scenarios and treatments (8 and 16 mol/kg of BaP) (P = <0.001). Hif-1 was
overexpressed 11.82-fold and 9.81-fold in fish exposed respectively to 8 mol/kg and 16
mol/kg of BaP in the extreme scenario compared to the same treatments in fish kept at
the current scenario (Figure 7B).
90
3.6. Multivariate Analysis
Multivariate principal component analysis (PCA) after 30 days exposure revealed
the grouping of different variables. Distribution of PCA in biplot after 30 days exposure
(Figure 8) shows two groups: P1 is the scenarios (current scenario and extreme
scenario) and P2 is the treatments (0, 8, and 16 mol/kg of BaP) for the observed
variables. Most variables are clustered and well explained in fish exposed to the
extreme scenarios. Fish injected with 16 mol/kg of BaP explains the hematological
variables (Ht, MCH, MCV and MCHC), the liver histopathology, and the DNA damage.
Fish injected with 8 mol/kg of BaP grouped the variables Hb, RBC and glucose levels.
GST, CAT and LPO clustered together in P1, showing the influence of the current
scenario. Ras oncogene and hif-1are grouped together and are well explained by the
extreme scenario. All groups are compared and the variation among all parameters is
explained by P1=37% and P2=17%.
4. Discussion
Currently, there is a consensus that climate change is a global threat and a
challenge for the 21st century. A great deal of information is available demonstrating
how the increased temperature may affect aquatic ecosystems and living resources.
Many ecosystems are also affected by human releases of contaminants from land-
based sources or from the atmosphere, which also causes severe effects. So far, these
two significant stressors (climate change and pollutants) have been discussed
independently (Schiedek et al., 2007) and there is a lack of information about the joint
effects in ecosystems in general. Herein we analyzed the combined effect of the
carcinogenic pollutant benzo[a]pyrene adding the consequences of the increase in
atmospheric CO2 and temperature over the Amazon fish Colossoma macropomum
exposed to the extreme A2 scenario, as forecasted by IPCC (2007).
Hematological parameters are commonly used as an index to detect
physiological changes in many fish species and to assess structural and functional
health during stress conditions (Adhikari et al., 2004, Barcellos et al., 2004). In the
91
present study there was no alteration in Ht, Hb, RBC, MCV, CHCV in all treatments and
scenarios during the 30 days exposure. Oliveira and Val (2016), studying the influence
of four IPCC (2007) scenarios (B1, A1B, and A2) in C. macropomum without the
presence of a pollutant, observed an increase in Ht levels after 30 days exposition in
scenario A2. Kaya et al. (2016), studying Oreochromis mossambicus exposed to two
different temperature and carbon dioxide partial pressure levels for about two weeks,
observed in the group exposed to CO2 at 25 oC changes in hematology (RBC, Hb, Ht,
MCV, MCH, MCHC), but at the end of the first week (7days), the parameters returned to
the normal values at the end of the trial (14 days), what was explained by the operation
of the adaptation mechanism (Kaya et al., 2016). Similarly, in another study conducted
by Fivelstad et al. (2003) on Atlantic salmons, fish were exposed to 16 and 24 mg/L
CO2 for 57 days and, at the end of the test, no difference was detected in hematologic
parameters (Ht, Hb, and MCH) among experimental and control fish. Studyng the
Korean rockfish Sebastes schlegeli (Hilgendorf) exposed to 7,12-
dimethylbenzo(a)anthracene, Jee et al. (2006) showed a decrease in RBC, Hb and Ht
while the levels of MCH, MCHC and MVC revealed no difference from control.
In the present work, we observed an increase in MCH in the group of fish
exposed to 16 mol/kg of BaP in the extreme scenario in comparison with the control
group. No alteration in MCH was observed in the other treatments and scenarios.
Oliveira and Val (2016) also observe an alteration in MCH cells in C. macropomum
exposed to the various scenarios (B1, A1B, and A2); significant variations of MCH (P =
0.016) occurred at the 15 and the 30-days checkpoints. At the 15 days checkpoint, the
fish exposed to extreme scenario had an increase in MCH in comparison with the
current scenario, and after the 30 days exposure, the MCH decreased in fish exposed
to extreme scenario. In our study the contrary occurred; after 30 days exposure the
MHC was higher in fish exposed to extreme scenario and injected with 16 mol/kg of
BaP in comparison with the same treatment in the current scenario. Despite the studies
with PAH as 7,12dimethylbenz(a)anthracene and phenanthrene revealing a disruptive
action of the PAH on the erythropoietin tissue compromising the viability of the maturing
cells and haematological parameters (Jee and Kang 2004, Jee et al., 2006), in the
92
present work the single alteration observed was in fish treated with 16 mol/kg of BaP in
MCH parameter.
Physical, chemical and biological agents can act in the DNA, resulting in
mutation involved in cancer. Thus, genotoxic tests are required by regulatory agencies
to evaluate the potential risk of cancer. Among these tests, the Comet Assay (CA) is
commonly used (Araldi et al., 2015). CA also allows detecting breaks in DNA strands,
which can be visualized by the increased migration of free DNA segments, resulting in
images similar to comets, justifying the name of the assay (Azqueta and Collins, 2013).
The CA has been used in multiple freshwater and marine fish species as an indicator of
DNA damage (Yang et al., 2006, Winter et al., 2004, Bombail et al., 2001).
In the present study, we observed an increase of DNA strand breaks in blood
cells in fish exposed to BaP (8 and 16 mol/kg) in the current scenario, and a significant
difference between the treatments with BaP (8 and 16 mol/kg) in comparison with the
control in the extreme scenario. In comparison between the scenarios only fish injected
with 16 mol/kg of BaP and exposed to the extreme scenario presented an increase in
DNA damage. Flammarion and co-workers (2002) observed an increase of DNA
damage in chub (Leuciscus cephalus) erythrocytes from Mocella River (France)
exposed to areas contaminated with PAH. Izunza and co-workers (2006) also observed
high indices of DNA damage in Oncorhynchus mykiss erythrocytes in fish exposed to
sediment from two rivers contaminated by PAHs. They also showed that the average
comet length increased as the PAH concentration in the sediments increased. BaP is a
potent inducer of DNA damage, as demonstrated by Šrut and co-workers (2010) in
RTG-2 fish cell line after three days of exposure to a concentration range of model
genotoxic agent (BaP).
Climate changes can also affect de levels of DNA strand breaks in fish blood
cells as demonstrated by Lima (2016) in tambaqui exposed to IPCC (2007) scenarios.
Lima (2016) reported that tambaqui exposed for 30 days to both intermediate (A1B) and
extreme (A2) climate change scenarios revealed a significantly higher amount of DNA
damage in blood cells, evidenced by an average of 1.8-fold increase of GDI values, in
relation to fish in the current scenario at the same time of exposure. Our results are in
accordance with Lima (2016) since in extreme scenario fish exposed to 16 mol/kg of
93
BaP presented more DNA strand breaks in comparison with the same treatment in the
current scenario. Multivariate analysis also grouped the DNA damage results in the
concentration of 16 mol/kg of BaP in the extreme scenario, showing that these two
variables had a great influence in DNA strand breaks through comet assay. We may
suggest that the increase in temperature and CO2 in the extreme scenario (A2) may
influence the genotoxic effects of BaP in the higher dose and induce more DNA
damages. Anitha and co-workers (2000) exposed fish Carassius aurata to heat shock at
34 oC, 36 oC and 38 oC and observed an increase in DNA strand breaks in the highest
temperatures. Bruschini and colleagues (2003) also described the effect of increased
temperatures (4, 18, 28 and 37 oC) in mussels’ hemocytes (Dreissena polymorpha). The
data obtained in vivo showed an increased amount of DNA damage at increasing
temperatures in cells directly withdrawn from the mussels. The same authors suggested
that water temperature could alter DNA-damage baseline levels in mussels and suggest
that mussel sensitivity towards environmental pollutants could be temperature
dependent.
Carbon dioxide can also disturb the cell metabolism increasing the reactive
oxygen species (ROS) as demonstrated by Montalto and co-workers (2013) where SH-
SY5Y cell cultures were exposed to 15 mmHg CO2 had an increasing in ROS levels. An
increase in ROS levels serves as a sensor of oxidative stress and can readily damage
biological molecules including DNA (Ray et al., 2012, Sammour et al., 2009). The main
effect of ROS on cells is the damage of nucleic acids. Oxidative DNA damage occurs in
the form of strand breaks and base and nucleotide modifications (Waris and Ahsan
2006).
In the present study, we also evaluated the enzymatic reponse in C.
macropomum; GST and CAT activities, and LPO levels were investigated in fish liver.
There was no difference in GST activity between all treatments in fish exposed to the
current scenario. In the extreme scenario, GST activity had the same behavior as the
current scenario, where no difference was observed. There was a decrease in GST
activity in fish exposed to the extreme scenario in comparison to the current scenario of
2 to 3 fold, suggesting the malfunction of this organ regarding xenobiotic process, since
94
this enzyme acts in the Phase II of xenobiotic metabolism, acting in exogenous
compounds, derived or not from Phase I of biotransformation resulting in the increase of
contaminants solubility in the water and, consequently, in the increase of the removal
rate. An increase in GST activity indicates efficient disposal of such compounds in the
body (Rinaldi et al., 2002). GST activity increases are widely reported in the literature in
fish exposed to pollutants (Jeved et al., 2016, Mohanty and Samanta, 2016, Pereira et
al., 2013). Sadauskas-Henrique and co-workers (2017) observed an increase in GST
activity in C. macropomum acutely (96 h) exposed to BaP (1, 10 and 100 μmolar. Kg-1
of BaP). Conversely, Almeida and co-workers (2012) observed no differences in GST
activity of Dicentrarchus labrax L. exposed for 96h to BaP. Also, Beyer and colleagues
(1997) found no difference in GST activity of Platichthys flesus L. exposed to
benzo[a]pyrene; 2,3,3`,4,4`,5-hexachlorobiphenyl (PCB-156) and cadmium. Glutathione
S-transferase (GST) activities also remained unaffected by any of the treatments with
BaP (2, 4, 8, 16, 32, 64, 128 and 256 μg. L−1) in flatfish dab (Limanda limanda) (van
Shanke et al., 2000).
In the present work, the decrease in GST response was observed 30 days after
the injection at the extreme scenario; temperature and CO2 levels probably influenced
the decline in GST activity over the pollutant effect. Some authors suggest that there is
no involvement of GST in detoxifying the BaP (Collier and Varanasi 1991, Lemaire et
al., 1992). The increase of temperature influences parameters such as metabolic rate
and oxygen consumption, and frequently causes oxidative stress in the ectothermic
organisms (Bagnyukova et al., 2007). Thus, the induction of antioxidant defenses is an
essential part of the stress response against oxidative stress in biological systems
(Parihar et al., 1997). Our results are in accordance with Bagnyukova and co-workers
data (2007) where goldfish (Carassius aurata) were acutely moved from 3 to 23 oC,
and, as consequence, GST activities increased in the brain after 48 h exposure at the
warmest temperature, but decreased again to initial values by 120 h. Liver GST activity
was unaffected by the experimental conditions in goldfish.
Changes in environmental conditions such as thermal stress and pollution can
lead to oxidative stress in organisms by the production of Reactive Oxygen Species
(ROS) (Ahmed, 2005, Helliwel 1994). Aerobic organisms face challenges associated
95
with the formation of reactive oxygen species (ROS), including superoxide (O2•–),
hydroxyl radical (–OH) and the peroxyl radical (ROO•) (Halliwell and Gutteridge, 1999).
The challenges associated to ROS include several cellular components: lipids, proteins,
free amino acids, DNA, and carbohydrates (Toyokuni, 1999; Abele and Puntarulo,
2002). To cope with oxidative stress, the cell has a nonenzymatic and enzymatic
antioxidant system involved in many cellular reactions to removal of ROS (van der Oost
et al., 2003, Fang et al., 2002).
One of these enzymatic systems involves catalase (CAT). Catalase reduces
H2O2 to water, prevents oxyradical formation, and intercepts oxidative propagation
reactions promoted by the oxyradicals (Bainy et al. 1996). We didn’t observe any
alteration in CAT activity of fish injected with BaP in fish exposed to the current and
extreme scenario. Similar to GST, CAT activity decreased in all treatments in fish
exposed to the extreme scenario.
Catalase activity in the liver was not affected in Dicentrarchus labrax exposed in
vivo to chronic hydrocarbon pollution (Danion et al., 2014). Pan and co-workers (2009)
verified that the exposure to different concentrations of benzo(a)pyrene (BaP) (0.5 μg/L,
1.0 μg/L, 10.0 μg/L and 50.0 μg/L) in scallop Chlamys farreri for 30 days in seawater
resulted in the increase of CAT activity after 6 and 3 days exposure to 0.5 and 1.0 μg/L,
respectively, presenting a decrease to control levels after the entire experimental
period. The CAT activities of fish exposed to 10.0 μg/L and 50.0 μg/L BaP decreased
during the entire experimental period. In our experiment, we verified no change of CAT
activity. It is most probable that the CAT activity dropped to the control level at the end
of the 30 days due to cellular malfunction. No difference was observed in CAT activity
o in C. macropomum exposed to intraperitoneal injection of 1000 μmolar Kg-1 BaP for
96 h, as describe by Sadauskas-Henrique and collaborators (2017). Madeira and co-
workers (2013) described the effect of temperature (24 to 32 oC) in CAT activity in
Diplodus sargus, which presented significant changes in fish exposed to increasing
temperature; and in Diplodus vulgaris the opposite occurred, with a significant decrease
in fish exposed to higher temperature (2.6-fold decrease as temperature increased).
Some reactive oxygen species possess sufficient energy to initiate lipid
peroxidation in biological membranes, self-propagating reactions with the potential to
96
damage membranes by altering their physical properties and ultimately their function
(Crockett 2008). Some ROS can initiate lipid peroxidation (LPO), a self-propagating
process in which a peroxyl radical is formed when a ROS has sufficient reactivity to
abstract a hydrogen atom from an intact lipid (Halliwell and Gutteridge, 1999). The
membrane peroxidation reaction is initiated when there is a subtraction of allylic
hydrogen, carbon which is adjacent to the double bond, the ROS as ●OH, thereby
forming a lipid peroxy radical (L-OOH). Thus, a molecule ●OH can generate
propagation of the lipid peroxidation, which leads to changes in membrane fluidity and
permeability, impairing cell function and tissue of animals (Sadauskas-Henrique, 2015).
In the present work, we observed no change in hepatic LPO levels in fish
exposed to different concentration of BaP kept in the current scenario. Instead, in the
extreme scenario, fish exposed to BaP decrease LPO levels, again suggesting an
impairment of antioxidant defense of the cell. LPO levels declined in all treatments at
the extreme scenario in comparison with the same treatments of the current scenario.
Several works had related a different result for LPO levels in fish exposed to pollutants,
increasing the lipid peroxidation products (Choi and Oris 2000, Sayeed et al., 2003).
Almeida and co-workers (2012) observed high LPO levels in Dicentrarchus labrax L.
exposed to BaP for 96 h. The same was observed by Sadauskas-Henrique and
collaborators (2017) where an increase in LPO levels occurred in C. macropomum
exposed acutely to BaP Injection. Similar to our findings, some authors described low
LPO levels; Solé and co-workers (2008) reported no difference in LPO levels of 8 fish
species (Pagellus acarne, Mullus barbatus, Merluccius merluccius, Trisopterus minutus,
Micromesistius poutassou, Phycis blennoides, Trachyrhynchus scabrous and Galeus
melastomus) sampled in a polluted area in Barcelona coast (NW Mediterranean Sea).
Sagerup and co-workers (2016) verified the biological effects of marine diesel oil
exposure in red king crab (Paralithodes camtschaticus); lipid peroxidation levels in the
low and high exposure groups were significantly lower.
Our results suggest that the extreme scenario in tambaqui injected with BaP
influenced the LPO levels. Madeira and co-workers (2013) verified no alteration in LPO
levels in Diplodus vulgaris exposed to high temperatures. The same authors suggest
that the response is species specific and cannot be generalized to untested organisms
97
(Madeira et al., 2013). Oliveira (2014), studying the levels of stearoyl-CoA (SCD) gene
expression in C. macropomum exposed to different IPCC (2007) scenarios, proposed
that elevation of the temperature and CO2 can alter the lipid properties of the biological
membranes. The effects of temperature and CO2 in SCD influence the physical
properties of lipid complex systems, particularly membrane phospholipids, triglycerides
and cholesterol, which can result in changes of membrane fluidity and lipid metabolism.
Histopathological indicator is a useful tool for fish health monitoring. Histological
analyses provide information about the effects of contaminants in a particular organ and
are also relevant for the assessment of fish stress (Rašković et al., 2013, van der Oost
et al., 2003, Schwaiger et al., 1997). In the present work, we observed an increase liver
damage in C. macropomum exposed to BaP in both scenarios (current and extreme),
and, in opposition of the gene expression results, there was no effect of the extreme
scenario exposure. In fact, fish from both scenarios and exposed to BaP presented
cellular vacuolization, deformation in cell shape, nuclear degeneration, cytoplasmic
degeneration and cell disruption. Leite and co-workers (2015) observed cytoplasmic
vacuolization, nucleus abnormally located in the cell periphery and changes in cell
shape in Oreochromis niloticus exposed to high doses of water-soluble fraction (WSF).
These are considered responses to stressors since they are indicative of the functional
activation of this organ. Cellular vacuolization is an alteration described after
contamination of a lot of pollutants as organophosphorus (Fanta et al., 2003), chromium
(Mishra and Mohanty 2008), paraquat (Salazar-lugo et al., 2011) and heavy oil (Pal et
al., 2011). Cytoplasmic vacuolization is usually produced by deposition of glycogen and
lipids (Myers et al., 1987), which will eventually lead to the displacement and
deformation of the nucleus (Holm et al., 1991).
The most relevant histological alterations observed in the liver of Prochilodus
lineatus exposed to WSD were biliary stagnation, nuclear and cellular degeneration
(Simonato et al., 2008). We also observed nuclear and cellular degeneration in C.
macropomum exposed to BaP. In our experiment, fish injected with BaP showed
necrosis and leucocytes infiltration. Khan (1998) found necrosis in winter flounder
(Pleuronectes americanus) sampled next to a petroleum refinery. Necrosis was
frequently recorded in the BaP-exposed rainbow trout, often accompanied by massive
98
infiltration with inflammatory cells (Malmstrom et al., 2004). Herein, the observed HP in
C. macropomum indicates that this species is sensible to BaP exposure so that necrosis
occur impairing the proper function of the organ, what is evidenced by our enzyme
measurements.
Oncogenes are altered cellular genes that disrupt the control systems of cell
growth and cell differentiation and, in this way, contribute to the development of cancer
cells (Bishop, 1987). The ras oncogene is considered one of the most important genes
involved in multistep carcinogenesis (Bos, 1989). Ras genes are a ubiquitous eukaryotic
gene family identified in mammals, birds, fishes, insects, mollusks, plants, fungi, and
yeasts. Sequence analysis of these genes and their products has revealed a high
degree of conservation, which suggests that they may play a fundamental role in
cellular proliferation (Barbacid, 1987). Ras genes have been characterized in several
fish species, and they all had a high degree of nucleotide sequence and deduced amino
acid similarity with the mammalian ras gene (Rotchell et al., 2001, Vincent et al., 1998).
In the present work we observed, exposure to different BaP dosages at the
current scenario caused no difference in ras oncogene expression. Nogueira and co-
workers (2006) described similar results studying European eel (Anguilla anguilla L.)
exposed during one month to BaP; no mutations or changes in ras oncogene
expression levels occurred compared to control fish. Later, Nogueira and co-workers
(2010) also found no alteration in ras oncogene expression in the liver of Dicentrarchus
labrax and Liza aurata colected in a contaminated coastal lagoon from River Aveiro,
Portugal.
Conversely, the exposure to the future scenario caused an increase in ras
oncogene expression in C. macropomum injected with BaP (8 and 16 mol/kg)
suggesting that the extreme increase in the mean temperature and CO2 magnified the
effects of this HPA, one of the strongest pollutant derived from petroleum. Most works
with fish ras oncogene describe the hot spots for the mutation that can induce cancer
(Cronin et al., 2002, Vincent et al., 1998, Torten et al., 1996). Ras gene mutation is
considered to develop cancer, and its overexpression is the second mechanism
implicated in carcinogenesis (Nogueira et al., 2006). In a previous experiment, we
verified the overexpression of ras oncogene on the liver of C. macropomum acutely
99
exposed to 8 and 16 mol/kg of BaP (96 h) (Silva et al., accepted for publication). Lee
and co-workers (2006) described the up-regulation of c-K-ras (long form) in the liver of
Rivulos mamoratus treated with a 4-nonylphenol endocrinal disruptor, but there was no
significant up-regulation of c-Ki-ras (short form). R-ras gene was also up-regulated on
the liver of Kryptolebias marmoratus after exposure to an endocrine-disrupting
chemical. The authors showed that the liver showed the highest level of expression
compared to other tissues, even though each R-ras gene showed different expression
patterns in tissues (Rhee et al., 2009).
