Apresentação do PowerPoint · carinho e atenção em mandar mensagem no WhatsApp, mesmo eu...

Post on 07-Jul-2020

0 views 0 download

Transcript of Apresentação do PowerPoint · carinho e atenção em mandar mensagem no WhatsApp, mesmo eu...

UNIVERSIDADE FEDERAL DO RIO GRANDE DO NORTECENTRO DE BIOCIÊNCIAS

PROGRAMA DE PÓS-GRADUAÇÃO EM SISTEMÁTICA E EVOLUÇÃO

VARIABILIDADE FENOTÍPICA E GENOTÍPICA DO CAMARÃOMacrobrachium jelskii (MIERS, 1877) DAS BACIAS DO NORDESTEBRASILEIRO: UMA ABORDAGEM DE SISTEMÁTICA INTEGRATIVA

________________________________________________Dissertação de Mestrado

Natal/RN, fevereiro de 2017

SÁVIO ARCANJO SANTOS NASCIMENTO DE MORAES

SÁVIO ARCANJO SANTOS NASCIMENTO DE MORAES

Variabilidade fenotípica e genotípica do camarão Macrobrachium jelskii (Miers,

1877) das Bacias do Nordeste Brasileiro: uma abordagem de sistemática

integrativa

Dissertação apresentada ao Programa de Pós-

graduação em Sistemática e Evolução da

Universidade Federal do Rio Grande do Norte

como requisito parcial para obtenção do título de

Mestre em Sistemática e Evolução.

Orientador: Fúlvio Aurélio Morais Freire.

Coorientador: Sérgio Maia Queiroz Lima.

Natal, 2017

Moraes, Sávio Arcanjo Santos Nascimento de. Variabilidade fenotípica e genotípica do camarãoMacrobrachium jelskii (Miers, 1877) das Bacias do NordesteBrasileiro: uma abordagem de sistemática integrativa / SávioArcanjo Santos Nascimento de Moraes. - Natal, 2017. 96 f.: il.

Dissertação (Mestrado) - Universidade Federal do Rio Grandedo Norte. Centro de Biociências. Programa de Pós-Graduação emSistemática e Evolução. Orientador: Prof. Dr. Fúlvio Aurélio Morais Freire. Coorientador: Prof. Dr. Sérgio Maia Queiroz Lima.

1. Camarão-sossego - Dissertação. 2. Invasão - Dissertação.3. Decapoda - Dissertação. 4. Plasticidade fenotípica -Dissertação. 5. Coamplificação - Dissertação. I. Freire, FúlvioAurélio Morais. II. Lima, Sérgio Maia Queiroz. III. UniversidadeFederal do Rio Grande do Norte. IV. Título.

RN/UF/BSE-CB CDU 595.371

Universidade Federal do Rio Grande do Norte - UFRNSistema de Bibliotecas - SISBI

Catalogação de Publicação na Fonte. UFRN - Biblioteca Setorial do Centro de Biociências - CB

SÁVIO ARCANJO SANTOS NASCIMENTO DE MORAES

Variabilidade fenotípica e genotípica do camarão Macrobrachium jelskii (Miers,

1877) das Bacias do Nordeste Brasileiro: uma abordagem de sistemática

integrativa

Dissertação apresentada ao Programa de Pós-

graduação em Sistemática e Evolução da

Universidade Federal do Rio Grande do Norte

como requisito parcial para obtenção do título de

Mestre em Sistemática e Evolução.

Aprovada em 21 de fevereiro de 2017.

BANCA EXAMINADORA:

_____________________________________________ Dr. Fúlvio Aurélio de Morais Freire

Universidade Federal do Rio Grande do Norte

(Orientador)

_____________________________________________

Dra. Renata Akemi Shinozaki Mendes

Universidade Federal Rural de Pernambuco

______________________________________________

Dra. Luciana Segura Andrade

Universidade Federal do Triângulo Mineiro

Natal, 2017

AGRADECIMENTOS

Aos meus pais por acreditarem e apoiarem nesta caminhada acadêmica e me

alimentarem mesmo comprometendo o orçamento da família.