Another gene involved in neoplasia development is the hypoxia inducible factor-
1 (hif-1). Most of the works with hif-1 expression in fish are related to environmental
hypoxia (Rimoldi et al., 2012, Shen et al., 2010). However, this gene is also related to
the development of tumor and is overexpressed in the cancer cellular environment
(Wong et al., 2003, Law et al., 2008). Herein, we observed no alteration in hif-1
expression in fish exposed to different treatments of BaP in the current scenario.
However, hif-1 was overexpressed in fish injected with BaP and exposed to extreme
scenario, both compared to fish injected with corn oil (control), and with fish with similar
treatments in the current scenario. Yu and co-workers (2008) examined the expression
of four hypoxia-responsive genes (HIF-1-mediated) – igfbp (insulin-like growth factor
binding protein), epo (erythropoietin), ldh-a (lactate dehydrogenase-a isoform) and vegf
(vascular endothelial growth factor) in the orange-spotted grouper (Epinephelus
coioides) upon single and combined exposures to BaP and hypoxia. BaP in normoxic
condition did not induce the expression of any of the above-mentioned genes. Instead,
we observed an overexpression of hif-1 on the liver of C. macropomum acutely
exposed to BaP (4, 8, 16 mol/kg) in normoxic environment (Silva et al., accepted for
publication).
In the present work, we observed an increase on the relative expression of ras
oncogene and hif-1 gene in fish injected with BaP and exposed to the extreme
scenario compared with fish exposed to BaP in the current scenario, what was
corroborated by the PCA analysis. The effect of increased temperature and CO2 is
manifested at all levels in the organism, from genes to behavior; and changes in
100
temperature over diel or seasonal periods induce shifts in a variety of gene transcripts
expression levels that result in numerous metabolic and hormonal adaptations
(Hochachka and Somero, 2002). Moreover, temperature-driven gene expression
changes in fish adapted to differing thermal environments are constrained by the level
of gene pleiotropy, estimated by either the number of protein interactions or gene
biological processes (Papakostas et al., 2014). This must be the case of both genes
studied herein; oncogene ras and hif-1, which, as already mentioned, are responsible
by the control of a series of other gene transcripts.
Rissanen and co-workers (2006) verified the effect of different temperatures (8,
18 and 26 oC) over HIF-1 in crucian carp (Carassius carassius). Temperature had a
significant effect on HIF-1 protein amounts in the liver and gills of crucian. In the heart,
acclimation to cold (8 °C) increased HIF-1a protein amounts slightly, but not
significantly. Mladineo and Block (2009), studying the effects of chronic warm (23 oC)
and cold (15 oC) exposure in bluefin tuna (Thunnus sp), observed an increase in the
amount of hif-1 transcripts in liver. No information is available in the literature
regarding the effects of temperature on ras oncogene expression in fish. However it is
already known that temperature influences the patterns of gene expression (Hochachka
and Somero, 2002; Gutierrez de Paula et al., 2014). As occured with hif-1a relative
expression in C. macropomum injected with BaP, an increase in ras relative expression
was observed in fish injected with BaP and exposed to the extreme scenario, where the
temperature is 4.5 degrees higher than the current scenario. Eisenmann and Kim
(1997) described the substitution of leucine (L) by phenylalanine (F) at amino acid 19, a
conserved residue of H-Ras, after the in vivo exposure to different temperatures (15 o,
20 o, 24 o, 37 o and 42 oC); finding a temperature-dependent GTPase activity. In the
present work, the new scenario, where temperature was increased, magnified the
effects of BaP on oncogene ras and hif-1 gene expression. Temperature is generally
assumed to be positively correlated with toxic effects. This has been attributed to
increased uptake and increased accumulation of the toxicant at higher temperatures
(Holmstrup et al., 2010). Herein we evaluated the combination of increased
temperature, CO2 and pollutant, what may be a dangerous threat in the near future for
101
fish of the Amazon due to both ongoing climate changes and increased pollution
activities.
In the current scenario there was not an increase in gene expression in
oncogene ras and hif-1 in fish injected with BaP in comparison with the control.
Otherwise, the GST and CAT activity and LPO levels were higher than fish under the
same treatments exposed to the extreme scenario. The activity of enzymes contributes
to cellular maintenance even in treatments where the fish received BaP injection and
tissue damage was severe.
5. Conclusions
The present work shows that climate changes as proposed by IPCC (2007) in the
extreme scenario (A2) magnifies the action of the contaminant (BaP), increasing the
expression of the ras oncogene and hif-1 gene. Overexpression of both genes in the
extreme scenario in fish injected with BaP can be explained by the increased metabolic
demands of the liver for maintaining cellular integrity since ras is involved with the
control of the cell cycle, and hif-1 participates in cell proliferation and erythropoiesis.
The increase in ras oncogene and hif-1 expression compensates for the low
responses of GST, CAT, and LPO, helping to maintain cell survivor since liver tissue in
fish injected with BaP in the extreme scenario was greatly injured. After 30 days
exposuer to climate changes, the biomarkers GST, CAT, and LPO did not present
differences in the extreme scenario, showing maladaptive responses to oxidative stress
that needs to be better understood. The blood cells DNA strand breaks were expected
in fish exposed to BaP, but the effect of the A2 (IPCC, 2007) scenario magnified the
genotoxicity in fish injected with 16mol/kg BaP. Irreparable tissue damage occurred in
both scenarios, where fish exposed to BaP presented necrosis. So, fish cellular
defenses to BaP were diminished as fish were kept in the extreme scenario due to
magnification of some damages, and impairment of antioxidant metabolism. As a
consequence, the overexpression of ras and hif-1 was the way the cells responded to
keep fish survival in such conditions. Further studies are needed to find out these
responses in a prolonged period under such extreme scenario.
102
Acknowledgments: FAPEAM and CNPq supported this study through INCT-ADAPTA
grant to ALV. We thank Julie Andrez de Andrade Paredes and Juliana Freitas their
assistance in realize the experiment. Thank for SERPROR for the donation of the fish
used in the experiment. Thanks are also due to the personnel of the Functional
Histology Laboratory of the Federal University of Amazonas for their support with the
preparation of histological material.
6. References
Abele, D., Heise, K., Pörtner, H. O., & Puntarulo, S. (2002). Temperature-dependence of mitochondrial function and production of reactive oxygen species in the intertidal mud clam Mya arenaria. Journal of Experimental Biology, 205(13), 1831-1841. Adhikari, S., Sarkar, B., Chatterjee, A., Mahapatra, C. T., & Ayyappan, S. (2004). Effects of cypermethrin and carbofuran on certain hematological parameters and prediction of their recovery in a freshwater teleost, Labeo rohita (Hamilton). Ecotoxicology and Environmental Safety, 58(2), 220-226. Ahmed, R.G., 2005. Is there a balance between oxidative stress and antioxidant defense system during development? MJIAS 15 (2), 55–63. Almeida J.R.; Gravato C. and Guilhermino L. (2012). Biological parameters towards polycyclic aromatic hydrocarbons pollution: A Study with Dicentrarchus labrax L. Exposed to the Model Compound Benzo(a)pyrene. Water Air and Soil Pollution, 223(8):4709-4722. Anitha, B., Chandra, N., Gopinath, P. M., & Durairaj, G. (2000). Genotoxicity evaluation of heat shock in gold fish (Carassius auratus). Mutation Research/Genetic Toxicology and Environmental Mutagenesis, 469(1), 1-8.
Araldi, R.P., de Melo, T.C., Mendes, T.B., de Sa Junior, P.L., Nozima, B.H.N., Ito, E.T., de Cassia Stocco, R. (2015). Using the comet and micronucleus assays for genotoxicity studies: a review. Biomedicine & Pharmacotherapy, 72: 74-82.
Azqueta, A. and Collins, A.R. (2013). The essential comet assay: a comprehensive guide to measuring DNA damage and repair. Archives of toxicology, 87(6): 949-968.
Bagnyukova, T.V., Lushchak, O.V., Storey, K.B., & Lushchak, V.I. (2007). Oxidative stress and antioxidant defense responses by goldfish tissues to acute change of temperature from 3 to 23 C. Journal of Thermal Biology, 32(4), 227-234. Bainy, A., Saito, E., Carvalho, P., Junqueira, V. (1996) Oxidative stress in gill, erythrocytes, liver and kidney of Nile tilapia (Oreochromis niloticus) from a polluted site. Aquatic Toxicology. 34:151–162. Barbacid, M. (1987). Ras genes. Annual review of biochemistry, 56(1), 779-827.
Barcellos, L.J.G., Kreutz, L.C., Souza, C., Rodriguez, L.B., Fioreze, I., Quevedo, R.M., Cericato, L., Soso, A.B., Fagundes, M., Conrad, J., Lacerda, L.A., Terra, S. (2004). Haematological changes in Jundia
103
(Rhamdia quelen) after acute and chronic stress caused by usual aquacultural management, with emphasis on immunosuppressive effects. Aquaculture, 237: 229–236.
Beutler, E. (1975). Red Cell Metabolism: A manual of biochemical methods. Grune & Straton, New York.
Bos, J.L., 1989. Ras oncogenes in human cancer: a review. Cancer Research, 49: 4682–4689. Beyer, J., Sandvik, M., Skare, J. U., Egaas, E., Hylland, K., Waagbo, R., & Goksoyr, A. (1997). Time-and dose-dependent biom arker responses in flounder (Platichthys flesus L.) exposed to benzo [a] pyrene, 2, 3, 3′, 4, 4′, 5-hexachlorobiphenyl (PCB-156) and cadmium. Biomarkers, 2(1), 35-44. Bishop, J.M. (1987) The molecular genetics of cancer, Science. 235: 305-311. Bombail, V., Aw, D., Gordon, E., Batty,J. (2001) .Application of the comet and micronucleus assay to butter fish (Pholis gunnellus) erythrocytes from the Firth of Forth, Scotland. Chemosphere, 44: 383–392.
Bos, J.L. (1988). The ras gene family and human carcinogenesis. Mutation Research/Reviews in Genetic Toxicology, 195(3), 255-271. Boyd, C.E.; Tucker, C.S. (1992). Water quality and pond soil analysis for aquaculture. Auburn: Auburn University. 183p.
Bradford, M.M. (1976). A rapid and sensitive method for the quantification of microgram quantities of
protein utilizing the protein-dye binding. Analytical Biochemistry, 72:248-254.
Brandão, R.M.L. Efeitos do hormônio do crescimento recombinante bovino (rbgh lactotropin
®) na
expressão do gene igf-i e parâmetros fisiológicos em juvenis de tambaqui (Colossoma macropomum)/ Rúbia Maielli Lima Brandão. Dissertação (mestrado) Newton Lins, Manaus, 2015. Orientador: Dra.Vera Maria Fonseca de Almeida e Val. Área de concentração: Aquicultura. Brow, B.A. 1976. Hematology: principles and procedures. 2ª ed. Philadelphia. Lea & Febiger.
Buschini, A., Carboni, P., Martino, A., Poli, P., & Rossi, C. (2003). Effects of temperature on baseline and genotoxicant-induced DNA damage in haemocytes of Dreissena polymorpha. Mutation Research/Genetic Toxicology and Environmental Mutagenesis, 537(1), 81-92. Cavas, T. (2011). In vivo genotoxicity evaluation of atrazine and atrazine–based herbicide on fish Carassius auratus using the micronucleus test and the comet assay. Food and Chemical Toxicology, 49(6), 1431-1435.
Choi, J., and Oris, J. T. (2000). Anthracene photoinduced toxicity to plhc‐1 cell line (Poeciliopsis lucida)
and the role of lipid peroxidation in toxicity. Environmental toxicology and chemistry, 19(11), 2699-2706. Collier T.K. & Varanasi U. (1991). Hepatic activities of xenobiotic metabolizing enzymes and biliary levels of xenobiotics in English sole (Parophrys vetulus) exposed to environmental contaminants. Archives of Environmental Contamination Toxicology, 20:462–73.
Comte, L., Buisson, L., Daufresne, M., & Grenouillet, G. (2013). Climate‐induced changes in the
distribution of freshwater fish: observed and predicted trends. Freshwater Biology, 58(4), 625-639. Crockett, E.L. (2008). The cold but not hard fats in ectotherms: consequences of lipid restructuring on susceptibility of biological membranes to peroxidation, a review. Journal of Comparative Physiology B, 178(7), 795-809.
104
Cronin, M.A., Wickliffe, J.K., Dunina, Y., Baker, R.J. (2002). K-ras oncogene DNA sequences in pink salmon in streams impacted by the Exxon Valdez oil spill: no evidence of oil-induced heritable mutations. Ecotoxicology, 11: 233–241. Cui, H., Grosso, S., Schelter, F., Mari, B., and Krüger, A. (2012). On the pro-metastatic stress response to cancer therapies: evidence for a positive co-operation between TIMP-1, HIF-1α, and miR-210. Frontiers in pharmacology.3: 134. Danion, M., Le Floch, S., Lamour, F., & Quentel, C. (2014). EROD activity and antioxidant defenses of sea bass (Dicentrarchus labrax) after an in vivo chronic hydrocarbon pollution followed by a post-exposure period. Environmental Science and Pollution Research, 21(24), 13769-13778.
Eisenmann, D.M., & Kim, S.K. (1997). Mechanism of activation of the Caenorhabditis elegans ras homologue let-60 by a novel, temperature-sensitive, gain-of-function mutation. Genetics, 146(2), 553-565. Elith J., Kearney M. & Phillips S. (2010) The art of modeling range-shifting species. Methods in Ecology and Evolution. 1: 330–342. Fang, Y. Z., Yang, S., & Wu, G. (2002). Free radicals, antioxidants, and nutrition. Nutrition, 18(10), 872-879. Fanta, E., Rios, F. S. A., Romão, S., Vianna, A. C. C., & Freiberger, S. (2003). Histopathology of the fish Corydoras paleatus contaminated with sublethal levels of organophosphorus in water and food. Ecotoxicology and environmental safety, 54(2), 119-130. Ficke, A.D., Myrick, C.A., & Hansen, L.J. (2007). Potential impacts of global climate change on freshwater fisheries. Reviews in Fish Biology and Fisheries, 17(4), 581-613. Fivelstad, S., Waagbø, R., Zeitz, S.F., Hosfeld, A.C.D., Olsen, A B., & Stefansson, S. (2003). A major water quality problem in smolt farms: combined effects of carbon dioxide, reduced pH and aluminium on Atlantic salmon (Salmo salar L.) smolts: physiology and growth. Aquaculture, 215(1): 339-357. Flammarion, P., Devaux, A., Nehls, S., Migeon, B., Noury, P., & Garric, J. (2002). Multibiomarker responses in fish from the Moselle River (France). Ecotoxicology and environmental safety, 51(2), 145-153. García-Tavera, J.L., Valdés-Lozano, D., Poblete-Naredo, I., Albores-Medina, A., & Zapata-Pérez, O. (2013). Bile benzo [a] pyrene concentration and hepatic CYP1A induction in hypoxic adult tilapia (Oreochromis niloticus). Chemosphere, 92(1), 16-23. González-Doncel, M., González, L., Fernández-Torija, C., Navas, J. M., & Tarazona, J. V. (2008). Toxic effects of an oil spill on fish early life stages may not be exclusively associated to PAHs: studies with Prestige oil and medaka (Oryzias latipes). Aquatic Toxicology. 87(4): 280-288.
Goulding, M., & Carvalho, M. L. (1982). Life history and management of the tambaqui (Colossoma macropomum, Characidae): an important Amazonian food fish. Revista Brasileira de Zoologia, 1(2), 107-133. Gouveia, C., Liberato, M.L.R., DaCamara, C.C., Trigo, R.M., & Ramos, A.M. (2011). Modelling past and future wine production in the Portuguese Douro Valley. Climate Research, 48(2-3), 349-362. Gouveia, C., Trigo, R.M., DaCamara, C. C., Libonati, R., & Pereira, J. (2008). The North Atlantic oscillation and European vegetation dynamics. International Journal of Climatology, 28(14), 1835-1847.
105
Gutierrez de Paula, T. de Almeida, F. L. A., Carani, F. R., Vechetti-Junior, I. J., Padovani, C. R., Salomão, R. A. S., ... & Dal-Pai-Silva, M. (2014). Rearing temperature induces changes in muscle growth and gene expression in juvenile pacu (Piaractus mesopotamicus). Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 169, 31-37. Halliwell, B. (1994). Free radicals, antioxidants, and human disease: curiosity, cause, or consequence?. The lancet, 344(8924), 721-724. Hochachka, P. W., & Somero, G.N. (2002). Biochemical Adaptation, Mechanism and Process in Physiological Evolution Oxford University Press. USA, New York. Hofmann, G.E. & Todgham, A.E. (2010). Living in the now: physiological mechanisms to tolerate a rapidly changing environment. Annual Review of Physiology, 72: 127–145.
Holm, G., Norrgren, L., & Lindén, O. (1991). Reproductive and histopathological effects of long‐term
experimental exposure to bis (tributyltin) oxide (TBTO) on the three‐spined stickleback, Gasterosteus
aculeatus Linnaeus. Journal of fish biology, 38(3), 373-386.
Holmstrup, M., Bindesbøl. A-M., Oostingh, G.J., Duschl A., Scheil V., et al. (2010) Interactions between effects of environmental chemicals and natural stressors: A review. Science of The Total Environment, 408: 3746–3762. Hong, W.J., Jia, H., Li, Y.F., Sun,Y., Liu, X., & Wang, L. (2016). Polycyclic aromatic hydrocarbons (PAHs) and alkylated PAHs in the coastal seawater, surface sediment and oyster from Dalian, Northeast China. Ecotoxicology and environmental safety, 128: 11-20.
International Agency for Research on Cancer, (IARC). (2012). A review of human carcinogens: chemical agents and related occupations. In: IARC Monographs on the Evaluation of Carcinogenic Risks to Humans, vol. 100 F, pp. 111-114. http:// monographs.iarc.fr/ENG/Monographs/vol100F/. Intergovernmental Panel on Climate Change (IPCC). 2007. Summary for Policymakers. In: Solomon, S.; Qin, D.; Manning, M., Chen, Z.; Marquis, M.; Averyt, K.B.; Tignor, M.; Miller, H.L. (Eds). Climate Change 2007: The 117 Physical Science Basis. Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change. Cambridge University Press, Cambridge, United Kingdom and New York, United States of America. p. 1-17. Inzunza, B., Orrego, R., Peñalosa, M., Gavilán, J. F., & Barra, R. (2006). Analysis of CYP4501A1, PAHs metabolites in bile, and genotoxic damage in Oncorhynchus mykiss exposed to Biobio River sediments, Central Chile. Ecotoxicology and environmental safety, 65(2): 242-251. Javed, M., Ahmad, I., Usmani, N., & Ahmad, M. (2016). Bioaccumulation, oxidative stress and genotoxicity in fish (Channa punctatus) exposed to a thermal power plant effluent. Ecotoxicology and environmental safety, 127, 163-169. Jee, J. H., & Kang, J. C. (2004). Effect of phenanthrene on haematological parameters in olive flounder, Paralichthys olivaceus (Temminch et Schlegel). Aquaculture Research, 35(14): 1310-1317.
Jee, J. H., Park, K. H., Keum, Y. H., & Kang, J. C. (2006). Effects of 7, 12‐dimethylbenz (a) anthracene on
growth and haematological parameters in Korean rockfish, Sebastes schlegeli (Hilgendorf). Aquaculture Research. 37(5): 431-442.
Jha, A.N. (2008). Ecotoxicological application and significance of the comet assay. Mutagenesis. 23: 207–221.
106
Jiang, Z.Y., Woolland, A.C.S., Wolf, S.P. (1991). Lipid hydroperoxide measurement by oxidation of Fe2+ in the presence of xylenol orange-comparison with TBA assay and on iodometric method. Lipids 26:777-860. Kampen, E.J. & Zijlstra, W.G. 1964. Standartization of haemoglobinometry. In: Boroviczény, C. G. (Ed.) Erythrocytometric Methods and their standardization. Blibliotheca Haematologica, p.68-72. Karol, I.L., Kiselev, A.A. and Frolkis, V.A. (2011). Indices of the Factors that Form Climate Changes of Different Scales. Atmospheric and Oceanic Physics, 47(4): 415–429. Kitajima, Y., & Miyazaki, K. (2013). The critical impact of HIF-1a on gastric cancer biology. Cancers, 5(1), 15-26. Kaya, H., Hisar, O., Yılmaz, S., Gürkan, M., & Hisar, Ş. A. (2016). The effects of elevated carbon dioxide and temperature levels on tilapia (Oreochromis mossambicus): Respiratory enzymes, blood pH and hematological parameters. Environmental toxicology and pharmacology, 44, 114-119.