Aos professores Fúlvio Freire e Sérgio Lima (Prof. Xérxis) pela confiança,

desempenho na orientação acadêmica e pela amizade.

Ao meu amor Valéria Vale por acreditar, por vezes mais do que eu, na minha

capacidade de continuar nesta empreitada e por não me abandonar nesta vida de muito

trabalho e pouco dinheiro.

À galera do Laboratório de Fauna Aquática pelo “conversadeiro de m...” diário,

pelo apoio em laboratório e em campo. Em especial, a tia Anastacia (Roney), Walmir

(Waldir), Lucianus marmoratus (Luciano), Jebis (Mateus Germano), Telton e Cadu

Guedes (Carlos Eduardo, famoso Cadu) por arriscarem suas vidas, adquirirem dermatites

incuráveis, viajando e coletando por esse Nordeste “velho de guerra”.

Aos demais integrantes do Laboratório de Fauna Aquática, Espirito Inquieto

(Matheus Arthur), Veiuda (Thaís), Demônio Daltônico (Bruna), Dr. Márcio, Carol Tupan

(Carol Puppin), Carol Alimentos (Ana Carolina Xavier), Boy Ni Ni (Nielson), Flávia

Peter Pan (Flávia Petean), Silvia Yasmin, Luquinhas, Boquinha de Hypostomus

(Nathalia) e Aninha, por tornar o laboratório um ambiente alegre e descontraído, muitas

vezes até de mais.

À alguns colegas da pós-graduação e do laboratório que me ensinaram o que é

uma atitude não profissional e o verdadeiro significado de ser otário. Obrigado por me

ensinar não ser como vocês. Não quero citar nomes... rsrsrsrs...

Às personalidades singulares “Índio Janduís”, “Minha mãe é uma pilantrinha” e

ao Guia, autor das estórias de “Jú Cascata” e “Arara e Ipê” por propiciarem momentos de

raiva e descontração durante nossas viagens de Kombi.

À Empresa “PC Rent a Car” por fornecer uma Kombi confortável, arrejada, com

sistema de direção remoto (o volante até sai), freios ABS e pintura temática (adesivagem

tosca). Na verdade, aqui não é realmente um agradecimento, é puro sarcasmo.

Ao Bar do Thomas e Bar do Pedrão por fornecer cerveja, às vezes gelada, kits

(cachaça 51, Pepsi e limão) e um lugar “confortável” para promover discussões

enriquecedoras sobre ecologia e biologia, arriação e alteração com direto a briga de bar e

tudo mais. Em especial, à “Galega do Thomas” por transbordar toda sua doce ignorância

ao servir nossas mesas.

Aos “cara”, Kavera (Igor), Sérgio (Sérgio), Pedrinho (Pedro), Beiço (Gabriel) e

Robson (in memoriam), por estarem sempre por perto pra beber e falar sobre assuntos

aleatórios da vida. Em especial, à Sergeta (Sérgio) pelo empenho no serviço de tradução.

Aos colegas de graduação que nunca pederam os laços afetivos, agradeço o

carinho e atenção em mandar mensagem no WhatsApp, mesmo eu demorando semanas

para responder.

Ao pior cachorro do mundo, Loki, e a melhor cadela do mundo, Mel, por zelarem

pela segurança do seu dono e da casa nas madrugadas que seu dono pegava no sono

escrevendo e a casa “dormia” de portas abertas.

Aos crustáceos que habitam meu aquário, Eriphia gonagra, Clibanarius

sclopetarius, Clibanarius antillensis, Calcinus tibicen, Alpheus buckupi, Hepatus

gronovii e Palaemon spp., por segurar minha atenção por horas e ver o quão interessante

é o mundo dos crustáceos.

Ao álcool, às vezes o da bancada serve, por procipiar o “desestresse”.

À cafeína e taurina por tentar me manter acordado nas “madrugas” de escrita de

artigo e ‘deadlines’.

À Deus por promover a estocasticidade durante minha vida.

OBRIGADO A TODOS!!!