Keen, J.H., Habig, W.H., Jakoby, W.B. 1976. Mechanism for the several activities of the glutathione S-transferase. The Journal of Bbiological Chemistry, 251:6183-6188. Khan, R. A. (1998). Influence of petroleum at a refinery terminal on feral winter flounder, Pleuronectes americanus. Bulletin of Environmental Contamination and Toxicology, 61(6), 770-777. Kobayashi, S.C., Morikawa, Y., Hayashi, M., Sofuni, T. (1995). A comparison between manual microscopic analysis and computerized image analysis in the single cell gel electrophoresis assay MMS Community, 2 pp. 103–115. Kolch, W. (2000). Meaningful relationships: the regulation of the Ras/Raf/MEK/ERK pathway by protein interactions. Biochemical Journal, 351(2), 289-305. Law, A. Y., Lai, K. P., Ip, C. K., Wong, A. S., Wagner, G. F., & Wong, C. K. (2008). Epigenetic and HIF-1 regulation of stanniocalcin-2 expression in human cancer cells. Experimental Cell Research, 314(8), 1823-1830. Lee, Y. M., Jung, S. O., Seo, J. S., Yoon, Y. D., & Lee, J. S. (2006). Cloning of Ki-ras and Ha-ras cDNAs from the hermaphroditic fish Rivulus marmoratus (Cyprinodontiformes, Rivulidae) and its expression after exposure to 4-nonylphenol. Marine environmental research, 62, S136-S140. Leite, M.B.N.L., da Cruz, A.L., Rodrigues, L.E.A., Yamashita, S.R., Carqueija, C.R.G., & Nascimento, I. A. (2015). Comparing the Toxicity of Water-Soluble Fractions of Biodiesel, Diesel and 5% Biodiesel/Diesel Blend on Oreochromis niloticus Using Histological Biomarkers. Bulletin of Environmental Contamination and Toxicology, 95(5), 574-581. Lemaire, P., Mathieu, A., Carrière, S., Narbonne, J.F., Lafaurie, M., & Giudicelli, J. (1992). Hepatic biotransformation enzymes in aquaculture European sea bass (Dicentrarchus labrax): kinetic parameters and induction with benzo (a) pyrene. Comparative Biochemistry and Physiology Part B: Comparative Biochemistry, 103(4), 847-853. Lima, M.P. Efeitos das mudanças climáticas sobre a expressão gênica e fisiologia do tambaqui (Colossoma macropomum Cuvier, 1818)/ Marcos Prado Lima. Manaus: AM, 2014. xvii+152p. Tese (doutorado) INPA, Manaus, 2016.Orientador: Dr. Adalberto Luís Val Área de concentração: Genética, Conservação e Biologia Evolutiva. Lotufo, G. R., and Fleeger, J. W. (1997). Effects of sediment-associated phenanthrene on survival, development and reproduction of two species of meiobenthic copepods. Marine Ecology Progress Series, 151: 91-102.
107
Lucas, J., Percelay, I., Larcher, T., & Lefrançois, C. (2016). Effects of pyrolytic and petrogenic polycyclic aromatic hydrocarbons on swimming and metabolic performance of zebrafish contaminated by ingestion. Ecotoxicology and Environmental Safety, 132: 145-152. Madeira, D., Narciso, L., Cabral, H. N., Vinagre, C., & Diniz, M. S. (2013). Influence of temperature in thermal and oxidative stress responses in estuarine fish. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology, 166(2), 237-243. Malmström, C. M., Koponen, K., Lindström-Seppä, P., & Bylund, G. (2004). Induction and localization of hepatic CYP4501A in flounder and rainbow trout exposed to benzo [a] pyrene. Ecotoxicology and environmental safety, 58(3), 365-372.
Manoli, E., & Samara, C. (1999). Polycyclic aromatic hydrocarbons in natural waters: sources, occurrence and analysis. TrAC Trends in Analytical Chemistry, 18(6), 417-428.
Maria, V.L., & Bebianno, M. J. (2011). Antioxidant and lipid peroxidation responses in Mytilus galloprovincialis exposed to mixtures of benzo (a) pyrene and copper. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology. 154(1): 56-63.
Mishra, A.K., & Mohanty, B. (2008). Acute toxicity impacts of hexavalent chromium on behavior and histopathology of gill, kidney and liver of the freshwater fish, Channa punctatus (Bloch). Environmental Toxicology and Pharmacology, 26(2), 136-141. Mladineo, I., & Block, B.A. (2009). Expression of Hsp70, Na+/K+ ATP-ase, HIF-1α, IL-1β and TNF-α in captive Pacific bluefin tuna (Thunnus orientalis) after chronic warm and cold exposure. Journal of Experimental Marine Biology and Ecology, 374(1), 51-57. Mohanty, D., and Samanta, L. (2016). Multivariate analysis of potential biomarkers of oxidative stress in Notopterus notopterus tissues from Mahanadi River as a function of concentration of heavy metals. Chemosphere. 155: 28-38. Montalto, A. S., Currò, M., Russo, T., Visalli, G., Impellizzeri, P., Antonuccio, P., ... & Romeo, C. (2013). In vitro CO2-induced ROS production impairs cell cycle in SH-SY5Y neuroblastoma cells. Pediatric surgery international, 29(1), 51-59. Moore, M.J., Smolowitz, R., and Stegeman, J.J. (1989). Cellular alterations preceding neoplasia in Pseudopleuronectes americanus from Boston Harbor. Marine Environmental Research, 28(1-4), 425-429. Myers, M.S., Olson, O.P., Johnson, L.L., Stehr, C.S., Hom, T., & Varanasi, U. (1992). Hepatic lesions other than neoplasms in subadult flatfish from Puget Sound, Washington: relationships with indices of contaminant exposure. Marine Environmental Research, 34(1-4), 45-51.
Myers, M.S., Rhodes, L.D., & McCain, B.B. (1987). Pathologic anatomy and patterns of occurrence of hepatic neoplasms, putative preneoplastic lesions, and other idiopathic hepatic conditions in English sole (Parophrys vetulus) from Puget Sound, Washington. Journal of the National Cancer Institute, 78(2), 333-363. Navarro, C.E.K.G.; Pachaly, J.R. 1994. Manual de hematologia veterinária. São Paulo: Varela. p. 74–75.
Nogueira, P., Pacheco, M., Pereira, M. L., Mendo, S., & Rotchell, J. M. (2010). Anchoring novel molecular biomarker responses to traditional responses in fish exposed to environmental contamination. Environmental Pollution, 158(5), 1783-1790. Nogueira, P. R., Lourenço, J., Mendo, S., & Rotchell, J. M. (2006). Mutation analysis of ras gene in the liver of European eel (Anguilla anguilla L.) exposed to benzo [a] pyrene. Marine pollution bulletin. 52(12): 1611-1616.
108
Oliveira, A.M. Influência da temperatura ambiental e dos cenários climáticos futuros sobre os ácidos graxos ω-3 e ω-6 e desempenho zootécnico do tambaqui (Colossoma macropomum)/Alzira Miranda de Oliveira. Manaus: AM, 2014. xi+127p. Tese (doutorado) INPA, Manaus, 2014. Orientador: Dr. Adalberto Luís Val. Área de concentração: Biologia de Água Doce e Pesca Interior. Oliveira, A.M. & Val, A.L. (2016). Effects of climate scenarios on the growth and physiology of the Amazonian fish tambaqui (Colossoma macropomum) (Characiformes: Serrasalmidae). Hydrobiologia. DOI 10.1007/s10750-016-2926-0 Osorio-Yáñez, C., García-Tavera, J.L., Pérez-Núñez, M.P.,Poblete-Naredo, I., Muñoz, B., Barron-Vivanco, B.S., Rothenberg, S.J., Omar Zapata-Pérez, O., and Albores, A. (2012). Benzo (a) pyrene induces hepatic AKR1A1 mRNA expression in tilapia fish (Oreochromis niloticus). Toxicology Mechanisms and Methods, 22(6), 438-444. Pal, S., Kokushi, E., Cheikyula, J. O., Koyama, J., & Uno, S. (2011). Histopathological effects and EROD induction in common carp exposed to dietary heavy oil. Ecotoxicology and Environmental Safety, 74(3), 307-314.
Pan, L., Ren, J., & Zheng, D. (2009). Effects of benzo (a) pyrene exposure on the antioxidant enzyme activity of scallop Chlamys farreri. Chinese Journal of Oceanology and Limnology, 27, 43-53. Papakostas, S., Vøllestad, L. A., Bruneaux, M., Aykanat, T., Vanoverbeke, J., Ning, M., ... & Leder, E. H. (2014). Gene pleiotropy constrains gene expression changes in fish adapted to different thermal conditions. Nature Communications, 5. Parihar, M.S., Javeri, T., Hemnani, T., Dubey, A.K., & Prakash, P. (1997). Responses of superoxide dismutase, glutathione peroxidase and reduced glutathione antioxidant defenses in gills of the freshwater catfish (Heteropneustes fossilis) to short-term elevated temperature. Journal of Thermal Biology, 22(2), 151-156. Pereira, S., Pinto, A.L., Cortes, R., Fontaínhas-Fernandes, A., Coimbra, A.M., & Monteiro, S.M. (2013). Gill histopathological and oxidative stress evaluation in native fish captured in Portuguese northwestern rivers. Ecotoxicology and Environmental Safety, 90, 157-166.
Pfaffl, M.W. 2001. A new mathematical model for relative quantification in real-time RT PCR. Nucleic Acids Research, 29(9): 2003-2007. Poleksic, V. & Mitrovic-Tutundžic V. 1994. Fish gills as a monitor of sublethal and chronic effects of pollution. IN: Müller, R.; Lloyd, R. Sublethal and chronic effects of pollutants on freshwater fish. Oxford: Fishing News Books. 30: 339-352.
Pryor, S.C., & Barthelmie, R.J. (2010). Climate change impacts on wind energy: a review. Renewable and Sustainable Energy Reviews, 14(1), 430-437.
Rašković, B., Jarić, I., Koko, V., Spasić, M., Dulić, Z., Marković, Z., & Poleksić, V. (2013). Histopathological indicators: a useful fish health monitoring tool in common carp (Cyprinus carpio Linnaeus, 1758) culture. Open Life Sciences, 8(10), 975-985 Ray, P.D., Huang, B.W., & Tsuji, Y. (2012). Reactive oxygen species (ROS) homeostasis and redox regulation in cellular signaling. Cellular Signalling, 24(5), 981-990.
Rhee, J. S., Lee, Y.M., Raisuddin, S., & Lee, J.S. (2009). Expression of R-ras oncogenes in the hermaphroditic fish Kryptolebias marmoratus, exposed to endocrine disrupting chemicals. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 149(3), 433-439.
109
Rimoldi, S., Terova, G., Ceccuzzi, P., Marelli, S., Antonini, M., & Saroglia, M. (2012). HIF-1α mRNA levels in Eurasian perch (Perca fluviatilis) exposed to acute and chronic hypoxia. Molecular Biology Reports, 39(4), 4009-4015. Rinaldi, R., Eliasson, E., Swedmark, S., & Morgenstern, R. (2002). Reactive intermediates and the dynamics of glutathione transferases. Drug Metabolism and Disposition, 30(10), 1053-1058. Rissanen E, Tranberg HK, Sollid J, Nilsson GE and Nikinmaa M (2006) Temperature regulates hypoxia-inducible factor-1 (HIF-1) in a poikilothermic vertebrate, crucian carp (Carassius carassius). Journal of Experimental Biology, 209: 994-1003. Rotchell, J.M., Lee, J.S., Chipman, J.K., Ostrander, G.K. (2001). Structure, expression and activation of fish ras genes. Aquatic Toxicology, 55: 1–21. Sadauskas-Henrique, H. Efeitos subletais da poluição por petróleo e derivados sobre peixes da Amazônia (Amazonas, Brasil) /Helen Sadauskas Henrique. Manaus: AM, 2015. xv+195p. Tese (doutorado) INPA, Manaus, 2015. Orientador: Dra.Vera Maria Fonseca de Almeida e Val. Área de concentração: Biologia de Água Doce e Pesca Interior. Sadauskas-Henrique, H., Duarte, R.M., Gagnon, M.M., Almeida-Val, V.M.F. (2017). Validation of a suite of biomarkers of fish health in the tropical bioindicator species, tambaqui (Colossoma macropomum). Ecological Indicators 73, 443–451. Sagerup, K., Nahrgang, J., Frantzen, M., Larsen, L. H., & Geraudie, P. (2016). Biological effects of marine diesel oil exposure in red king crab (Paralithodes camtschaticus) assessed through a water and foodborne exposure experiment. Marine Environmental Research, 119, 126-135. Salazar-Lugo, R., Mata, C., Oliveros, A., Rojas, L. M., Lemus, M., & Rojas-Villarroel, E. (2011). Histopathological changes in gill, liver and kidney of neotropical fish Colossoma macropomum exposed to paraquat at different temperatures. Environmental Toxicology and Pharmacology, 31(3), 490-495.
Sammour, T., Mittal, A., Loveday, B.P.T., Kahokehr, A., Phillips, A.R.J., Windsor, J.A., & Hill, A.G. (2009). Systematic review of oxidative stress associated with pneumoperitoneum. British Journal of Surgery, 96(8), 836-850. Sayeed, I., Parvez, S., Pandey, S., Bin-Hafeez, B., Haque, R., & Raisuddin, S. (2003). Oxidative stress biomarkers of exposure to deltamethrin in freshwater fish, Channa punctatus Bloch. Ecotoxicology and Environmental Safety, 56(2), 295-301. Schiedek, D., Sundelin, B., Readman, J. W., & Macdonald, R. W. (2007). Interactions between climate change and contaminants. Marine Pollution Bulletin, 54(12), 1845-1856. Schwaiger, J., Wanke, R., Adam, S., Pawert, M., Honnen, W., & Triebskorn, R. (1997). The use of histopathological indicators to evaluate contaminant-related stress in fish. Journal of Aquatic Ecosystem Stress and Recovery, 6(1), 75-86. Shackelford, R.E., Kaufmann, W.K., Paules, R.S. (1999). Cell cycle control, checkpoint mechanisms, and genotoxic stress. Environ. Health Perspective. 107 (1): 5–24.
Shaw, G. R., & Connell, D. W. (1994). Prediction and monitoring of the carcinogenicity of polycyclic aromatic compounds (PACs). In Reviews of Environmental Contamination and Toxicology (pp. 1-62). Springer New York.
Shen, R.J., Jiang, X.Y., Pu, J.W., & Zou, S.M. (2010). HIF-1α and-2α genes in a hypoxia-sensitive teleost species Megalobrama amblycephala: cDNA cloning, expression and different responses to hypoxia. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 157(3), 273-280.
110
Silva, J., Freitas, T.R.O., Marinho, J.R., Speit, G., Erdtmann, B. (2000). An alkaline single-cell gel electrophoresis (comet) assay for environmental biomonitoring with native rodents. Genetics and Molecular Biology, 23(1): 241-245.
Silva, A.G. (2004). Alterações histopatológicas de peixes como biomarcadores da contaminação aquática. Dissertação (Mestre em Ciências Biológicas). Universidade Estadual de Londrina.
Simonato, J. D., Guedes, C. L., & Martinez, C. B. (2008). Biochemical, physiological, and histological changes in the neotropical fish Prochilodus lineatus exposed to diesel oil. Ecotoxicology and Environmental Safety, 69(1), 112-120.
Singh, N. P.; M. T. Mccoy; R.R. Tice & E. L. Schneider. (1988). A simple technique for quantitation of low levels of DNA damage in individual cells. Experimental Cell Research, 175:184-191.
Solé, M., Lobera, G., Aljinovic, B., Ríos, J., de la Parra, L. G., Maynou, F., & Cartes, J. E. (2008). Cholinesterases activities and lipid peroxidation levels in muscle from shelf and slope dwelling fish from the NW Mediterranean: Its potential use in pollution monitoring. Science of the Total Environment, 402(2), 306-317.
Šrut, M., Štambuk, A., & Klobučar, G. I. (2010). Genotoxicity and genetic changes in RTG-2 fish cell line upon exposure to benzo [a] pyrene and ethyl methanesulfonate detected by the Comet assay and AFLP marker analysis. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology, 157, S13.
Strobel, A., Burkhardt-Holm, P., Schmid, P., & Segner, H. (2015). Benzo (a) pyrene Metabolism and EROD and GST Biotransformation Activity in the Liver of Red-and White-Blooded Antarctic Fish. Environmental science & technology. 49(13): 8022-8032. Tishkov, A.A. (1994). Geographic Patterns of Natural and Anthropogenic Successions, Extended Abstract of Doctoral (Geogr.) Dissertation, Moscow: Inst. Geogr. Ros. Akad. Nauk. Tishkov, A.A., II i Mezhdunarodnyi Simpozium “Chuzherodnye vidy v Golarktike (Borok_2)” (II Int. Symp. “Alien Species in the Holarctic” (Borok 2)), Rybinsk: Ros. Akad. Nauk, 2005, p. 31. Torten, M., Liu, Z., Okihiro, M. S., Teh, S. J., & Hinton, D. E. (1996). Induction of ras oncogene mutations and hepatocarcinogenesis in medaka (Oryzias latipes) exposed to diethylnitrosamine. Marine Environmental Research, 42(1), 93-98.
Toyokuni, S. (1999). Reactive oxygen species‐induced molecular damage and its application in
pathology. Pathology international, 49(2), 91-102. Val, A.L. & Honczaryk, A. (1995). Criando peixes na Amazônia. Manaus: INPA (Editor), Manaus, Brasil. p.160. Val, A.L. & Almeida-Val, V.M.F. (1995). Fishes of the Amazon and their environment: physiological and biochemical features. Heidelberg: Springer-Verlag. Val, A. L., Kapoor, B. G., Raschi, W. G., & Gerry, S. P. (2003). Fish adaptations.
Van der Oost, R., Beyer, J., & Vermeulen, N. P. (2003). Fish bioaccumulation and biomarkers in environmental risk assessment: a review. Environmental toxicology and pharmacology, 13(2), 57-149. van Schanke, A., Boon, J.P., Aardoom, Y., van Leest, A., van Schooten, F.J., Maas, L., ... & Everaarts, J.M. (2000). Effect of a dioxin-like PCB (CB 126) on the biotransformation and genotoxicity of benzo [a] pyrene in the marine flatfish dab (Limanda limanda). Aquatic Toxicology, 50(4), 403-415.
111
Vásquez, K.L. Ontogenia das enzimas digestivas do tambaqui, Colossoma macropomum (CUVIER, 1818): subsídios para a aquicultura/Katherine López Vásquez. Manaus: AM, 2009. Tese (doutorado), Manaus, 2009.Orientador: Dr. Adalberto Luís Val Área de concentração: Biotecnologia. Vincent, F., Boer, J., Pfohl-Leszkowicz, A., Cherrel, Y., Galgani, F. (1998). Two cases of ras mutation are associated with liver hyperplasia in Callionymus lyra exposed to polychlorinated biphenyls and polycyclic aromatic hydrocarbons. Molecular Carcinogenesis. 21: 121–127. Vogelbein, W. K., Fournie, J. W., Van Veld, P. A., & Huggett, R. J. (1990). Hepatic neoplasms in the mummichog Fundulus heteroclitus from a creosote-contaminated site. Cancer Research, 50(18), 5978-5986. Voolstra, C., Schnetzer, J., Peshkin, L., Randall, C.J., Szmant, A.M., Medina, M. (2009) Effects of temperature on gene expression in embryos of the coral Montastraea faveolata. BMC Genomics.10: 627. Vörösmarty, C.J., McIntyre, P.B., Gessner, M.O., Dudgeon, D., Prusevich, A., Green, P., Gilden, S., Bunn, S.E., Sullivan, C.A., Reidy Liermann, C., Davies, P.M. (2010). Global threats to human water security and river biodiversity. Nature. 467: 555–561. Waris, G., & Ahsan, H. (2006). Reactive oxygen species: role in the development of cancer and various chronic conditions. Journal of Carcinogenesis, 5(1), 14. Winter, M.J., Day, N., Hayes, R.A., Taylor, E.W., Butler, P.J., & Chipman, J.K. (2004). DNA strand breaks and adducts determined in feral and caged chub (Leuciscus cephalus) exposed to rivers exhibiting variable water quality around Birmingham, UK. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis, 552(1), 163-175.
Wong, C., Wellman, T. L., & Lounsbury, K. M. (2003). VEGF and HIF-1α expression are increased in advanced stages of epithelial ovarian cancer. Gynecologic oncology, 91(3), 513-517.
Yang, G., Mercado‐Uribe, I., Multani, A. S., Sen, S., Shih, I. M., Wong, K. K., ... & Liu, J. (2013). RAS
promotes tumorigenesis through genomic instability induced by imbalanced expression of Aurora‐A and
BRCA2 in midbody during cytokinesis. International Journal of Cancer. 133(2): 275-285.
Yang, X., Meier, J., Chang, L., Rowan, M., & Baumann, P. C. (2006). DNA damage and external lesions in brown bullheads (Ameiurus nebulosus) from contaminated habitats. Environmental toxicology and chemistry, 25(11), 3035-3038.
Yu, R.M.K., Ng, P.K.S., Tan, T., Chu, D.L.H., Sun, Wu, R.S. & Kong R.Y.C. (2008) Enhancement of hypoxia-induced gene expression in fish liver by the aryl hydrocarbon receptor (AhR) ligand, benzo[a]pyrene (BaP). Aquatic Toxicology. 90: 235–242.
112
Tables and Figures
Table 1. Physicochemical parameters of water and air in the current and extreme scenarios where the specimens of
tambaqui were kept for 30 days. The data are reported as the mean ± standard error of the mean.
Climate Scenarios
Treatments Water
O2 (mg.L-1
)
Water CO2
(ppm)
Water temperature
(°C)
pH Environment
ToC
Environment CO2
(ppm)
Current
Control
6.6 ± 0.06 7.1 ± 0.28 26.3 ± 0.20 6.7 ± 0.07
8 mol/kg BaP
6.7 ± 0.07 6.8 ± 0.20 26.2 ± 0.21 6.9 ± 0.03 30.6 ± 0.39 510.1 ± 5.80
16 mol/kg BaP
6.7 ± 0.06 6.8 ± 0.20 26.2 ± 0.20 6.9 ± 0.03
Extreme
Control
6.3 ± 0.07 11.7 ± 0.31 28.4 ± 0.16 7.0 ± 0.02
8 mol/kg BaP
6.3 ± 0.06 11.6 ± 0.30 28.5 ± 0.16 7.0 ± 0.03 34.1 ± 0.38 1349.2 ± 7.01
16 mol/kg Bap
6.3 ± 0.07 11.5 ± 0.27 28.5 ± 0.16 7.0 ± 0.03
113
Table 2. Characteristics of each specific primer obtained for the experiment. Primers for endogenous
genes (28S e ef-1) and primers for the target genes (ras e hif-1).
Gene
Primer sequence (5`-3`)
forward/reverse
Length (bp)
Amplicon length(bp)
Tm
Ef(%)
*
28S-Fa
CGGGTTCGTTTGCGTTAC
18 150 54.5 98.19
28S-Ra
AAAGGGTGTCGGGTTCAGAT
20 150 56.3 98.19
ef-1Fb
GTTGGTGAGTTTGAGGCTGG
20 78 60.7 99.09
ef-1Rb
CACTCCCAGGGTGAAAGC
18 78 60.9 99.09
Ras-F
CCAGTACATGAGGACAGGAG
20 134 60.3 99.31
Ras-R
CAAGCACCATTGGCACATCG
20 134 60.3 99.31
HIF-1F
ATCAGCTACCTGCGCATG 18 133 59.3 100.69
HIF-1R
CTCCATCCTCAGAAAGCAC 19 133 57.3 100.69
*Primer Efficience a. Vasquez (2009) b. Brandão (2015)
114
Table 3. Hematological parameters and glucose levels in plasma of tambaqui (Colossoma macropomum) injected with BaP
and submitted to climate scenarios provided by the IPCC for the year 2100. The values are presented as mean ± standard
error of the mean (SEM). Lowercase letters represent significant differences (p <0.05) between the different treatments of the
same room. The asterisk represents significant difference (p <0.05) between the same treatments in different rooms.
Climate Scenary
Treatment [Hb]
(g/dL)
Ht
(%)
RBC
(106/mm
3)
MVC
(μm3)
MHC
(pg)
MCHC
(%)
Glucose
mg/dL
Current Control 6.2 ± 0.3 a
23.8 ±0.6 a 1.4 ± 0.09
a 152.0 ± 5.3
a 43.4 ± 1.8
a 28.8 ± 1.7
a 41.9 ± 1.6
a
8 μmol/kg BaP
7.2 ± 0.04 a
24.5 ± 0.6 a 1.5 ± 0.05
a 162.8 ± 5.8
a 44.4 ± 2.3
a 29.5 ± 1.1
a 46.4 ± 0.2
a
16 μmol/kg BaP
6.8 ± 0.4 a
25.6 ±0.3
a 1.5 ± 0.09
a 156.8 ±7.5
a 42.3 ± 1.9
a 28.5 ± 1.1
a 44.0 ± 1.8
a
Extreme Control 7.0 ± 0.1 a
24.5 ± 0.5
a 1.5 ± 0.13
a 163.6 ± 9.6
a 40.5 ± 1.6
a 28.2 ± 1.2
a 48.4± 1.5
a
8 μmol/kg BaP
7.5 ± 0.1a
25.1 ± 0.4
a 1.8 ± 0.07
a 153.6 ±7.5
a 40.1 ± 2.1
a 29.5 ± 1.3
a 47.5 ± 1.9
a
16 μmol/kg Bap
7.0 ± 0.4 a
26.4 ± 0.8
a 1.4 ± 0.06
a 170.4 ± 5.7
a 52.1 ± 2.5
b* 28.5 ±0.8
a 43.5 ± 2.1
a
115
Table 4. Histopathology and Indexes (HDI) of Tissue Damage and occurrence intensity (0 absente, 0+ low frequency, +
moderate frequency, ++ frequent and +++ high frequency) on the liver of C. macropomum after 30 days exposure to
climate scenarios (current and extreme) and treatments. Values indicate the stages of damage as modified by Poleksic
and Mitrovic-Tutundzic (1994). Data are means ± SEM, N= 10 (n=3).
Lesion Type
Current Scenario
Extreme Scenario
Stage Control 8 mol/kg of BaP
16mol/kg of BaP
Control 8 mol/kg of BaP
16 mol/kg of BaP
Nuclei Hypertrophy
I 0+ + + 0+ 0+ 0+
Cell Hypertrophy
I 0+ + ++ 0+ 0+ +
Nuclei in cell periphery
I + ++ ++ + + +
Cytoplasm Vacuolization
I + +++ ++ ++ ++ ++
Leukocyte infiltration
I 0+ ++ ++ 0+ 0+ +
Sinusoid Dilation
I 0 ++ ++ 0+ ++ ++
Cellular deformation
I + + + 0+ 0+ +
Derangement of hepatic cords
I 0 0+ 0+ 0+ 0+ 0+
Vessel congestion
II
0+ ++ ++ + + +
Nuclei vacuolization
II
0 0+ 0+ 0+ 0+ 0+
Nuclei degeneration
II
0+ ++ ++ + ++ ++
Cytoplasm degeneration
II
+ ++ ++ + ++ ++
Pyknotic nuclei
II
0+ + ++ 0+ + +
Cell disruption
II
0+ + + + + ++
Focal Necrosis
III
0+ ++ ++ + ++ ++
Histopathological Damage Index (HDI)
36.1 ±3.0 146.9 ± 2.1 144.1 ± 1.9 36.3 ±4.6 147.3 ± 2.3 142.3 ± 3.6
Effects
Moderate to severe alteration
Irreparable damage
Irreparable damage
Moderate to severe alteration
Irreparable damage
Irreparable damage
116
GDI: Genetic damage index (0-400)
Figure 1. Distribution of the number of erythrocytes classified in each class of DNA damage in C.
macropomum exposed to the current and extreme scenarios and their respective treatments (control, 8
and 16mol/kg of BaP). The Genetic Damage Index (0-400) is identified in each treatment. Lowercase
letters represent significant differences (P <0.001) in GDI between the different treatments in the same
scenario. The asterisk represents significant difference (P <0.001) in GDI between the same treatments in
different scenarios.
117
Figure 2. Liver glutathione-S-transferase (GST) of C. macropomum after 30 days exposure to current and
extreme scenarios and their respective treatments (control 8 and 16 mol/kg of BaP). Columns represent
means and vertical lines represent SEM. Lowercase letters represent significant differences (P <0.001)
between the different treatments in the same scenario. The asterisk represents significant difference (P
<0.001) between the same treatments in different scenarios.
118
Figure 3. Liver catalase (CAT) activity of C. macropomum after 30 days exposure to current and extreme
scenarios and their respective treatments (control 8 and 16 mol/kg of BaP). Columns represent means
and vertical lines represent SEM. Lowercase letters represent significant differences (P <0.001) between
the different treatments in the same scenario. The asterisk represents significant difference (P <0.001)
between the same treatments in different scenarios.
119
Figure 4. Liver lipid peroxidation (LPO) of C. macropomum after 30 days exposure to current and
extreme scenarios and their respective treatments (control 8 and 16 mol/kg of BaP). Columns represent
means and vertical lines represent SEM. Lowercase letters represent significant differences (P <0.001)
between the different treatments in the same scenario. The asterisk represents significant difference (P
<0.001) between the same treatments in different scenarios.
120
Figure 5. Liver of C. macropomum exposed to the current scenario for 30 days and their respective
treatments (control, 8 and 16 mol/kg of BaP). A: Liver of C. macropomum exposed to control group.
Asterisk show blood vessel. B, C and D: C. macropomum exposed to 8mol/kg of BaP. B: Head arrows
indicate pyknotic nuclei. Big arrows show nuclear hypertrophy. Thin arrow indicates cellular hypertrophy.
C: Asterisk indicates a vessel congestion and thin arrow point to a nuclear vacuolization. D. Asterisk
indicates a big necrotic area with leukocyte infiltration (arrows). E and F C. macropomum exposed to
16mol/kg of BaP. E. Asterisk shows a hepatopancreas necrotic area and thin arrow indicates cell
disruption. F. Completely parenchyma vacuolization. Hematoxylin and Eosin stain.
121
Figure 6. Liver of C. macropomum exposed to the extreme scenario for 30 days and their respective
treatments (control, 8 and 16 mol/kg of BaP). A: Liver of C. macropomum exposed to control group. B
and C: C. macropomum exposed to 8mol/kg of BaP. B: Thin arrows indicate a big area with sinusoidal
dilatation. C. Head arrows indicate pyknotic nuclei and thin arrows cellular disruption. D, E and F C.
macropomum exposed to 16mol/kg of BaP. D. Arrows indicate vessel congestion with blood stagnation
and vessel dilatation. E. Necrotic area (arrows) adjacent to hepatopancreas (asterisk). F. Necrotic
parenchyma. Arrows point to leukocyte infiltration. Hematoxylin and Eosin stain.
122
Figure 7. Ras relative expression (A) and hif-1 relative expression (B) on the liver of C. macropomum
exposed to current scenario and extreme scenario and their respective treatments (Control, 8 and 16
mo/kg of BaP). Lowercase letters represent significant differences (P <0.001) between the different
treatments in the same scenario. The asterisk represents significant difference (P <0.001) between the
same treatments in different scenarios.
123
Figure 8. Bioplots showing the distribution of PCA values for the variables analyzed in C. macropomum
exposed to the current scenario and extreme scenario (A2 proposed by IPCC (2007)). All groups are
compared and variation between variables is explained by P1=37.0% and P2=17.0%.
124
Capítulo III
Hypoxia magnifies the effects of Roundup® over tambaqui genotoxicity, physiology and
gene expression levels.
125
Title
Hypoxia magnifies the effects of Roundup® over tambaqui genotoxicity, physiology and
gene expression levels.
Running title
Tambaqui, Roundup®, hypoxia
Author names and affiliations
Grazyelle Sebrenski da Silva1,2, Carolina D. Abrahim1, Juliana O. S. Freitas1, Derek
Campos1 and Vera Maria Fonseca de Almeida e Val1
1Laboratory of Ecophysiology and Molecular Evolution (LEEM), Brazilian National
Institute for Research in the Amazon (INPA). 69067-375 André Araújo Avenue, 2936,
Petrópolis. Manaus, AM, Brazil.
2Institute of Biological Science (ICB) in Amazon Federal University (UFAM), General
Rodrigo Octávio Ave, 6200, Coroado I. AM, Brazil
E-mail address: C.D. Abrahim (carolina_abrahim@hotmail.com), J.O.S. Freitas
(juliana.freitas.bio@hotmail.com), D. campos (campos.derek@gmail.com) and V.M.F.
de Almeida e Val (veraval30@gmail.com)
Corresponding author: G.S. Sebrenski
Phone number: +55 92 3643 3188
E-mail address: grazysebrenski@hotmail.com
Postal address: André Araújo Avenue, 2936, Petrópolis, 69067-375. Manaus, AM,
Brazil
126
Abstract
Roundup® (RD) is a non-selective herbicide used to control the weeds around fish farm tanks,
threatening aquatic biota. Otherwise, among the natural challenges faced by fish in Amazon, is
the oscillation in dissolved oxygen in the water, resulting in periodic and intermittent episodes of
hypoxia. Considering the possibility of roundup® contamination in hypoxic environments, we
decided to evaluate the effects of hypoxia in fish exposed to this herbicide. Herein, we analysed
the physiological responses, including hematology, antioxidant defenses, gene expression and
histopatology of Colossoma macropomum affected by hypoxia and RD. Moreover, we assessed
bood cells nuclear damages to find out the genotoxicity of the combination of these two threats
causes in tambaqui as well as histopatological damages. To reach these objectives, fish were
placed in individual aquaria (n=10) and exposed to four different treatments; normoxia (N),
hypoxia (H), normoxia plus RD (75% of LC50% - nominal concentration 15 mg.L-1) (NRD); and
hypoxia plus RD (same dosage) (HRD). After 96 h, fish were anesthetized and bleed for
hematological analysis and genotoxicity effects. Fish were, then, euthanized and liver was
sampled for enzymatic analysis, gene expression, and histopatological damages observation.
Hif-1 and ras oncogene were down regulated in HRD. However, ras oncogene was
overexpressed in NRD (3.68-fold), and there was no difference in hif-1 gene expression
between N and NRD. The glutathione-S-transferase (GST) and catalase (CAT) activities
increased in fish exposed to HRD fish compared to fish exposed to NRD. Moreover, there was
no difference in lipoperoxidation (LPO) in the treatments normoxia N and NRD compared to
hypoxia conditions (H and HRD). On the other hand, comet assay DNA strand breaks increased
in NRD compared to N, but no difference was observed between H and HRD. Liver histological
injuries were higher in H and HRD groups, showing an increase in the incidence of necrosis. An
increase in blood hemoglobin, hematocrit, erythrocytes, corpuscular constants (MVC and MHC)
was observed in fish under H compared to N. Thus, C. macropomum may be considered more
sensitive to RD under hypoxic environment; notwithstanding the increase of antioxidant
defenses in hepatocytes, the damage on fish liver was irreparable under these severe
conditions.
Key-words: Roundup, Colossoma macropomum, hypoxia, ras oncogene and hif-1
127
1. Introduction
Pesticides constitute a large group of chemicals, which are essential to control pests
in agriculture. Their application is still the most effective and accepted ways for
protection of plants from pests, contributing to the increase of agricultural productivity
(Tomita and Beyruth, 2002, Bolognesi, 2003, Cavalcante et al., 2008). The glyphosate-
based herbicide, Roundup® (RD), is among the most used pesticides worldwide
(Guilherme et al., 2010). Roundup® is formulated as isopropylamine salt and contains
the surfactant polyethoxylene amine (POEA), which is added to improve the efficacy of
the herbicide (Tsui and Chu, 2004, Relyea, 2005). RD is applied in crop fields to
unwanted weeds, and also surrounding fishponds, lakes and canals to control or
removal of herbaceous plants (Bolognesi, 2003, Neškovic et al., 1996). The presence of
herbicides in aquatic systems will directly and indirectly contaminate fish, other animals
and plants (Cattaneo et al., 2011). The exposure of non-target aquatic organisms to this
herbicide is a concern especially because changes in the chemical composition of
natural aquatic environments can affect them, particularly fish. Fish have been largely
used to evaluate the quality of aquatic systems as bioindicators for environmental
pollutants (Tsui and Chu, 2003). There are many studies describing the effects of RD in
fish (Gholami-Seyedkolaei et al., 2013, Cavalcante et al, 2008, Langiano and Martinez,
2008, Glusczak et al., 2006). A recent work has addressed the effects of RD in the
Amazon fish Colossoma macropomum; Braz-Mota and co-workers (2015) described gill
histopathological changes, hematological and DNA damage in C. macropomum acutely
exposed (96 h) to sub-lethal concentration of RD (50% and 75%, LC50). RD is
commonly used in the Amazonas state to control weeds in fish farms (Araújo et al.,
2008). The use of herbicides to control weeds around fish tanks in the fish farms in the
Amazon is very worrying, since aquaculture is an economic area in constant
development in the region.
Besides the presence of contaminants such as herbicides, other challenges fish
must cope with in the Amazon region are the changes in physical and chemical
parameters of the water, particularly dissolved oxygen levels. Water dissolved oxygen
levels oscillate on a seasonal and diel basis in the Amazonian waters (Junk, 1980; Val
128
and Almeida-Val, 1995). The oscillation in the water results in low levels of oxygen,
resulting in intermittent or cronic periods of profound hypoxia (< 2 mg O2. L-1) (Val et
al.,1995). In flooded areas, varzea and igapós, drastic environmental changes in
oxygen availability are observed in a single day. To survive low oxygen tensions at high
temperature, Amazon fish have developed many respiratory strategies (Val and
Almeida-Val, 1995). One strategy is the maintenance of low levels of activity depressing
the metabolism, which is predominantly powered by anaerobic metabolism, decreasing
the ATP demands (Boutilier, 2001; Lutz and Nilsson, 1997). Fish may down regulate
metabolism to decrease the oxygen demand during hypoxia exposure. The critical
oxygen tension (PO2crit) is the minimum oxygen level required to sustain the routine
oxygen consumption rate (MO2rout). PO2crit is thought to reflect the ability of an organism
to extract oxygen from the environment to maintain MO2rout as oxygen tension
decreases; a lower PO2crit is associated with higher hypoxia tolerance (He et al., 2015,
Pörtner and Grieshaber, 1993). In addition to down regulation of the metabolism,
tambaqui presents aquatic surface respiration (ASR), a behavioral adjustment that
allows fish to access oxygenated water from the water–air interface (Hochachka and
Somero, 2002).
Several authors reported the adaptive mechanisms of Amazon fish to hypoxia
(De Boeck et al., 2013, Baldisserottto et al., 2008, Muusze et al., 1998, Kochhann et al.,
2015; Chabot and Claireaux, 2008), but just a few have discussed the issue from a
molecular or transcriptional point of view (Baptista et al., 2016). Moreover, many studies
about hypoxia did not associate the effects of this condition when fish is exposed to
contaminants. It is worth, thus, consider the effects of hypoxia in fish exposed to a
contaminant, and, to understand the responses some important genes such as hypoxia
inducible factor-1(hif-1) and ras oncogene will present under these conditions.
Animals can often remain in low oxygen by increasing specific oxygen-dependent
regulatory transcriptional proteins known as hypoxia-inducible factors (HIFs) (Bracken
et al., 2003). HIF-1 contains two subunits of HIF-1 and HIF-1 (Semenza, 2001).
Under hypoxic conditions, HIF-1α accumulates and forms a heterodimeric DNA-binding
complex with HIF-1β, and interacts with the hypoxia response element (HRE), 5′-
RCGTG-3′ on the promoter region of target genes (Wang and Semenza, 1993). HIF is a
129
master regulator of many physiological responses to hypoxia, controlling the
transcription of more than 100 genes regulating diverse functions, such as
angiogenesis, erythropoiesis, glucose metabolism, vasodilation, apoptosis, cell growth,
and cell proliferation (Wu, 2009). Hif-1 is also related as involved in cancer
development (Quintero et al., 2004).
A wide range of other physiological and pathological pathways activates the HIF
system. Growth promoters including insulin, insulin-like growth factor and epidermal
growth factor amplify the system together with the oncogenes Ras and Myc (Quintero et
al., 2004). Ras plays an important role in normal cellular proliferation (Barbacid, 1987).
Ras is also involved in grow control, cell division, differentiation and programmed cell
death (apoptosis) (Smith 1986, Rotchell et all., 2001). Ras related sequences have
been described for several fish species such as Goldfish (Carassius auratus) (Nemoto
et al., 1986), Rainbow trout (Oncorhynchus mykiss) (Mangold et al., 1991), and Oryzias
latipes (Torten et al., 1996).
The species Colossoma macropomum (tambaqui) is native to the Amazon region
and is the most native cultivated fish in Brazil (Val and Honczaryk, 1995). This
serrasalmid can populate habitats with a temporary deficiency or even absence of
oxygen. They employ a great variety of mechanisms to adapt to the strongly fluctuating
O2 concentration, particularly Aquatic Surface Respiration. Additionaly, tambaqui is also
capable of expanding its lower lips to explore the water surface (water–air-interface)
when exposed to hypoxia (Val and Almeida-Val, 1999).