SUMÁRIO 1. INTRODUÇÃO GERAL ................................................................................................... 8

1.1.Nordeste ................................................................................................................. 8

1.2.Crustacea ............................................................................................................... 9

1.3.Região Neotropical e a Sistemática Integrativa ................................................... 11

REFERÊNCIAS ........................................................................................................ 13

2. CAPÍTULO I - INTRA- AND INTERSPECIFIC VARIATION RELATED TO

SHAPE: ECO-EVOLUTIONARY ASPECTS OF FRESHWATER PRAWN

Macrobrachium jelskii (MIERS, 1877) (PALAEMONIDAE: DECAPODA) IN

DRAINAGES IN BRAZILIAN NORTHEAST ......................................................... 21

2.1.INTRODUCTION ............................................................................................... 22

2.2.MATERIAL AND METHODS........................................................................... 25

2.2.1. Sampling .................................................................................................. 25

2.2.2. Geometric morphometric analysis ........................................................... 26

2.3.RESULTS ............................................................................................................ 28

2.4.DISCUSSION ...................................................................................................... 30

REFERENCES .......................................................................................................... 35

TABLES .................................................................................................................... 47

FIGURES .................................................................................................................. 52

3. CAPÍTULO II - EVIDÊNCIA GENÉTICA DE INTRODUÇÃO DO CAMARÃO

Macrobrachium jelskii (MIERS, 1877) (CARIDEA: PALAEMONIDAE) NAS

BACIAS DO NORDESTE BRASILEIRO E A IMPLICAÇÃO DE

PSEUDOGENES MITOCONDRIAIS EM ESTUDOS MOLECULARES DE

CRUSTÁCEOS .................................................................................................................. 64

3.1.INTRODUÇÃO ................................................................................................... 66

3.2.MATERIAL E MÉTODOS ................................................................................. 69

3.2.1. Coleta de dados ........................................................................................ 69

3.2.2. Extração, amplificação e verificação das sequências de DNA ................ 69

3.2.3. Inferência filogenética e estruturação genética ........................................ 72

3.3.RESULTADOS ................................................................................................... 72

3.4.DISCUSSIÃO ...................................................................................................... 74

REFERÊNCIAS ........................................................................................................ 78

TABELAS ................................................................................................................. 88

FIGURAS .................................................................................................................. 92

RESUMO

Macrobrachium jelskii é uma espécie de ampla distribuição no nordeste brasileiro, e

ocorrendo em toda América do Sul. Contudo, nenhum estudo acerca a filogeografia,

variações morfológicas locais e variabilidade genética das populações desta espécie foi

efetuado. Esta espécie de camarão, pode revelar informações importantes sobre o padrão

de dispersão e vicariantes correlatos à cenários de arranjos tectônicos pretéritos e outros

eventos que possam ter influenciado a biogeografia dos taxa aquático. Portanto, o

presente trabalho tem como objetivo investigar a diversidade fenotípica e molecular das

populações do camarão Macrobrachium jelskii, nas ecorregiões Nordeste Médio Oriental,

Maranhão Piauí e São Francisco, frente a influência de cenários pretéritos e respostas

ambientais locais. Este trabalho utilizou uma abordagem de Sistemática integrativa, a

morfometria geométrica multivariada, análises filogenéticas e de estruturação genética.

A morfometria geométrica, revelou dimorfismo sexual evidente, em que fêmeas

apresentaram cefalotórax e abdômen mais estirados horizontalmente. Isto, possivelmente,

favorece o desenvolvimento gonadal, vitelogênese e armazenamento dos ovos. Abstração

da forma dos três planos corporais não demostrou um consenso acerca da estruturação

das populações entre de M. jelskii no Nordeste Brasileiro. Tal fato corrobora com a baixa

diversidade nucleotídica e haplotípica, em que foi relatado apenas um haplótipo

compartilhado entre as populações das bacias. Assim, ratificando a possibilidade de

introdução da espécie nos corpos d’água do Nordeste pelo DNOCS. Em adição, os dados

genéticos relataram a presença de ruídos e picos duplos no eletroferograma, que

representa co-amplificação de pseudogenes mitocondriais da região Citocromo Oxidase

I, pouco relatadas na literatura para o gênero Macrobrachium. Este fato abre um

precedente de desconfiança para relações filogenéticas e filogeográficas publicadas,

recentemente que não retratam isto. Sabendo que esta característica pode gerar uma

superestimação de linhagens evolutivas e, assim, conclusões errôneas sobre eventos

dispersivos, vicariantes ou de especiação, se faz de suma importância retratar os casos de

pseudogenes e a utilização de iniciadores específicos para cada táxon.