Despite the fact that Roundup® is widely used in Brazil, only a limited amount of
information is available on its toxic effects to native freshwater fishes and gene
expression response. Moreover, the hypoxia is a natural phenomenon in Amazon
waters and need to be better understood, especially in areas where the aquatic biota
receives contaminant influences such as RD exposure. Herein, we aimed to assess the
potential interaction effects of the two stressors: Roundup® and hypoxia over the
species Colossoma macropomum. Initially, we established the critical oxygen tension
(PO2crit) for fish exposed to decreasing oxygen in an environment free of RD.
Afterwards, we used a oxygen concentration defined in PO2crit to expose fish to hypoxia
and to hypoxia plus RD. Our main goal was to characterize the transcriptional response
130
of hif-1gene and oncogene ras expression under these conditions. An additional
objective was to evaluate the hematological changes, blood cells DNA strand breaks,
the liver histopathological alterations, and its antioxidant defenses mechanisms
throughout the measurement of glutathione-S-transferase activity (GST), catalase
activity (CAT) and lipid peroxidation level (LPO).
2. Material and Methods
2.1. Collection and maintenance of fish
Juveniles of C. macropomum (81.10 g ± 11.8; 15.11 cm ± 0.30) were purchased
from a local fish farm nearby Manaus city (Santo Antônio Farm: 02º44'802''S;
059º28'836''W), Amazon State (Brazil). Fish were transported to the Laboratory of
Ecophysiology and Molecular Evolution at the Brazilian National Institute for Amazon
Research (LEEM - INPA). Fish were held indoors in fish tanks supplied with
recirculating aerated INPA’s groundwater ([Na+], 0.83; [K+], 0.45; [Ca2+], 0.10; [Mg2+],
0.040; [Cl-], 0.90mgl-1; [Cu2+], 7.0 g l-1; hardness=1.33mg CaCO3 l-1; pH= 6.80); and
fed once a day with commercial food containing 36% protein. Fish were monitored daily
during the acclimation period (30 days).
2.2. Experimental Design
As above-mentioned, we determined the critical oxygen pressure to further
perform the experiments with Roundup® and hypoxia. After PO2crit was determined, the
hypoxic oxygen levels was fixed for the experiments. PO2crit is defined as the partial
pressure of oxygen (O2) below which the animal's metabolic rate decreases as the O2
pressure decreases.
131
2.2.1. Oxygen pressure (PO2 crit) determination
After the acclimation time, feed was suspended and six fish were separated and
allocated in individual glass aquaria with five liters water capacity and constant aeration.
Fish spent one day in the aquaria before starting the experiment. Then, they were
separated into two experimental groups. One group was the control (n=3) with water
free of contaminant, and the second group (n=3) had water with addition of RD; nominal
concentration corresponded to 75% of CL50 established by Miyasaki et al. (2004). Fish
remained in those conditions during 96 h. After 96 h, fish were placed in the
respirometer chamber to measure their routine metabolic rate. Intermittent- flow
respirometry was used to determine the metabolic rate of the fish (Steffensen, 1989).
Fish were placed in a 70 ml individual chamber in two groups of 3 fish for 3 hours with
the water openly flowing inside each chamber. During the flush phase, peristaltic pumps
were used to recirculate chambers with ambient tank water. After this period, the water
circulation was closed and the PO2crit was initialized. Oxygen concentration inside the
chamber decreased due to fish breathing, so fish were exposed to a brief period of
progressive hypoxia by omitting the flush period. The oxygen measurement of the
chambers occurred through sensor spots that were stacked inside the chambers and
fiber optic cables that were connected toOXY-4 or Witrox 4 oximeters (Loligo Systems).
The oxygen consumption rates were calculated, and PO2 crit was determined as the
point where the PO2 regression line of the oxygen regulation intersected the oxygen
conforming, initiating the suppressed metabolic rate by segmented linear regression
using the SegReg program (www.waterlog.info) (De Boeck et al., 2013). After the
establishment of the values of PO2crit, the experiment was conducted with Roundup®
and hypoxia.
132
2.2.2. Acute experiment with Roundup® and hypoxia
After the acclimation time and definition of the oxygen concentration to be used
as hypoxic situation, feed was suspended and fish were moved from acclimate at
individual glass tanks, with 5 liters water capacity and constant aeration, where they
spent one day before starting the experiment. To start the experiment fish were
separated in four different treatments with 10 fish each (n=10): normoxia (N), hypoxia
(H), normoxia plus RD (75% of LC50% - nominal concentration 15 mg L-1) (NRD); and
hypoxia plus RD (HRD).The RD toxicity (i.e. 360 g of gliphosate L-1) was evaluated
following the sub-lethal concentration corresponding of 75% of LC50% (nominal
concentration: 15 mg L-1) established for C. macropomum in 96 h by Miyasaki et al.,
(2004). The experiment lasted 96 hours, and in hypoxia treatments, oxygen was
decreased to hypoxic levels (1.5 mg L-1) during the last 6 hours of the total experimental
period. The low level of oxygen in the aquarium was obtained suspending the oxygen
aeration and introducing nitrogenous gas in the water. Surface of the aquarium was
covered to avoid ASR.
At the end of the experiment, all fish were individually removed from the aquaria
and bleed with the help of heparinized syringes, for haematology measurements and
genotoxic (comet assay) analyzes. Then, fish were anesthetized on ice, weighed,
measured and euthanized by spinal section. After euthanasia, liver samples were
collected for histological, genetic and enzymatic analysis.
During the experiment, the water parameters (pH, oxygen, and temperature)
were measured. Two liters of water from each tank were changed daily, and the
concentrations of RD reestablished.
2.3. Analytical procedures
2.3.1. Water variables
Water parameters (pH, oxygen, and temperature) were monitored every day in
each experimental tank in all treatments. Temperature and oxygen were measured
133
using an oximeter 5512-FT (YSI, EUA) and pH was measured with a pHmeter
UltraBASIC UB-10 (Denver Instrument, EUA).
2.3.2. Hematological and plasma glucose parameters
Blood parameters as hematocrit (Ht), Hemoglobin [Hb], total erythrocytes
count (RBC) and glucose was analyzed. The [Hb], RBC and Ht values were used to
calculate corpuscular parameters: medium corpuscular volume (MCV), medium
corpuscular hemoglobin concentration (MCHC) and medium corpuscular hemoglobin
(MCH).
Hemoglobin concentration ([Hb]) was determined by cyanmethemoglobin method
(Kampen and Zijlstra, 1964) in a spectrophotometer at 540 nm. Blood was centrifuged
in microcapillary tubes and then hematocrit (Ht) was read using an appropriate card
(Navarro and Pachaly, 1994). Total RBC were read on a Neubauer chamber (Leica
DM2015) using blood diluted with formaldehyde citrate. Glucose was measured using
the colorimetric method without deproteinization (GOD-PAP) using the kit InVitro®. The
reading was performed in a spectrophotometer at 500 nm.
2.3.3. Comet Assay
We quantified the DNA damage in erythrocyte cells using the comet assay as
described by Singh et al. (1988), and modified by Silva et al., (2000). Two comet
microscope slides for ten fish from each treatment were prepared with standard melting
agarose (1.5% normal melting agarose prepared in phosphate-buffer saline (PBS)) and
dried overnight. Five microliters of whole fish blood were mixed with 0.75% low melting
point agarose at 5% ratio (Gibco BRL) at 37 ºC and immediately poured on pre-covered
slides. Each slide was covered with a coverslip until the agarose solidified. After the
agarose gel has solidified the coverslip was gently removed, and the slides were placed
in a lyses solution consisting of high salts and detergents (2.5 M NaCl, 100 mM EDTA,
10 mM Tris, pH 10-10.5; 1% Triton X-100 and 10% DMSO). Before electrophoresis, the
134
slides were incubated for 20 min in alkaline electrophoresis buffer (300 mM NaOH and
1 mM EDTA, pH >13) to produce single stranded DNA. After alkali unwinding, the
single-stranded DNA was electrophoresed in the gels in a dark place under alkaline
conditions for 20 min at 300 mA and 25 V at 4 °C to produce the comets. After
electrophoresis, we rinsed the slides with a suitable buffer (0.4 M Tris buffer, pH 7.5) to
neutralize the alkalis in the gels. Finally, the DNA staining was revealed with silver
solution (5% sodium carbonate, 0.1% ammonia nitrate, 0.1% silver nitrate 0.25%
tungstosilicic acid and 0.15% formaldehyde). Slides were examined using an optical
microscope (Leica DM2015) at 400X of magnification. Randomly selected cells (100
cells from each of two replicate slides) were analyzed for each animal. We used the tail
sizes to score the comet assay into five classes (from undamaged (zero) to maximally
damage (four)). An overall score was obtained by summation of all cell scores from
completely undamaged (sum zero) to maximum damage (sum 400) according to
Kobayashi et al. (1995).
2.3.4. Biochemical Analyzes
To measure the Glutathione-S-tranferase (GST), catalase (CAT) activity and
lipoperoxidation (LPO), frozen (-80 oC) fish liver samples were weighted and
homogenised in buffer solution (20 mM Tris buffer (pH 7.6), 1 mM EDTA, 1 mM
dithiothreitol, 500 mM sucrose, and 150 mM KCl). For GST and CAT liver was
homogenised (1:10 w/v) and LPO (1:2 w/v).
Estimation of GST activity on the liver samples was performed following the Keen
et al. (1976) protocol. Homogenised samples were centrifuged (9.000 rcf for 30min at
4oC), after the supernatant was incubated with reduced glutathione (GSH) and 1-chloro-
2,4-dinitrobenzene (CDNB) as substrates. Change in absorbance was recorded at 340
nm, and the enzyme activity was calculated as nmol CDNB conjugate formed per min
per mg protein using a molar extinction coefficient of 9.6 mM cm-1.
To estimate the CAT liver activity the protocol followed to prepare the supernatant as
enzyme source was the same for GST. CAT was measured in accordance with Beutler
(1975) method. The rate of inhibition of H2O2 decomposition was measured at
135
absorbance of 240 nm in a spectrophotometer. CAT activity was expressed as H2O2
micromol. min-1 .mg-1 protein.
As described by Jiang et al. (1991) liver LPO was estimated by Fe2+ oxidation in
the presence of xylenol orange (FOX, ferrous oxidation–xylenol orange assay). Liver
homogenate (1:2 w/v) as describes bellow was centrifuged at 10.000 rpm for 10 min at
4oC. For the assay the supernatants were treated with 10% TCA (trichloroacetic acid)
and centrifuged at 500 rpm for 10 min at 4oC. After the treated supernatants were added
to a reaction mixture containing 100 M xylenol orange, 4 mM C15H24O, 25 mM
H2SO4, and 250 M FeSO4 dissolved in 90% methanol. Samples plus reaction mixture
were incubated for 30 min at room temperature for color development before
colorimetric measurement at 560 nm. LPO concentration was expressed as mol
cumene hydroperoxide mg protein-1.
For all assays, total protein content was determined previously using the Bradford
(1976) method adapted to the microplate reader.
2.3.5. Liver histopathological analyzes
After sampled one portion of the each fish liver were immediately separated and
fixed in ALFAC solution for 16h (ALFAC: 70% ethanol, 5% glacial acetic acid, and 4%
formaldehyde). Posteriorly tissues were washed in 70% ethanol and following a serial
crescent ethanol concentration dehydrating protocol, diafanization and inclusion in
paraffin. Using a semi-automatic microtome serial sections of the tissue (5m) were
prepared in glass slides (n=10 for treatment). Samples were stained with
Hematoxylin/Eosin and PAS (Shiff Periodic Acid) and observed under the bright field
microscope (Leica DM2015).
Liver tissue injuries were analyzed qualitatively, according to the level of the
damage classified by Poleksic and Mitrovic-Tutundsic (1994) and Silva (2004).
136
2.3.6. Isolation of total RNA and cDNA synthesis
Fish liver collected were maintained in -80 oC waiting the analyses procedure.
Total RNA liver (n=4) were isolated according to Trizol®reagent manufacturer
instruction. Contaminating genomic DNA was removed using DNase (Invitrogem™).
First strand cDNA was reverse-transcribed following manufacturer`s instructions by
ReverAID Minus First Strand cDNA Synthesis Kit (Fermentas®). Enzymatic treatment
with reverse transcriptase (MMLV Reverse Transcriptase) (200 U/μL, USB) was first
done and, then, mixed in a 1.5 mL microtube with approximately 25 μg RNA, 1,0 μL
oligonucleotide dT(18) (1μg), 1,0 μL dNTP mix (10 mM), buffer 5X MMLV, and
deionized for a 50 mL final volume. This solution was incubated at 37 °C for 1 hour for
conversion and 70 °C for 10 minutes to inactivate the enzyme. The quality of the total
RNA and after cDNA was verified using NanoDrop® spectrophotometer, model 2000
(Thermo Scientific) as recommended in the user manual (NanoDrop 2000 / 2000c
Spectrophotometer, V1.0 user manual, 2009).
2.3.7. Determination of ras and hif-1sequences
A search for 28S, ef-1 hif-1α and ras genes partial sequences for fish species
were performed in http://www.ncbi.nlm.nih.gov. Obtained sequences were use to
design degenerate primers based on the conserved regions of 28S, ef-1α, ras and hif-
1α. The annealing temperature of the degenerated primers was optimized by gradient
PCR using PCR master mix (Promega). All PCR products obtained were sequenced
with Kit ABI PRISM® Big DyeTM Terminator Cycle Sequencing Ready Reaction
(Applied Biosystems) and run on an ABI 3130XL automatic DNA sequencer (Applied
Biosystems). Obtained sequences were analyzed using the BLAST program from NCBI
and then used to generate the specific primers for Colossoma macropomum q-PCR,
ras, hif-1α (target primers), 28S, and ef-1α (reference primers) showed in Table 1.
137
2.3.8. Quantitative real-time PCR
Expression patterns of the C. macropomum ras oncogene and hif-1 gene were
analyzed using quantitative real-time PCR (qRT-PCR) through equipment Viia7 Dx from
Life Technologies (Applied Biosystems). We used a 96-well thin-wall PCR plate where
we added 1.0 μL of cDNA of C. macropomum in triplicate from each treatment (n=4).
After, we added to each well 1.0 μL of each primer (concentration of ras, 2.0 pmol; hif-
1α, 1.8 pmol, 28S, 2.5 pmol and ef-1α, 1.5 pmol), 2.0 μL of nuclease-free water 192
(Ambion, Life Technologies) and 5 μL SYBR Green PCR Master Mix (Applied
Biosystems) in a total volume of 10 μL. The following steps qRT-PCR reaction was
performed: the PCR plate was heated for 2 min at 50 °C, plus 95 °C for 10 min; followed
by 40 cycles of 95 °C for 15 s and 60 °C for 1 min (annealing temperature of all
primers). The relative quantification of the target and reference genes was evaluated
using standard curves. The amplification efficiency and threshold were automatically
generated by standard curves as follows: 28S (slope -3.36/ R2 0.99), ef-1α (slope -
.3.34/ R2 0.99), ras (slope -3.33/ R2 0.97) and hif-1α (slope -3.30/ R2 0.99). For PCR
efficiency, calculations of standard curves were constructed using a serial dilution curve
obtained from a pool of experimental samples (1000 to 1 ng cDNA concentration; n=4).
All primer pairs showed high PCR efficiency (between 98-100%). Serial dilutions of a
cDNA standard were amplified in each run to determine amplification efficiency
according to Pfaffl (2001).
2.3.9. Statiscal Analyses
All values are presented as mean ± SEM (Standard statistical tests, distribution
and homogeneity of data were checked. Gene expression, hematological parameters,
genotoxic test (comet assay) and enzymatic data data were analyzed by two-way
ANOVA test, with oxygen concentration (normoxia and hypoxia) and water
contamination by RD as the factors, followed by Tukey’s post hoc test for comparisons.
Statistical significance was accepted at the level of P<0.05.
138
Oxygen pressure measure (PO2 crit) data from fish no contaminated and
contaminated with RD were analyzed by t test.
All statistical tests were run using SigmaStat 3.5 and the graphs were plotted
using SigmaPlot 11.0 software.
3. Results
No mortality was observed during the subletal RD exposure in normoxia group (N)
and normoxia plus RD (NRD) group. However, for the hypoxia group (H) and the
hypoxia plus RD (HRD) treatment, one and four fish died, respectively.
3.1. Oxygen pressure (PO2 crit)
No difference was detected for PO2crit values in the C. macropomum exposed to
water free of contaminant (Control) and to RD contaminated water (RD). The metabolic
rate at lower oxygen contents in the water decreased in the same way in fish from both
treatments (Control and RD) (P= 0.878/ t= 0.158). Thus, RD (nominal concentration 15
mg. L-1) did not affect C. macropomum oxygen consumption. The average critical
oxygen tensions (PO2crit) were 1.49 mg O2. L-1 ± 0.06 and 1.47 O2. L
-1 ± 0.13 for control
and RD groups, respectively (n=3) (Figure 1).
3.2. Hematological plasma glucose parameters
There was no statistical difference in Hb, Ht, RBC, MCH, MCV and CMCH blood
parameters in fish exposed to normoxia (N x NRD). The same occurred in Hb, RBC,
MCH, MCV and CMCH for fish exposed to hypoxia (H x HRD). Hb concentration was
higher in fish exposed to hypoxia (H) than in normoxia (N) (P= 0.008) (Table 2). Ht
decreased in fish exposed to HRD in comparison with H (P= 0.006), and increased in
hypoxia (H), in comparison with fish under normoxia (N) (P=0.012). RBC increased in
fish exposed to hypoxia (H) in comparison with (N) (P = 0.040), and in MCH the same
occurred (P= 0.047). Glucose levels were higher in fish exposed to NRD than in N
treatment (P= 0.005). Fish exposed to HRD presented an increase in glucose levels in
comparison with H (P< 0.001). Tambaqui under hypoxia (H) and hypoxia plus RD
139
(HRD) showed an increase in glucose levels in comparison with NRD (P = 0.003) (Table
2).
3.3. Genetic damage in erythrocytes by comet assay
DNA damage in erythrocytes increased in fish exposed to NRD (GDI: 327.0 ±
7.7) in comparison with N (GDI: 234.6 ± 15.0) (P< 0.001). There was no difference in
genetic damages between tambaquis subjected to hypoxia (H) and hypoxia plus RD
(HRD). According to genetic damage index, DNA damage in erythrocytes was higher in
fish exposed to H (GDI: 317.2 ± 18.5) than in fish exposed to N (GDI: 234.6 ± 15.0) (P<
0.001) (Table 3).
3.4. Biochemical analysis
No difference was observed in liver GST activity of fish exposed to N and NRD,
neither in H and HRD. Fish exposed to hypoxia (HRD) presented an increase in GST
activity (1.89 times) in comparison with fish exposed to normoxia (NRD) (P< 0.001)
(Figure 2A) suggesting a magnification of the RD effect when combined with hypoxia.
CAT activity was higher in fish exposed to hypoxia (H [1.51 times] and HDR [1.39
times]) compared with fish exposed to normoxia (N and RD). However, there was no
difference in liver CAT activity in fish exposed to normoxia (N and RD) and hypoxia (H
and HRD) (Figure 2B).
No difference was also observed in lipoperoxidation levels (LPO) between the
groups of fish exposed to normoxia (N and NRD). However, fish exposed to hypoxia
presented a decrease in LPO levels in HRD treatment in comparison with N (P = 0.016).
There was no difference in LPO levels between the treatments and normoxia and
hypoxia condition (Figure 2C).
3.5. Liver histopathology
Normal fish liver presented a parenchyma consisting by polyedric hepatocytes
organized in cords with one or two cells, surrounded by sinusoids, as observed in
control (N) (Figure 3A). Fish liver showed also the hepatopancreas cell types (Figure
140
3B). Some of the liver alteration observed in the all treatments with moderate (+) or low
frequency (0+) were sinusoidal swelling (Figure 3C) and Leukocyte infiltration (Figure
3D). Cellular vacuolization was frequent (++) in fish exposed to N and NRD treatments
and highly frequent (+++) in fish exposed to HRD (Figure 3D). Fish liver exposed to
normoxia and RD presented most of the histopathological damages classified as
moderate frequency (+). Qualitatively, the intensity of tissue damage and the level of the
damages (stage II and III) increased in the hepatic tissue of fish exposed to hypoxia and
hypoxia plus RD (HRD) (Table 4). Fish exposed to hypoxia presented higher damage
levels as the occurrence and frequence of injuries in HDR. Injuries in stage II as
cytoplasm degeneration, pyknotic nuclei (Figure 3 E) and cell disruption were classified
as frequent (++) in NRD and H groups. In HDR treatments, fish showed high frequency
(+++) of injuries in stage II. High frequency (+++) of focal necrosis (Figure 3F) was
observed in fish exposed to hypoxia and RD, the same occurred with fish exposed only
to hypoxia (H).
3.6. Hif-1 expression and ras oncogene
Relative expression of hif-1 on the liver of C. macropomum was not statistically
different between the different concentration of oxygen (normoxia and hypoxia) and
between the treatments (no RD and RD) (P = 0.113). No difference was observed
between fish exposed to normoxia (N and NRD). The same behavior was observed in
the relative expression of hif-1in fish exposed to hypoxia (H and HRD). Instead, there
was a down regulation in the expression of hif-1 in fish exposed to H (2.18-fold) and
HRD (6.81-fold) in comparison with fish exposed to normoxia (N and NRD) (Figure 4).
The relative expression of ras oncogene was statically different between the
different concentration of oxygen (normoxia and hypoxia) and the treatments (no RD
and RD) (P < 0.001). Ras oncogene was over expressed 3.68-fold in fish exposed to
RD (NRD) in comparison with fish in the absence of the contaminant in normoxia (N) (P
<0.001). There was no difference in ras relative expression between fish exposed to
hypoxia (H and HRD). Fish exposed to HRD down regulated the expression of ras
oncogene (12.20-fold) in comparison with fish exposed to NRD (P < 0.001) (Figure 5).
141
4. Discussion
Glyphosate-based herbicides are considered relatively nontoxic (WHO, 1994),
and its broad application to aquatic systems and pollution of terrestrial ecosystems are
a concern for ecotoxicologists. Therefore, the increasing preoccupation results in the
need to find reliable markers reflecting RD effects in order to better understand its
potential hazards and prognose faraway perspectives (Lushchak et al., 2009).
Responses of fish to the impact of any kind of toxicant appear, first of all, as main
blood parameters changes. Hematological analysis enables to elicit latent course of the
toxicosis, warning the danger even when all other parameters indicate relative well
being (Zhydenko, 2008). Evaluating fish blood parameters might be a useful tool to
understand the impact of agrichemicals on fish health (Kreutz 2011). Herein, no
difference was observed in C. macropomum hematological parameters (Hb, Ht, RBC,
MVC, MHC and MCHC) comparing fish exposed to normoxia (N) with normoxia plus RD
(NRD). Moreover, when we compared fish submitted to hypoxia (H) and hypoxia plus
RD (HRD), no alteration was observed in Hb, RBC, MVC, MHC and MCHC parameters.
However, a decrease in Ht levels could be observed in fish in hypoxia plus RD
compared to hypoxia. Hb, Ht and RBC blood parameters decreased in common carp
(Cyprinus carpio) subjected to RD at 3.5, 7 and 14 ppm for 16 days compared to
control. On the other hand, MCV and MCH increased and MCHC decreased (Gholami-
Seyedkolaei et al., 2013). Hematocrit levels did not change in catfish (Rhamdia quelen)
following short term exposure to sublethal concentrations of glyphosate (0.730 mg/l-1)
witch corresponds to 10% of LC 50% in 96h (Kreutz et al., 2011). Piava fish (Leporinus
obtusidens) exposed to different concentration of RD (2, 6, 10 ad 20 mg/L) showed a
decrease in hematological parameter evaluated (Hb, Ht and RBC) (Glusczak et al.,
2006). Herein, hematocrit levels, hemoglobin, RBC, MVC and MHC increased in C.
macropomum exposed to hypoxia (H) when compared with fish exposed to normoxia
(N). C. macropomum is an Amazon fish with the capacity to regulate the levels of
hematocrit and hemoglobin to cope with low concentration of oxygen (Val, 1996). The
increase in Ht levels is a consequence of spleen contraction since hemoglobin
concentration also increased, leading to increased cell volume (MCV) and MCH. The
142
increase observed in MCV and MCH values possibly result from the increase of
immature RBC (Saravanan et al., 2011). Concerning the influence of RD contamination
on fish blood response it is clear that it depends on the contaminant concentration, the
surfactant compounds applied in the herbicide formulation, the time of exposure, and
fish species tested.
Indeed, contaminants such as RD along with hypoxia conditions are stressful to
fish. In response to stress, the body prepares to minimize the effects of the stressor.
The release of hormones such as catecholamines and cortisol are well followed by
increased glucose, an energy reserve ready for use (Val et al., 2004). In the present
work, fish exposed to normoxia plus RD (NRD) showed high levels of glucose
compared to C. macropomum exposed to normoxia. There was an increase in glucose
levels of fish exposed to hypoxia and RD compared to hypoxia (H), and fish submitted
to HRD also showed higher glucose levels than fish exposed to NRD. The RD
contamination was stressful for C. macromopum, and the combined effect with hypoxia
was even more. Langiano and Martinez (2008) observed increased levels of plasma
glucose of P. lineatus exposed to 10 mg L−1 of RD for 24 and 96 h. Other herbicides
are also described in the literature to affect fish glucose levels. For instance, juvenile
rainbow trout (Oncorhynchus mykiss) chronically exposed to verapamil (0.5, 27 and 270
g/L) showed increase in glucose levels (Li et al., 2011); Rhandia quelen exposed to
clomazone (0.5 and 1.0 mg/L also presented elevated plasma glucose in treated fish. A
different result was described by Braz-Mota and collaborators (2015), where no
alteration in plasma glucose of C. macropomum exposed to RD occurred. According
Almeida-Val et al. (2005), most Amazonian fish species submitted to some level of
oxygen depletion show alterations in plasma glucose. The Amazon cichlid, Astronotus
crassipinnis, presented accumulation of plasma glucose at low oxygen levels, probably
due to an activation of hepatic glycogenolysis as indicated by the decreases in liver
glycogen (Chippari-Gomes et al., 2005). An increase in blood glucose levels was also
observed in Atlantic sturgeon (Acipenser oxyrinchus) and shortnose sturgeon
(Acipenser brevirustrum) exposed to hypoxia (Baker et al., 2005).
Comet assay is a technique used to detect genomic lesions, which after being
processed, may result in mutation. Different than mutations, the lesions detected with
143
the comet assay can be recovered (Gontijo and Tice, 2003). Results of genotoxicity
studies on glyphosate products are contradictory depending on purity of the active
agent, nature of inert components, type of the applied test, as well as organisms tested
(Çavas and Konen, 2007). For instance, in cultured human cell line Hep-2, settled with
glyphosate at concentrations of 3.00 -7.50 mM, an increase in DNA damage was
reported as well as an extention in DNA migration compared with control (Mañas et al.,
2009). In another study, addressing microbial mutagenicity, Salmonella typhimztrium
strains TA1535, TAlOO, TA1537, TA1538, and TA98 were treated with 10 to 5000
mg/plate of glyphosate and no statistically significant induction of mutagenecity above
solvent control levels was observed as well as no significant dose-response (Li and
Long, 1988).
In the present study, fish exposed to normoxia plus RD (NRD) showed an
increase in genetic damage index (GDI) compared with fish exposed to normoxia (N).
However, fish exposed to hypoxia plus RD, when compared with fish exposed to
hypoxia (H) did not present differences. Fish exposed to hypoxia (H) showed higher
GDI values than fish exposed to normoxia (N). RD was able to induce DNA damage in
blood cells of C. macropomum. The predominant class of DNA damage in C.
macropomum erythrocytes was the class 4 in treatments of fish exposed to NRD, H and
HRD. Negreiros and collaborators (2011) observed an increase in DNA damage in
Hippocampus reidi exposed to hypoxia and petroleum. The comet scores for fish
exposed to hypoxia, oil and hypoxia plus oil were significantly higher than the respective
negative control groups. The predominant class of DNA damage in Hippocampus reidi
was class 2 in hypoxia.
Guilherme and collaborators (2014) confirmed the genotoxic effect of RD through
comet assay analyzing Anguilla anguila erythrocytes. Authors observed an increase in
DNA strand breaks in fish exposed during 3 days to 116 g L-1 of RD and the
predominant class of DNA damage was the class 3. In another work, Anguilla anguilla
fish were exposed to RD (58 and 116 g L-1) and the active ingredient, glyphosate
(17.9 and 35.7g L-1) and the surfactant polyethoxylated amine; (POEA) (9.3 and 17.3
g L-1). After one day exposure, the GDI values, with the exception of the lower
concentration of RD, displayed significantly higher values in comparison with control
144
(Guilherme et al., 2012). The induction of DNA damage (Comet assay) on peripheral
erythrocytes was also observed in freshwater goldfish Carassius auratus; RD
significantly increased the DNA damage following 2 days exposure and gradual
increases in GDI values were noticed at the fourth and sixth days, indicating inhibition of
DNA repair during the exposure period (Çavas and Konen, 2007). RD is clearly toxic for
C. macropomum inducing DNA damages; hypoxia was also capable to induce DNA
strand breaks.
Contaminants such as pesticides may induce reactive oxygen species (ROS),
resulting in the imbalance between pro-oxidant and antioxidant defense mechanisms
(Glusczak et al., 2011). Enzymatic and non-enzymatic antioxidants are essential to
maintain the redox status of fish cells and serve as an important biological defense
against oxidative stress (Bainy et al., 1996). Variations in the activities of antioxidant
enzymes have been proposed as indicators of pollutant mediated oxidative stress
(Ahmad et al., 2000; Li et al., 2003). Recently, the effects of RD and glyphosate on
oxidative stress markers have been addressed in fish (Braz-Mota et al, 2015, Lushchak
et al., 2009, Glusczak et al., 2007). GSTs are detoxifying enzymes of phase II that
catalyze the conjugation of GSH with a variety of electrophilic compounds (Ferreira et
al., 2010). In the present study GST activity increased in the liver of C. macropomum
exposed to hypoxia combined with RD (HRD) in comparison with fish exposed to
normoxia combined with RD. There was no difference, though, in GST activity between
fish exposed to normoxia (N) versus normoxia plus RD (NRD). The same behavior was
observed in fish submitted to hypoxia (H) versus hypoxia plus RD (HRD). Lushchak and
collaborators (2009) observed a reduction in GST activity in goldfish exposed to RD (2.5
- 20mg L-1) for 96 h in comparison with control. On the other hand, Langiano and
Martinez (2008), studying Prochilodus lineatus exposed to RD (7.5 and 10 mg L-1) for 6,
24 and 96 h, observed no alteration in GST activity. The same authors explained the
absence of variation in GST activity as the metabolism of the compounds present in RD,
which may be processed by other biotransformation pathways. In the present study, the
increase in GST activity in C. macropomum under HRD may be explained by the
oxidative stress induced by hypoxia. Changes in environmental O2 availability can alter
145
ROS production, and both hyperoxia and hypoxia are thought to increase oxidative
stress (Lushchak, 2011).
In the present work, catalase (CAT) did not present alteration between fish
exposed to normoxia versus normoxia and RD (NRD). The same occurred with fish
submitted to hypoxia compared with HRD. Menezes and collaborators (2011) observed
no alteration in CAT activity in catfish (Rhamdia quelen) exposed to RD (0.45 and 0.95
mg L-1) for 8 days. Catalase activity in the liver of Rhamdia quelen also did not change
during 96h exposure to 0.2 and 0.4 mgRD.L-1 according to Glusczak and collaborators
(2007). On the other hand, our results showed an increase in CAT activity in C.
macropomum exposed to hypoxia (H) compared with fish exposed to normoxia (N). The
same behavior was presented by fish exposed to hypoxia plus RD (HRD) compared to
fish under NRD. The hypoxia combined with RD was, again, the inducible factor of
increased oxidative stress. Zhang and collaborators (2016) evaluated the enzymatic
activities of Darkbarbel catfish, Pelteobagrus vachelli, for oxidative stress induced by
acute hypoxia. The authors observed an increase in GST and CAT activity of fish
exposed to 1.5 mg L-1 oxygen concentration in comparison with the control group. It has
been considered that the reduced dissolved O2 also affects oxidative stress in fishes,
but via mechanism that are still unclear (Chandel and Shumacker, 2000).
Lipid peroxidation is thought to be an effect of the toxic action of environmental
pollutants, leading to injuries of cellular function under oxidative stress conditions. Lipid
peroxidation takes place in the the cell membrane lipids, altering cohesion, flow,
permeability, and metabolic function, leading to cell membrane instability with
consequent cellular damage and death (Ortiz-Ordonez et al., 2011). There was no
alteration in LPO levels between fish exposed to normoxia and normoxia plus RD.
Neither in fish exposed to normoxia (N) versus fish exposed to hypoxia (H). The same
occurred between fish submitted to normoxia and RD (NRD) and hypoxia and RD
(HRD). However, fish exposed to hypoxia and RD (HRD) presented a decrease in LPO
levels in comparison with fish submitted to hypoxia (H). The lower LPO levels in hypoxia
and RD (HRD) treatment can be explained by the increased activity of antioxidant
defense enzymes, as above mentioned. We observed higher levels of GST and CAT on
liver of fish in the same conditions. The GST and CAT are able to reduce the oxidative
146
stress damages in hepatic tissue caused by ROS. Different results were observed by
Modesto and Martinez (2010) with Prochilodus lineatus exposed to Roundup
Transdorb® (RDT) acutely exposed (6, 24 and 96 h) to 1 mg L-1 of RDT and 5 mg L-1 of
RDT. In their study LPO levels increased significantly in the liver of fish exposed to both
concentrations of RDT for 6 h. However, GST activity was significantly reduced in fish
exposed for 6 h to both RDT concentrations and CAT activity showed a significant
reduction in fish exposed for 6 h to the highest concentration of herbicide. Menezes and
collaborators (2011) also observed the same pattern measuring LPO levels throughout
the TBARS (thiobarbituric acid reactive species) methodology. There was a significantly
higher TBARS levels in liver of Rhamdia quelen exposed to the 0.95 mg/l compared
with control fish. Conversely, hepatic tissue exposed to RD presented no alteration of
CAT activity compared with the control group. The differences in peroxide levels have
also been attributed to the variation in antioxidant mechanisms of fish species (Radi et
al. 1985; Ahmad et al. 2000). In the present work, considering the fact that hypoxia can
induce oxidative stress, the antioxidant enzymes GST and CAT acted minimizing the
effects of reactive oxygen species in fish exposed to hypoxia combined to RD (HDR).
Exposure to xenobiotics as metals, pesticides and petroleum derivates can
induce histopathological damages in fish organs as liver and gills (Jayaseelan et al.,
2014, Leite et al., 2015, Samanta et al., 2016). The liver is the central metabolic organ
and plays a key role in biochemical transformations of the xenobiotic substances, which
inevitably reflects on its integrity by creating lesions and other histopathological
alterations in the liver parenchyma (Roberts, 1978). Histopathological changes may
affect organ function depending on the distribution and intensity of the lesions (Bernet et
al., 1999).
In the present work C. macropomum submitted to normoxia (N) and normoxia
plus RD (NRD) showed low frequency of leukocyte infiltration. On the other hand, fish
exposed to hypoxia (H) and hypoxia and RD (HRD) showed a moderate frequency of
leukocyte infiltration indicating an increase in inflammatory processes. Hued and
collaborators (2012) also observed leukocyte infiltration as signal of inflammatory
process in Jenynsia multidentata subjected to different concentration of RD (5, 10. 20
and 35 mg/l). In our work fish exposed to hypoxia and RD (HRD) showed the most
147
injured hepatic liver, presenting higher frequency of cytoplasm vacuolization, nuclear
degeneration, cytoplasm degeneration, pyknotic nuclei, cell disruption and focal
necrosis. In fish exposed to hypoxia (H), most of tissue damage was classified as
frequent, and focal necrosis had high frequency, resulting in tissue damage as well.
Necrotic focus compromises the function of the liver as it is considered irreparable
damage (Poleksic and Mitrovic-Tutundsic, 1994). Langiano and Martinez (2008)
frequently observed cellular and nuclear degeneration; cytoplasmatic vacuolization; and
pyknotic nuclei em P. lineatus exposed to RD. Cytoplasmatic vacuolization suggest
changes in liver function (Takashima and Hibiya, 1995). The vacuolization of
hepatocytes might indicate an imbalance between the rate of synthesis of substances in
the parenchymal cells and the rate of their release into the systemic circulation
(Gingerich, 1982). Necrosis were found in the liver of African catfish (Clarias gariepinus)
after exposure to glyphosate (Ayoola, 2008), and in liver of neotropical fish Piaractus
mesopotamicus necrosis was described after exposure to Roundup® Ready (RR)
(Shiogiri et al., 2012). An increase in vacuolization is related with induction of necrosis
as observed by Zhidenko and Kovalenko (2007) in the liver of carps exposed to RD for
14 days. Histological changes, which are connected with the granular and vacuolar-drop
dystrophy, lead to the death of hepatocytes and to necrotic changes and, as a
consequence, to the functional liver failure.
Hypoxia can affect the liver structure, as we observed in this work, where higher
frequency of necrosis was observed in fish under hypoxia and hypoxia plus RD
condition. Similarly, Mustafa and collaborators (2012) found lipid vacuolization and
necrosis in liver of Cyprinus carpio exposed to hypoxia and hypoxia plus copper
contamination. All these damages may have altered the gene expression and enzyme
activities as we mentioned before. Necrosis, as observed in H and HRD exposed fish,
may have lead to malfunction of the cells and impairment of molecular machinery. In
fact, DNA damages also occurred in these animals, as seen through comet assay.
To the best of our knowledge, the present work is the first to correlate gene
expression (hif-1 gene and ras oncogene) and RD contamination combined with
hypoxia in an Amazon fish species. Variation in the level of oxygen concentration in the
Amazon waters is a common phenomenon, and Amazon fish developed a series of
148
strategies to cope with low oxygen levels during their evolutionary history (Almeida-Val
et al., 1999a, 1999b). The use of herbicides in the last few years have been common in
the Amazon region, specially surrounding fish farm tanks, and no information is
available about the combined effects of hypoxia and RD in fish.
Hif-1 acts as a key transcription factor in regulating metabolism, development,
cellular survival, proliferation and pathology under hypoxia condition. Compared to
mammals, fish are more vulnerable to hypoxia stress and contamination; however, the
regulation of hif-1 in fish remains obscure (Liu et al., 2013). In the present work there
was no alteration in hif-1relative expression between fish exposed to normoxia and
normoxia plus RD. The same results were observed in fish exposed to hypoxia
compared to hypoxia plus RD. However, comparing fish under normoxia and hypoxia,
we observed down regulation of hif-1 gene expression for both contamined and non-
contamined groups. Our results are different from those showed by Baptista and
collaborators (2016), where the levels of hif-1 increased on the liver of Oscar
(Astronotus ocellatus) exposed to 3h hypoxia. A slight over expression of hif-1 was
observed by Kodama and collaborators (2012) in dragonet fish (Callionymus
valenciennei) exposed to environmental hypoxia (1.7 ml l-1) in Tokyo Bay, but the
difference between non hypoxic and hypoxic sites was not significant. The hif-1 level
were significantly increased with the gradual decline of oxygen (7.2, 3.2, 2.8 and 2.2
mg/L) concentration in larval fish of Chinese sucker (Myxocyprinus asiaticus); however,
there was no significant difference among different hypoxia groups after re-oxygenation
(Chen et al., 2012). Most of the studies describe an over expression of hif-1 gene in
fish exposed to hypoxia (Terova et al., 2008, Geng et al., 2014), different from our
results for Amazon fish C. macropomum exposed to hypoxia and hypoxia plus RD. A
possible explanation for this controverse result, once this gene is responsible by the
transcription of more than 100 genes related to hypoxia, relies in a malfunction of
molecular machinery, as we shall mention further. Nevertheless, more studies must be
developed to better understand and elucidate these results.
The ras family of proto-oncogenes encodes small GTP binding proteins that
transduce mitogenic signals from tyrosine-kinase receptors (Barbacid, 1987; Cahill et
149
al., 1996). Ras genes are associated with tumorigenesis and also with metastasis (Cox
et al., 1004, Saez et al., 1994, Mora et al., 2007). Mutational events at codon 12 and 13
of the ras oncogene have already been associated with tumorigenesis in rainbow trout
(Onchorhynchus mykiss) and other teleost fishes (Nemoto et al., 1986).