Palavras-chave: camarão-sossego, invasão, Decapoda, plasticidade fenotípica, co-

amplificação.

ABSTRACT

Macrobrachium jelskii is a widely distributed species in northeastern Brazil, occurring

throughout South America. However, no studies on phylogeography, local morphological

variations and genetic variability of the populations of this species were carried out. This

prawn species can reveal important information on the dispersion pattern and related

vicariates for scenarios of past tectonic arrangements and other events that have

influenced the biogeography of the aquatic taxa. The aim of this manuscript is to

investigate a phenotypic and molecular diversity of the prawn M. jelskii populations in

the Mid-Northeast Caatinga, Maranho Piauí and São Francisco ecoregions, influenced by

past scenarios and environmental local responses. This scientific article uses an approach

of Integrative Systematics, a multivariate geometric morphometry, phylogenetic analyzes

and genetic structuring. Geometric morphometry showed evident sexual dimorphism, in

which females presented cephalothorax and abdomen more horizontally stretched. This

possibly favors gonadal development, vitellogenesis and egg storage. Abstraction of the

shape of the three body planes does not demonstrate a consensus on the structuring of the

populations between M. jelskii in the Northeast of Brazil. This fact corroborates a low

nucleotide and haplotype diversity, in which only one haplotype was shared among the

populations of the basins. Thus, ratifying a possibility of introduction in the Northeast

area by DNOCS. In addition, the genetic data reported a presence of noises and double

peaks not electropherogram, which represents co-amplification of mitochondrial

pseudogenes of the region Cytochrome Oxidase I, little reported in the literature for the

genus Macrobrachium. This fact show a precedent of mistrust for published phylogenetic

and phylogeographic relationships, which recently did not depict this. Knowing that this

characteristic can generate an overestimation of evolutionary lineages and, thus,

erroneous conclusions on dispersive, vicarious or speciation events, it is of importance to

report the cases of pseudogenes and the use of specific molecular primers for each taxon.

Keywords: agar river prawn, invasion, Decapoda, phenotypic plasticity, co-

amplification.

8

1. INTRODUÇÃO GERAL

1.1.Nordeste

Os ecossistemas aquáticos continentais estão entre os mais ameaçados do mundo

por ações antrópicas (i. e. destruição de hábitats, sobreexplotação, modificações dos

cursos d’água, introdução de espécies exóticas, poluição, etc) (LÉVÊQUE; BALIAN;

MARTENS, 2005; LÉVÊQUE et al., 2008; NOGUEIRA et al., 2010). Embora os

ecossistemas aquáticos continentais estejam em rápido declínio, estudos recentes

demonstraram que a biodiversidade dulcícola vem sendo negligenciada pelas avaliações

de conservação (NOGUEIRA et al., 2010) e apresentam baixa prioridade em iniciativas

conservacionistas (LÉVÊQUE; BALIAN; MARTENS, 2005). O clima semi-árido e ao

regime intermitente, foram os fatores reportados como dificuldade para a estimar a

biodiversidade aquática do bioma Caatinga, sendo negligenciado até os dias hodiernos,

mas estudos tem revelado uma riqueza moderadamente alta para diversos taxa, com uma

grande proporção de endemismo (GIARETTA; AGUIAR, 1998; GOLDANI;

CARVALHO; BICCA-MARQUES, 2006; HADDAD; ABE, 1999; MMA, 2007;

NANIWADEKAR; VASUDEVAN, 2007; ROSA et al., 2004). Contudo, a diversidade

biológica, estado de conservação e a biogeografia dos animais aquáticos da Caatinga

ainda é incipiente (LÉVÊQUE; BALIAN; MARTENS 2005; LÉVÊQUE et al., 2008

ROSA et al., 2004).