Another mechanism of ras-implicated carcinogenesis involves overexpression of
the gene (Nogueira et al., 2006). In the present work, C. macropomum exposed to
normoxia plus RD (NRD) presented an overexpression of ras oncogene compared to
fish submitted to normoxia. Similar to the hif-1gene, ras oncogene was down
regulated in fish exposed to HRD compared to fish exposed only to hypoxia. However,
there was no difference in ras oncogene expression between fish exposed only to
normoxia versus hypoxia. Fish submitted to HRD showed a decrease in ras oncogene
expression compared to NRD. As far as we know, there is no prior work relating the
influence of RD or hypoxia over ras oncogene expression. Nogueira and collaborators
(2010) observed no alteration in ras oncogene expression of Dicentrarchus labrax and
Liza aurata collected in a polluted area (various types and sources of contamination) in
Ria Aveiro, Portugal. Ras was also overexpressed in C. macropomum acutely exposed
to Benzo[a]pyrene (4, 8 and 16 mol/kg) (Silva et al., 2016 accepted for publication). C.
macropomum exposed to Benzo[a]pyrene in the extreme scenario (A2) proposed by
IPCC, 2007 increased the levels of ras oncogene expression on the liver in comparison
with control (Silva et al., 2016 accepted for publication). Rivululos marmonatos, after
exposure to 4-nanylphenol presented a significant overexpression (P < 0.001) in the
liver c-Ki-ras (long form) (Lee et al., 2006). Glyphosate and the kind of surfactant used
can also affect the pattern of gene expression as demonstrated by Uchida and
collaborators (2012). The authors observed no significant gene expression changes in
liver of medaka (Oryzias latipes) after exposure to glyphosate through DNA microarray
analysis. Nevertheless, 78 and 138 genes were significantly induced by fatty acid
alkanolamide surfactant (DA) and glyphosate DA mixture, respectively. RAB 27A
member of ras oncogene family and ras homologous gene family member Q were
significantly affected in medaka exposed to glyphosate DA mixture. Herein, we
demonstrated that RD induces the overexpression of ras oncogene in normoxia
condition. Fish exposed to NRD presented moderate liver tissue damage (+), including
150
the damage in stage III (necrosis). It is likely that Ras oncogene was induced to
maintain the survivor and division capacity of the hepatocytes. On the other hand,
hypoxia fish downregulated the expression of ras oncogene when combined with RD
(HRD). As the histopathology analyzes revealed, the fish under HRD treatments had
their liver highly injured compared with fish under NRD. Necrotic focus appeared in a
higher frequency (+++) on the liver of those animals, and, so, the hepatocytes may have
lost their ability to induce the expression of ras oncogene and hif-1as above-described
due to hepatic tissue disruption and molecular machinery failure. As far as we know,
this is the first work describing the combined effects of hypoxia and RD. The similar
effect of these two stressors separately and combined need to be better understood.
5. Conclusion
The results obtained in this studt revealed that C. macropomum is very sensitive
species concerning RD contamination, and this sensitivity increases when combined
with hypoxia exposure. We observed that hypoxia interestingly induced a down
regulation in hif-1 expression, and this behavior could be explained by an impairment
in the molecular machinery since this was the strongest situation imposed to the fish
(HRD) and caused cellular and DNA damages. Nevertheless, further studies are
necessary to better explain those results. RD induced and overexpression of the
oncogene ras, contributing to cell survivor, but the combination with hypoxia caused a
down regulation of this oncogene ras as occurred with hif-1. Hepatic tissue injuries
increased in fish under hypoxia and hypoxia plus RD, affecting the organ function.
Despite de RD contamination, antioxidant defenses (GST and CAT) were capable to
minimize ROS stress and avoider high levels of membrane lipoperoxidation. RD is very
toxic to C. macropomum as demonstrated by genotoxic results.
Acknowledgments: FAPEAM and CNPq supported this study through INCT-ADAPTA
grant to ALV. Thanks are also due to the personnel of the Functional Histology
Laboratory of the Federal University of Amazonas for their support with the preparation
of histological material. VMFAV is the recipient of a Research Fellowship by CNPq.
151
6. References
Ahmad, I., Hamid, T., Fatima, M., Chand, H. S., Jain, S. K., Athar, M., & Raisuddin, S. (2000). Induction of hepatic antioxidants in freshwater catfish (Channa punctatus Bloch) is a biomarker of paper mill effluent exposure. Biochimica et Biophysica Acta (BBA)-General Subjects, 1523(1), 37-48. Almeida-Val, V.M.F., Val, A.L. and Walker I. (1999a) Long- and short-term adaptation of amazon fishes to varying O2 levels: Intra-specific phenotypic plasticity and interspecific variation. In: Val AL and Almeida-Val VMF (eds) Biology of Tropical Fishes. Editora do INPA, Manaus, pp 185-206. Almeida-Val V.M.F., Paula-Silva M.N., Duncan W.P., Lopes N.P. and Val A.L. (1999b) Increase of anaerobic potential during growth of an Amazonian cichlid, Astronotus ocellatus. Survivorship and LDH regulation after hypoxia exposure. In: Val AL and Almeida-Val, V.M.F.(eds) Biology of Tropical Fishes. Editora do INPA, Manaus, pp 437-448. Almeida‐Val, V. M. F., Gomes, A. R. C., & Lopes, N. P. (2005). Metabolic and physiological adjustments to low oxygen and high temperature in fishes of the Amazon. Fish physiology, 21, 443-500. Araújo, R.S., Garcia, M.V.B., Garcia, T.B., (2008). Toxicidade aguda do herbicida Glifosato (Roundup) para Danio rerio (Teleostei, Cyprinidae), em condições tropicais. In: Anais da III Jornada de Iniciação Científica da Embrapa Amazônia Ocidental. Ed. 57. ISSN 1517–3135. Ayoola, S. O. (2008). Histopathological effects of glyphosate on juvenile African catfish (Clarias gariepinus). Am Eurasian J Agric Environ Sci, 4, 362-7.
Bainy, A.C.D. (1996). Oxidative stress as biomarker of polluted aquatic sites. In: Val, A.L., Almeida-Val, V.M.F., Randall, D.J. (Eds.), Physiology and Biochemistry of the Fishes of the Amazon. INPA, Manaus, Brazil, pp. 101–110. Baker, D.W., Wood, A.M., & Kieffer, J.D. (2005). Juvenile Atlantic and short nose sturgeons (family: Acipenseridae) have different hematological responses to acute environmental hypoxia. Physiological and Biochemical Zoology, 78(6), 916-925. Baldisserotto, B., Chippari-Gomes, A.R., Lopes, N.P., Bicudo, J.E.P.W., Paula-Silva, M.N., Almeida-Val, V.M.F., & Val, A.L. (2008). Ion fluxes and hematological parameters of two teleosts from the Rio Negro, Amazon, exposed to hypoxia. Brazilian Journal of Biology, 68(3), 571-575.
Baptista, R.B., Souza-Castro, N., & Almeida-Val, V.M.F. (2016). Acute hypoxia up-regulates HIF-1α and VEGF mRNA levels in Amazon hypoxia-tolerant Oscar (Astronotus ocellatus). Fish physiology and biochemistry, 1-12.
Barbacid, M. (1987). Ras genes. Annual Review Biochemistry. 56, 779–827.
Bernet, D., Schmidt, H., Meier, W., Burkhardt‐Holm, P., & Wahli, T. (1999). Histopathology in fish: proposal for a protocol to assess aquatic pollution. Journal of fish diseases, 22(1), 25-34.
Beutler, E. (1975). Red Cell Metabolism: A manual of biochemical methods. Grune & Straton, New York.
Bolognesi, C. (2003). Genotoxicity of pesticides: a review of human biomonitoring studies. Mutation Research/Reviews in Mutation Research, 543(3), 251-272.. Boutilier, R.G. (2001). Mechanisms of cell survival in hypoxia and hypothermia. Journal of Experimental Biology, 204(18), 3171-3181. Bracken, C.P., Whitelaw, M. L., & Peet, D.J. (2003). The hypoxia-inducible factors: key transcriptional
152
regulators of hypoxic responses. Cellular and Molecular Life Sciences CMLS, 60(7), 1376-1393.
Bradford, M.M. (1976). A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the protein-dye binding. Analytical Biochemistry 72:248-254.
Brandão, R.M.L. Efeitos do hormônio do crescimento recombinante bovino (rbgh lactotropin
®) na
expressão do gene igf-i e parâmetros fisiológicos em juvenis de tambaqui (Colossoma macropomum)/ Rúbia Maielli Lima Brandão. Dissertação (mestrado) Newton Lins, Manaus, 2015. Orientador: Dra.Vera Maria Fonseca de Almeida e Val. Área de concentração: Aquicultura.
Braz-Mota, S., Sadauskas-Henrique, H., Duarte, R. M., Val, A. L., & Almeida-Val, V. M. (2015). Roundup
®
exposure promotes gills and liver impairments, DNA damage and inhibition of brain cholinergic activity in the Amazon teleost fish Colossoma macropomum. Chemosphere, 135, 53-60.
Cahill, M.A., Janknecht, R., & Nordheim, A. (1996). Signalling pathways: jack of all cascades. Current Biology, 6(1), 16-19. Cattaneo, R., Clasen, B., Loro, V. L., de Menezes, C.C., Pretto, A., Baldisserotto, B., ... & de Avila, L. A. (2011). Toxicological responses of Cyprinus carpio exposed to a commercial formulation containing glyphosate. Bulletin of Environmental Contamination and Toxicology, 87(6), 597-602.
Cavalcante, D. G. S. M., Martinez, C. B. R., & Sofia, S. H. (2008). Genotoxic effects of Roundup® on the
fish Prochilodus lineatus. Mutation Research/Genetic Toxicology and Environmental Mutagenesis, 655(1), 41-46.
Çavaş, T., & Könen, S. (2007). Detection of cytogenetic and DNA damage in peripheral erythrocytes of goldfish (Carassius auratus) exposed to a glyphosate formulation using the micronucleus test and the comet assay. Mutagenesis, 22(4), 263-268. Chabot, D., & Claireaux, G. (2008). Environmental hypoxia as a metabolic constraint on fish: the case of Atlantic cod, Gadus morhua. Marine Pollution Bulletin, 57(6), 287-294. Chandel, N. S., & Schumacker, P. T. (2000). Cellular oxygen sensing by mitochondria: old questions, new insight. Journal of Applied Physiology, 88(5), 1880-1889.
Chen, N., Chen, L. P., Zhang, J., Chen, C., Wei, X. L., Gul, Y., ... & Wang, H. L. (2012). Molecular characterization and expression analysis of three hypoxia-inducible factor alpha subunits, HIF-1α/2α/3α of the hypoxia-sensitive freshwater species, Chinese sucker. Gene, 498(1), 81-90. Chippari-Gomes, A.R., Gomes, L.C., Lopes, N.P., Val, A.L., & Almeida-Val, V.M.F. (2005). Metabolic adjustments in two Amazonian cichlids exposed to hypoxia and anoxia. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 141(3), 347-355. Cox, A.D., Brtva, T.R., Lowe, D.G., Der, C.J. (1994). R-ras induces malignant, but not De Boeck, G., Wood, C. M., Iftikar, F. I., Matey, V., Scott, G. R., Sloman, K. A., ... & Val, A. L. (2013). Interactions between hypoxia tolerance and food deprivation in Amazonian oscars, Astronotus ocellatus. Journal of Experimental Biology, 216(24), 4590-4600.
Ferreira, D., da Motta, A. C., Kreutz, L. C., Toni, C., Loro, V. L., & Barcellos, L. J. G. (2010). Assessment of oxidative stress in Rhamdia quelen exposed to agrichemicals. Chemosphere, 79(9), 914-921.
153
Geng, X., Feng, J., Liu, S., Wang, Y., Arias, C., & Liu, Z. (2014). Transcriptional regulation of hypoxia inducible factors alpha (HIF-α) and their inhibiting factor (FIH-1) of channel catfish (Ictalurus punctatus) under hypoxia. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 169, 38-50. Gholami-Seyedkolaei, S. J., Mirvaghefi, A., Farahmand, H., Kosari, A.A., Gholami-Seyedkolaei, S.J., Gholami-Seyedkolaei S. J. (2013). Optimization of recovery patterns in common carp exposed to Roundup using response surface methodology: evaluation of neurotoxicity and genotoxicity effects and biochemical parameters. Ecotoxicology and Environmental Safety, 98, 152-161.
Gingerich, W.H. (1982). Hepatic toxicology of fishes. In Aquatic Toxicology (L. J. Weber, ed.), pp. 55–105. Raven Press, New York. Glusczak, L., dos Santos Miron, D., Crestani, M., da Fonseca, M. B., de Araújo Pedron, F., Duarte, M. F., & Vieira, V. L. P. (2006). Effect of glyphosate herbicide on acetylcholinesterase activity and metabolic and hematological parameters in piava (Leporinus obtusidens). Ecotoxicology and Environmental Safety, 65(2), 237-241.
Glusczak, L., dos Santos Miron, D., Moraes, B.S., Simões, R.R., Schetinger, M.R.C., Morsch, V.M., & Loro, V.L. (2007). Acute effects of glyphosate herbicide on metabolic and enzymatic parameters of silver catfish (Rhamdia quelen). Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 146(4), 519-524. Glusczak, L., Loro, V.L., Pretto, A., Moraes, B.S., Raabe, A., Duarte, M.F., ... & de Sousa Valladão, D.M. (2011). Acute exposure to glyphosate herbicide affects oxidative parameters in piava (Leporinus obtusidens). Archives of Environmental Contamination and Toxicology, 61(4), 624-630. Gontijo, A.M.M.C., & Tice, R. (2003). Teste do cometa para a detecção de dano no DNA e reparo em células individualizadas. Mutagênese ambiental. Canoas: Ulbra, 173-200. Guilherme, S., Gaivao, I., Santos, M. A., & Pacheco, M. (2010). European eel (Anguilla anguilla) genotoxic and pro-oxidant responses following short-term exposure to Roundup
®a glyphosate-based
herbicide. Mutagenesis, 25(5), 523-530. Guilherme, S., Santos, M. A., Barroso, C., Gaivão, I., & Pacheco, M. (2012). Differential genotoxicity of Roundup® formulation and its constituents in blood cells of fish (Anguilla anguilla): considerations on chemical interactions and DNA damaging mechanisms. Ecotoxicology, 21(5), 1381-1390. Guilherme, S., Santos, M.A., Gaivão, I., & Pacheco, M. (2014). Are DNA-damaging effects induced by herbicide formulations (Roundup® and Garlon®) in fish transient and reversible upon cessation of exposure. Aquatic Toxicology. 155: 213-221. He, W., Cao, Z. D., & Fu, S. J. (2015). Effect of temperature on hypoxia tolerance and its underlying biochemical mechanism in two juvenile cyprinids exhibiting distinct hypoxia sensitivities. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology, 187, 232-241. Hochachka, P.W., Somero, G.N., 2002. Biochemical Adaptation: Mechanism and Process in Physiological Evolution. Oxford University Press. Hued, A. C., Oberhofer, S., & de los Ángeles Bistoni, M. (2012). Exposure to a commercial glyphosate formulation (Roundup
®) alters normal gill and liver histology and affects male sexual activity of Jenynsia
multidentata (Anablepidae, Cyprinodontiformes). Archives of Environmental Contamination and Toxicology, 62(1), 107-117. Jayaseelan, C., Rahuman, A. A., Ramkumar, R., Perumal, P., Rajakumar, G., Kirthi, A. V., ... & Marimuthu, S. (2014). Effect of sub-acute exposure to nickel nanoparticles on oxidative stress and
154
histopathological changes in Mozambique tilapia, Oreochromis mossambicus. Ecotoxicology and Environmental Safety, 107, 220-228.
Jiang, Z.Y., Woolland, A.C.S., Wolf, S.P. (1991). Lipid hydroperoxide measurement by oxidation of Fe2+ in the presence of xylenol orange-comparison with TBA assay and on iodometric method. Lipids 26:777-860.
Junk, W. J. (1980). Áreas inundáveis-Um desafio para limnologia. Acta Amazonica. n. 10, 775– 796.
Kampen, E.J.; Zijlstra, W.G. 1964. Standartization of haemoglobinometry. In: Boroviczény, C. G. (Ed.) Erythrocytometric Methods and their standardization. Blibliotheca Haematologica, p.68-72. Keen, J.H., Habig, W.H., Jakoby, W.B. 1976. Mechanism for the several activities of the glutathione S-transferase. The Journal of Biological Chemistry 251:6183-6188. Kobayashi, S.C., Morikawa, Y., Hayashi, M., Sofuni, T. (1995). A comparison between manual microscopic analysis and computerized image analysis in the single cell gel electrophoresis assay MMS Community, 2 pp. 103–115.
Kochhann, D., Campos, D.F., & Val, A.L. (2015). Experimentally increased temperature and hypoxia affect stability of social hierarchy and metabolism of the Amazonian cichlid Apistogramma agassizii. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology, 190, 54-60. Kodama, K., Rahman, M.S., Horiguchi, T., & Thomas, P. (2012). Upregulation of hypoxia-inducible factor (HIF)-1α and HIF-2α mRNA levels in dragonet Callionymus valenciennei exposed to environmental hypoxia in Tokyo Bay. Marine pollution bulletin, 64(7), 1339-1347. Kreutz, L. C., Barcellos, L. J. G., de Faria Valle, S., de Oliveira Silva, T., Anziliero, D., dos Santos, E. D., ... & Zanatta, R. (2011). Altered hematological and immunological parameters in silver catfish (Rhamdia quelen) following short term exposure to sublethal concentration of glyphosate. Fish & Shellfish Immunology, 30(1), 51-57. Langiano, C.C. & Martinez, C.B. (2008). Toxicity and effects of a glyphosate-based herbicide on the Neotropical fish Prochilodus lineatus. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 147(2), 222-231.
Lee, Y. M., Jung, S. O., Seo, J. S., Yoon, Y. D., & Lee, J. S. (2006). Cloning of Ki-ras and Ha-ras cDNAs from the hermaphroditic fish Rivulus marmoratus (Cyprinodontiformes, Rivulidae) and its expression after exposure to 4-nonylphenol. Marine environmental research, 62, S136-S140. Leite, M. B. N. L., da Cruz, A. L., Rodrigues, L. E. A., Yamashita, S. R., Carqueija, C. R. G., & Nascimento, I. A. (2015). Comparing the Toxicity of Water-Soluble Fractions of Biodiesel, Diesel and 5% Biodiesel/Diesel Blend on Oreochromis niloticus Using Histological Biomarkers. Bulletin of Environmental Contamination and Toxicology, 95(5), 574-581. Li, A. P., & Long, T. J. (1988). An evaluation of the genotoxic potential of glyphosate. Toxicological Sciences, 10(3), 537-546. Li, W. M., Yin, D. Q., Zhou, Y., Hu, S. Q., & Wang, L. S. (2003). 3, 4-Dichloroaniline-induced oxidative stress in liver of crucian carp (Carassius auratus). Ecotoxicology and Environmental Safety, 56(2), 251-255. Li, Z. H., Velisek, J., Zlabek, V., Grabic, R., Machova, J., Kolarova, J., ... & Randak, T. (2011). Chronic toxicity of verapamil on juvenile rainbow trout (Oncorhynchus mykiss): effects on morphological indices, hematological parameters and antioxidant responses. Journal of Hazardous Materials, 185(2), 870-880.
155
Liu, S., Zhu, K., Chen, N., Wang, W., & Wang, H. (2013). Identification of HIF-1α promoter and expression regulation of HIF-1α gene by LPS and hypoxia in zebrafish. Fish physiology and biochemistry, 39(5), 1153-1163. Lushchak, V. I. (2011). Environmentally induced oxidative stress in aquatic animals. Aquatic Toxicology, 101(1), 13-30.
Lushchak, V., Kubrak, O. I., Storey, J. M., Storey, K. B., & Lushchak, V. I. (2009). Low toxic herbicide Roundup induces mild oxidative stress in goldfish tissues. Chemosphere, 76(7), 932-937.
Lutz, P. L. and Nilsson, G. E. (1997). Contrasting strategies for anoxic brain survival – glycolysis up or down. Journal of Experimental Biology. 200, 411-419. Mañas, F., Peralta, L., Raviolo, J., Ovando, H. G., Weyers, A., Ugnia, L., ... & Gorla, N. (2009). Genotoxicity of glyphosate assessed by the comet assay and cytogenetic tests. Environmental Toxicology and Pharmacology, 28(1), 37-41. Mangold, K., Chang, Y. J., Mathews, C., Marien, K., Hendricks, J., & Bailey, G. (1991). Expression of ras genes in rainbow trout liver. Molecular Carcinogenesis, 4(2), 97-102. Menezes, C. C., Da Fonseca, M. B., Loro, V. L., Santi, A., Cattaneo, R., Clasen, B., ... & Morsch, V. M. (2011). Roundup effects on oxidative stress parameters and recovery pattern of Rhamdia quelen. Archives of Environmental Contamination and Toxicology, 60(4), 665-671. Miyazaki, D.M.Y., Machado Neto, J.G., Castagnolli, N., (2004). Toxicidade aguda de triclorfon, partion metílico e glifosato para alevinos de tambaqui (Colossoma macropormum) e tambacu (C. macropormum X Piaractus mesopotamicus). In: Anais Encontro Brasileiro de Patologistas de Organismos Aquáticos (ENBRAPOA), Laguna. Maringá: Biblioteca Setorial da UEM. 8, 203. Modesto, K. A., & Martinez, C. B. (2010). Effects of Roundup Transorb on fish: hematology, antioxidant defenses and acetylcholinesterase activity. Chemosphere, 81(6), 781-787. Mora, N., Rosales, R., & Rosales, C. (2007). R-Ras promotes metastasis of cervical cancer epithelial cells. Cancer Immunology, Immunotherapy, 56(4), 535-544. Mustafa, S. A., Davies, S. J., & Jha, A. N. (2012). Determination of hypoxia and dietary copper mediated sub-lethal toxicity in carp, Cyprinus carpio, at different levels of biological organisation. Chemosphere, 87(4), 413-422. Muusze, B., Marcon, J., van den Thillart, G., & Almeida-Val, V. (1998). Hypoxia tolerance of Amazon fish: respirometry and energy metabolism of the cichlid Astronotus ocellatus. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology, 120(1), 151-156.
Navarro, C.E.K.G.; Pachaly, J.R. 1994. Manual de hematologia veterinária. São Paulo: Varela. p. 74–75.
Negreiros, L. A., Silva, B. F., Paulino, M. G., Fernandes, M. N., & Chippari-Gomes, A. R. (2011). Effects of hypoxia and petroleum on the genotoxic and morphological parameters of Hippocampus reidi. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology, 153(4), 408-414. Nemoto, N., Kodama, K. I., Tazawa, A., Masahito, P., & Ishikawa, T. (1986). Extensive sequence homology of the goldfish ras gene to mammalian ras genes. Differentiation, 32(1), 17-23. Neškovic, N.K., Poleksic, V., Elezovic,I., Karan,V., Budimir, M. (1996). Biochemical and histopathological effects of glyphosate on carp, Cyprinus carpio L. Bulletin of Environmental Contamination and Toxicology.56: 295–302.
156
Nogueira, P. R., Lourenço, J., Mendo, S., & Rotchell, J. M. (2006). Mutation analysis of ras gene in the liver of European eel (Anguilla anguilla L.) exposed to benzo [a] pyrene. Marine Pollution Bulletin, 52(12), 1. Nogueira, P., Pacheco, M., Pereira, M. L., Mendo, S., & Rotchell, J. M. (2010). Anchoring novel molecular biomarker responses to traditional responses in fish exposed to environmental contamination. Environmental Pollution, 158(5), 1783-1790. Ortiz-Ordoñez, E., Uría-Galicia, E., Ruiz-Picos, R. A., Duran, A. G. S., Trejo, Y. H., Sedeño-Díaz, J. E., & López-López, E. (2011). Effect of Yerbimat herbicide on lipid peroxidation, catalase activity, and histological damage in gills and liver of the freshwater fish Goodea atripinnis. Archives of Environmental Contamination and Toxicology, 61(3), 443-452.
Pfaffl, M.W. 2001. A new mathematical model for relative quantification in real-time RT PCR. Nucleic Acids Research, 29(9): 2003-2007.
Poleksic, V. e Mitrovic-Tutundžic V. 1994. Fish gills as a monitor of sublethal and chronic effects of pollution. IN: Müller, R.; Lloyd, R. Sublethal and chronic effects of pollutants on freshwater fish. Oxford: Fishing News Books. 30: 339-352.
Pörtner, H. O., & Grieshaber, M. K. (1993). Critical PO2 (s) in oxyconforming and oxyregulating animals gas exchange, metabolic rate and the mode of energy production. The vertebrate gas transport cascade adaptations to environment and mode of life (JEPW Bicudo, ed) CRC Press, Boca Raton FL, 330-357.
Quintero, M., Mackenzie, N., & Brennan, P. A. (2004). Hypoxia-inducible factor 1 (HIF-1) in cancer. European Journal of Surgical Oncology (EJSO), 30(5), 465-468. Radi, A. A. R., Matkovics, B., & Gabrielak, T. (1985). Comparative antioxidant enzyme study in freshwater fish with different types of feeding behaviour. Comparative Biochemistry and Physiology Part C: Comparative Pharmacology, 81(2), 395-399. Relyea, R.A. (2005). The impact of insecticides and herbicides on the biodiversity and productivity of aquatic communities. Ecological Applications, 15(2), 618-627. Roberts RJ. Fish pathology. London: Bailliere Tindall London; 1978. pp318. Rotchell, J. M., Lee, J. S., Chipman, J. K., & Ostrander, G. K. (2001). Structure, expression and activation of fish ras genes. Aquatic Toxicology, 55(1), 1-21. Saez, R., Chan, A.M., Miki, T., Aaronson, S.A., 1994. Oncogenic activation of human R-ras by point mutations analogous to those of prototype H-ras oncogenes. Oncogene 9, 2977–2982. Samanta, P., Mukherjee, A. K., Pal, S., Kole, D., & Ghosh, A. R. (2016). Toxic effects of glyphosate-based herbicide, Excel Mera 71 on gill, liver, and kidney of Heteropneustes fossilis under laboratory and field conditions. Journal of Microscopy and Ultrastructure. Saravanan, M., Karthika, S., Malarvizhi, A., & Ramesh, M. (2011). Ecotoxicological impacts of clofibric acid and diclofenac in common carp (Cyprinus carpio) fingerlings: hematological, biochemical, ionoregulatory and enzymological responses. Journal of hazardous materials, 195, 188-194. Semenza, G. L. (2001). HIF-1 and mechanisms of hypoxia sensing. Current Opinion in Cell Biology, 13(2), 167-171.
157
Shiogiri, N. S., Paulino, M. G., Carraschi, S. P., Baraldi, F. G., da Cruz, C., & Fernandes, M. N. (2012). Acute exposure of a glyphosate-based herbicide affects the gills and liver of the Neotropical fish, Piaractus mesopotamicus. Environmental Toxicology and Pharmacology, 34(2), 388-396.
Silva, A.G. 2004. Alterações histopatológicas de peixes como biomarcadores da contaminação aquática. Dissertação (Mestre em Ciências Biológicas). Universidade Estadual de Londrina.
Silva, J., Freitas, T.R.O., Marinho, J.R., Speit, G., Erdtmann, B. 2000. An alkaline single-cell gel electrophoresis (comet) assay for environmental biomonitoring with native rodents. General Molecular Biology. 23(1): 241-245.
Singh, N. P.; M. T. Mccoy; R.R. Tice & E. L. Schneider. (1988). A simple technique for quantitation of low levels of DNA damage in individual cells. Experimental Cell Research, 175:184-191.
Smith, M.R., DeGudicibus, S.J., Stacey, D.W., 1986. Requirement for c-ras proteins during viral oncogene transformation. Nature, 320, 540–543. Steffensen, J., (1989). Some errors in respirometry of aquatic breathers: how to avoid and correct for them. Fish Physiology and Biochemistry 6: 49–59. Takashima, F., Hibiya, T. (1995). An Atlas of Fish Histology. Normal and Pathological Features, second ed. Kodansha Ltd., Tokyo. Terova, G., Rimoldi, S., Corà, S., Bernardini, G., Gornati, R., & Saroglia, M. (2008). Acute and chronic hypoxia affects HIF-1α mRNA levels in sea bass (Dicentrarchus labrax). Aquaculture, 279(1), 150-159. Tomita, R. Y., & Beyruth, Z. (2002). Toxicologia de agrotóxicos em ambiente aquático. Biológico, 64(2), 135-142.
Torten, M., Liu, Z., Okihiro, M. S., Teh, S. J., & Hinton, D. E. (1996). Induction of ras oncogene mutations and hepatocarcinogenesis in medaka (Oryzias latipes) exposed to diethylnitrosamine. Marine Environmental Research, 42(1), 93-98. Tsui, M. T., & Chu, L. M. (2004). Comparative toxicity of glyphosate-based herbicides: aqueous and sediment pore water exposures. Archives of Environmental Contamination and Toxicology, 46(3), 316-323. Uchida, M., Takumi, S., Tachikawa, K., Yamauchi, R., Goto, Y., Matsusaki, H., ... & Arizono, K. (2012). Toxicity evaluation of glyphosate agrochemical components using Japanese medaka (Oryzias latipes) and DNA microarray gene expression analysis. The Journal of Toxicological Sciences, 37(2), 245-254. Val, A.L., 1995. Oxygen transfer in fish: morphological and molecular adjustments. Braziliam Jounal of Medicine and Biology Research. 28, 1119–1127. Val, A. L., & Honczaryk, A. (1995). A criação de peixes na Amazônia: um futuro promissor. Criando peixes na Amazônia, 1-5. Val AL, de Almeida-Val VMF. Fishes of the Amazon and their Environment. Physiological and Biochemical Aspects. Berlin: Springer, 1995. Val, A.L. 1996. Surviving low oxygen levels: lessons from fishes of the Amazon. In Val, AL., Almeida-Val, VMF. and Randall,DJ. (Eds.). Physiology and Biochemistry of the Fishes of the Amazon. Manaus: INPA. p. 59-73. Val, A.L. and Almeida-Val, V.M.F. Effect of crude oil on respiratory aspects of some fish species of the Amazon, Biology of Tropical Fish. 22 (1999) 277–291.
158
Val, A. L., Silva, M. N. P., & Val, V. M. F. A. (2004). Estresse em peixes–ajustes fisiológicos e distúrbios orgânicos. Sanidade de organismos aquáticos. São Paulo: Varela, 75-88. Vásquez, K.L. Ontogenia das enzimas digestivas do tambaqui, Colossoma macropomum (CUVIER, 1818): subsídios para a aquicultura/Katherine López Vásquez. Manaus: AM, 2009. Tese (doutorado), Manaus, 2009.Orientador: Dr. Adalberto Luís Val Área de concentração: Biotecnologia. Wang, G. L., & Semenza, G. L. (1993). Characterization of hypoxia-inducible factor 1 and regulation of DNA binding activity by hypoxia. Journal of Biological Chemistry, 268(29), 21513-21518. WHO – International Programme on Chemical Safety Glyphosate, 1994. Environmental Health Criteria 159 – Glyphosate. Wu, R.S.S. (2009). Effects of hypoxia on fish reproduction and development. In: Richards, J.G., Farrell, A.P., Brauner, C.J. (Eds.), Hypoxia. Elsevier, London, pp. 79–141. Zhang, G., Mao, J., Liang, F., Chen, J., Zhao, C., Yin, S., ... & Chen, S. (2016). Modulated expression and enzymatic activities of Darkbarbel catfish, Pelteobagrus vachelli for oxidative stress induced by acute hypoxia and reoxygenation. Chemosphere, 151, 271-279. Zhydenko, A. O. (2008). Dynamics of the Juvenile Carps' Hematological Parameters under the Impact of Herbicides. Hydrobiological Journal, 44(5). Zhydenko, A. O., & Kovalenko, Y. M. (2007). The influence of Roundup on the dynamics of histological changes in organs of carps. Hydrobiological Journal, 43(2).
159
Tables and Figures
Table 1. Characteristics of each specific primer obtained for the experiment. Primers for endogenous
genes (28S e ef-1) and primers for the target genes (ras e hif-1).
Gene
Primer sequence (5`-3`)
forward/reverse
Length (bp)
Amplicon length(bp)
Tm
Ef(%)
*
28S-Fa
CGGGTTCGTTTGCGTTAC
18 150 54.5 98.19
28S-Ra
AAAGGGTGTCGGGTTCAGAT
20 150 56.3 98.19
ef-1Fb
GTTGGTGAGTTTGAGGCTGG
20 78 60.7 99.09
ef-1Rb
CACTCCCAGGGTGAAAGC
18 78 60.9 99.09
Ras-F
CCAGTACATGAGGACAGGAG
20 134 60.3 99.31
Ras-R
CAAGCACCATTGGCACATCG
20 134 60.3 99.31
HIF-1F
ATCAGCTACCTGCGCATG 18 133 59.3 100.69
HIF-1R
CTCCATCCTCAGAAAGCAC 19 133 57.3 100.69
*Primer Efficience a. Vasquez (2009) b. Brandão (2015)
160
Table 2. Hematological and glucose parameters of tambaqui (Colossoma macropomum) submitted to
different concentration of O2 and contamination by RD. The values are presented as mean ± standard
error of the mean (SEM). Lowercase letters represent significant differences (p <0.05) between the
different treatments (N x NRD and H x HRD). The asterisk represents significant difference (p <0.05)
between the treatments N x H and NRD and HRD.
Treatment [Hb]
(g/dL)
Ht
(%)
RBC
(106/mm
3)
MVC
(μm3)
MHC
(pg)
MCHC
(%)
Glucose
mg/dL
Normoxia (N)
6.41 ± 0.5a 28.3 ± 1.0
a 1.48 ± 0.07
a 187.2 ± 4.8
a 43.3 ± 2.8
a 23.0 ± 1.1
a 54.0 ± 6.4
a
Normoxia and RD (NRD)
6.80 ± 0.6a 27.3 ± 1.0
a 1.43 ± 0.03
a 187.4 ± 5.9
a 47.1 ± 3.3
a 25.1 ± 1.7
a 96.2 ± 7.5
b
Hypoxia (H)
8.27 ± 0.3a* 32.0 ± 0.9
a* 1.69 ± 0.08
a* 197.6 ± 6.9
a 50.8 ± 1.8
a* 25.7 ± 0.6
a 35.4 ± 6.8
a
Hypoxia and RD (HRD)
7.71 ± 0.2a 27.6 ± 1.0
b 1.52 ± 0.09
a 182.9 ± 8.6
a 51.0 ± 2.4
a 27.9 ± 0.7
a 144.2 ± 20.0
b*
161
Table 3. Distribution of blood cells DNA damage in tambaqui according to the level of comet damage in each
treatment and Genetic Damage Index (0-400). The levels of comet damage are distributed in perceptual of cells
damage (%). The GDI values are presented as mean ± standard error of the mean (SEM). Lowercase letters
represent significant differences (p <0.05) between the different treatments (N x NRD) and (H x HRD). The asterisk
represents significant difference (p <0.05) between the same treatments N and H.
Treatments Levels of comet damage in 100 cells (%) Genetic Damage Index (GDI 0-400) 0 1 2 3 4
Normoxia (N)
6.88 20.22 27.77 21.55 23.55 234.6 ± 15.0 a
Normoxia and Roundup (NRD)
2.44 7.61 16.27 16.22 57.44 327.0 ± 7.7 b
Hypoxia (H)
0.58 10.47 18.7 15.47 54.76 317.2 ± 18.5 a*
Hypoxia and Roundup (HRD)
0 3 24.12 18.12 54.75 327.4 ± 21.31 a
162
Table 4. Qualitative distribution of histopathology damage and occurrence intensity (0 absent, 0+ low frequency, +
moderate frequency, ++ frequent and +++ high frequency) on the liver of C. macropomum after 96h exposure to
normoxia (N), normoxia plus RD (NRD), hypoxia (H) and hypoxia plus RD (n=10).
Lesion Type Stage Treatments
N NRD H HRD
Nuclei Hypertrophy
I + + + +
Cell Hypertrophy
I + + ++ +
Nuclei in cell periphery
I 0+ + ++ ++
Cytoplasm Vacuolization
I ++ ++ +++ +++
Leukocyte infiltration
I 0+ 0+ + +
Sinusoid Dilation
I + + + +
Cellular deformation
I + ++ +++ ++
Derangement of hepatic cords
I 0 0+ ++ ++
Vessel congestion
II
+ + + +
Nuclei vacuolization
II
0+ + + ++
Nuclei degeneration
II
+ + ++ +++
Cytoplasm degeneration
II
+ ++ ++ +++
Pyknotic nuclei
II
++ ++ ++ +++
Cell disruption
II
+ ++ ++ +++
Focal Necrosis
III
0+ + +++ +++
163
Figure 1. The effects of progressive hypoxia on MO2 in C. macropomum after 96h exposure to no
contaminated water (A) and RD contaminated water (B). The average critical oxygen tensions (PO2 crit)
that were calculated for no contaminated C.macropomum (1.49 mg l-1
± 0.06) and C. macropomum
exposed to RD (1.47 mg l-1
± 0.13).
164
Figure 2. GST (A) and CAT (B) activity and LPO (C) levels in C. macromopum exposed to normoxia (N), normoxia plus RD (NRD), hypoxia (H)
and hypoxia plus RD (HRD) exposed for 96h. Lowercase letters represent significant differences (P <0.001) between the different treatments. The
asterisk represents significant difference (P <0.001) between N compared with H and NRD compared to HRD.
165
Figure 3. C. macropomum liver exposed for 96h for N, NRD, H and HRD treatments. A: Normal C.
macropomum liver exposed to normoxia (N), asterisk indicate a blood vessel. B: Normal C.
macropomum liver exposed to normoxia (N), asterisk indicate liver hepatopancreas. C: Liver exposed to
NRD. Head arrows indicate sinusoids dilatation. D: Fish liver exposed to H. Black arrows indicate
leucocytes infiltration. E: Fish liver exposed to H. Head arrows indicate nuclear vacuolization, asterisks
cellular vacuolization. F: C. macropomum exposed to HRD. Asterisks showed injured bile duct. Black
arrows indicate focal necrosis of the bile duct and hepatocytes around. Hematoxylin and Eosin Stain.
166
Figure 4. Hif-1 relative gene expression in C. macromopum exposed to normoxia (N), normoxia plus
RD (NRD), hypoxia (H) and hypoxia plus RD (HRD) exposed for 96h. Lowercase letters represent
significant differences (P <0.001) between the different treatments. The asterisk represents significant
difference (P <0.001) between N compared with H and NRD compared to HRD.
Figure 5. Ras oncogene relative gene expression in C. macromopum exposed to normoxia (N), normoxia
plus RD (NRD), hypoxia (H) and hypoxia plus RD (HRD) exposed for 96h. Lowercase letters represent
significant differences (P <0.001) between the different treatments. The asterisk represents significant
difference (P <0.001) between N compared with H and NRD compared to HRD.
167
5. Conclusões Gerais
No primeiro capítulo verificamos que em tambaqui sob o efeito agudo do BaP o
oncogene ras e o gene hif-1 apresentaram maiores níveis de expressão nas
concentrações intermediárias do contaminante (4, 8 e 16 mol/kg de BaP). No grupo
controle e na maior concentração do contaminante (32 mol/kg de BaP) ambos os
genes apresentaram baixos níveis de expressão. Esses resultados, menores níveis de
expressão gênica para ras e gene hif-1 na maior concentração de BaP, foram
explicados pelos danos histológicos no fígado dos animais expostos, que apresentou
intensa ocorrência de necrose tecidual com comprometimento do funcionamento do
órgão.
No segundo capítulo ficou evidente que o cenário extremo (A2) proposto pelo
IPCC (2007) magnifica os efeitos do contaminante BaP em tambaqui exposto
cronicamente a este cenário. O tambaqui exposto ao cenário extremo apresentou
maiores níveis de expressão do oncogene ras e do gene hif-1 em ambas as
concentrações de BaP (8 e 16 mol/kg de BaP). A maior expressão de ambos os
genes no cenário extremo em peixes injetados com BaP pôde ser explicada por um
aumento da demanda metabólica do fígado para manter a integridade celular, já que
ras está envolvido com o controle do ciclo celular e hif-1 participa dos processos de
proliferação celular. As defesas antioxidantes (CAT e GST) e os níveis de
lipoperoxidação (LPO) do fígado não apresentaram diferença após 30 dias de
exposição, evidenciando uma diminuição das respostas adaptativas ao estresse
oxidativo. Os danos genotóxicos das células sanguíneas, verificados por meio do
ensaio cometa, e as alterações histológicas do fígado demonstraram ser excelentes
ferramentas para a análise dos efeitos de BaP em peixes expostos aos cenários do
IPCC. Portanto, as defesas celulares dos tambaquis expostos ao BaP foram
comprometidas nos peixes expostos ao cenário extremo, com o aumento dos danos
histológicos e grau de quebra de DNA nas células sanguíneas.
No terceiro capítulo verificamos que o tambaqui é uma espécie muito sensível aos
efeitos do herbicida Roundup® (RD) e que este efeito é ainda maior quando combinado
168
com a exposição a baixas concentrações de oxigênio (hipóxia). Nos peixes
submedidos a hipóxia e RD os danos teciduais no fígado foram intensos, com aumento
da ocorrência de necroses; além disso, os danos genotóxicos também foram maiores
nas células sanguíneas onde foi observado o aumento do grau de quebra de DNA. A
hipóxia teve um feito supressor nos níveis de expressão do gene hif-1, este
comportamento pôde ser explicado pelo maior desafio imposto à maquinaria celular
para a manutenção da integridade do tecido hepático. O RD induziu uma maior
expressão do oncogene ras, contribuindo para a sobrevivência celular, mas combinado
com a hipóxia, os seus níveis de expressão caíram, assim como ocorreu com o gene
hif-1. As defesas antioxidantes (GST e CAT) foram capazes de minimizar o efeito das
espécies reativas de oxigênio evitando altos níveis de lipoperoxidação das membranas
celulares dos hepatócitos.
Em síntese, a espécie do peixe amazônico Colossoma macropomum,
demonstrou ser um excelente modelo em trabalhos toxicológicos e em trabalhos que
envolvam marcadores genotóxicos. Sugerimos que tambaqui pode e deve ser utilizado
como espécie bioindicadora da qualidade do ambiente aquático, bem como modelo
para entender o comportamento de alguns genes relacionados ao desenvolvimento de
câncer.