O Nordeste brasileiro é constituído pelas ecorregiões Marinhão-Piauí, Nordeste

Médio-Oriental e São Franscisco, predominantemente (ALBERT; REIS, 2011). A

ecorregião hidrográfica do Maranhão-Piauí, abrange o rio Parnaíba e bacias costeiras

menores associadas, na zona de transição entre a Caatinga e o Cerrado (ROSA; GROTH,

2004). A ecorregião hidrográfica do Nordeste Médio Oriental, que compreende as bacias

costeiras entre os rios Parnaíba e a bacia do rio São Francisco, abrangendo os rios

Jaguaribe, Piranhas-Açú, Apodi-Mossoró, Mamanguape, Paraíba do Norte, Capibaribe e

Beberibe (LANGEANI et al., 2009). A ecorregião hidrográfica do rio São Francisco,

compreende toda a área de influência da bacia hidrográfica do São Franscisco, com maior

parte de sua abrangência no Nordeste; e as bacias costeiras localizadas entre a

desembocadura do rio São Francisco e o sul da Bahia (LANGEANI et al., 2009). As

principais bacias que compreendem a região hidrográfica do Nordeste Médio Oriental são

9

as dos rios Jaguaribe, Piranhas-Assú, Mamanguape, Paraíba, Capibaribe e Beberibe

(LANGEANI et al., 2009).

1.2.Crustacea

A precariedade de informação resulta em uma exclusão de espécies desta região

em estudos filogeográficos das grandes bacias hidrográficas da América do Sul. Deste

modo, há poucos estudos que possuem dados filogenéticos abrangendo representantes da

ictiofauna continental do Nordeste, e não há nenhum trabalho filogeográfico com taxa

aquáticos das bacias da região, quadro semelhante com outros táxons da caatinga

(TURCHETTO-ZOLET et al., 2012). A resolução das relações filogenéticas das espécies

endêmicas seria uma ferramenta crucial para o entendimento das relações biogeográficas

da região (ROSA; GROTH, 2004). Escassez de estudos que abordem tais relações é

notória para crustáceos no Nordeste brasileiro, principalmente para os membros mais

representativos como a Infraordem Decapoda. Estes desempenham papeis importantes

para processos ecológicos em ambientes aquáticos, atuando em diferentes níveis na

cadeia (consumidores e decompositores), bem como as mais variadas funcionalidades ao

meio ambiente (BEISSINGER; THOMAS; STRAHL, 1988; BENETTON; ROSA;

COLARES, 1990; GOULDING; FERREIRA, 1984; MAGNUSSON; DA SILVA;

LIMA, 1987; WALKER, 1987, 1990). Além do mais, estudos recentes demonstraram que

decápodes de água doce são importantes modelos para estudos para retratar padrões

biogeográficos e filogenéticos e, assim elucidar eventos geológicos influentes sobre a

diversificação biológica (CUMBERLIDGE, 2008; CUMBERLIDGE; STERNBERG;

DANIELS, 2008; CUMBERLIDGE; NG, 2009; DANIELS et al., 2006; YEO; TAN; NG,

2008).

A ordem Decapoda é a maior entre os crustáceos, com aproximadamente 15.000

espécies sendo que apenas em torno de 20% são de água doce, sendo contabilizadas 767

espécies de camarõs, 634 espécies de lagostins, 1485 de caranguejos e 69 de aeglídeos

(BOND-BUCKUP et al., 2008; BOWMAN; ABELE, 1982; CRANDALL; BUHAY,

2008; DE GRAVE; CAI; ANKER, 2008; DE GRAVE et al., 2009; DE GRAVE;

FRANSEN, 2011; YEO; TAN; NG, 2008). Dentre estes os camarões os podemos citar a

família Palaemonidae pela forte representatividade da transição do ambiente marinho ao

ambiente dulcícola por crustáceos decápodes (VOGT, 2012), por sua distribuição

10

cosmopolita, exceto Antártida (DE GRAVE; CAI; ANKER, 2008), e por ser o segundo

táxon mais especioso dos camarões Pleocyemata (DE GRAVE; FRANSEN, 2011).

Os camarões palaemonídeos de água doce apresetam uma plasticidade no

desenvolvimento larval, variando de um estágio prolongado dependente do ambiente

marinho a um desenvolvimento abreviado parcialmente ou independente do ambiente

marinho (JALIHAL; SANKOLLI; SHENOY, 1993; KNOWLTON; VARGO, 2004). Tal

caráter tem sido bastante investigado, sendo um aparente modulador dos processos

pretéritos de dispersão e vicariância das linhagens evolutivas (JALIHAL; SANKOLLI;

SHENOY, 1993; MEJÍA; ALVAREZ; HARTNOLL, 2003; PEREIRA; GARCÍA, 1995).

Dentre os palaemonídeos os gêneros mais especiosos são Macrobrachium Spence

Bates, 1868 (243 espécies), Palaemon Weber, 1795 (41) e Palaemonetes Heller, 1869

(31) (DE GRAVE et al., 2009; DE GRAVE; FRANSEN, 2011). Assim, destaca-se o

gênero Macrobrachium com maior número de eventos isolamento geográfico em sua

distribuição pan-tropical, principalmente nas Américas (DE GRAVE et al., 2009). Sua

distribuição abrange uma ampla gama de habitats, de ambiente costeiros a água doce,

incluindo lagoas costeiras, estuários e nascentes de rios (JALIHAL; SANKOLLI;

SHENOY, 1993, PEREIRA; GARCÍA, 1995). Isto revela uma impressionante

característica de adaptabilidade a flutuações de salinidade e abreviação do estágio larval.

Esta tendência é menos pronunciada em alguns representantes marinhos costeiros, como

os gêneros Palaemon e Palaemonetes. A maioria das espécies de água doce destes

géneros Desenvolver através de mais de cinco e três larvas Estágios, respectivamente

(FALCIAI; PALMERINI, 2002; KNOWLTON; VARGO, 2004). Por exemplo, espécies

de água salobra e de água doce possuem desenvolvimento larval em torno de 10 a 11

estágios larvais (CAVALLO; LAVENS; SORGELOOS, 2001), e espécies confinados a

montantes de ambientes dulcícolas demostram desenvolvimento abreviado entre 1 a 5

estágios larvais (JALIHAL; SANKOLLI; SHENOY, 1993; KARGE; KLOTZ, 2008;

PEREIRA; GARCÍA, 1995).

Shokita et al. (1991) lista apenas 13 espécies de Macrobrachium com ciclo de

desenvolvimento larval abreviado. Há evidências de que está característica tenha

evoluído pelo menos nove vezes nas linhagens da América do Sul, Austrália e Ásia

(MURPHY; AUSTIN, 2005; WOWOR et al., 2009). Dentre estas espécies, destaca-se a

espécie Macrobrachium jelskii (Miers, 1877) com apenas 3 estágios larvais (GAMBA,

1980, 1984, 1997; MAGALHÃES, 2000; PAIVA; BARRETO, 1960).

11

A espécie Macrobrachium jelskii, vulgamente conhecida por camarão sossego, foi

descrito inicialmente como Palaemon jelskii, coletado em expedição ao Rio Oyapock

(Oiapoque) pelo naturalista Konstanty Jelski em 1965 na localidade-tipo no rio

Oyapock/Saint-Georges (Oiapoque), Guiana Francesa (MIERS, 1877). Esta espécie tem

distribuição sulamericana (COELHO; RAMOS-PORTO, 1985; MAGALHÃES et al.,

2005; MELO, 2003; RODRÍGUEZ, 1981), mas questionável. Uma pequena miríade de

trabalhos defende que a distribuição natural de M. jelskii para as bacias do rio Amazonas

e Orinoco (BASTOS; PAIVA, 1959; COLLINS, 2000; HOLTHUIS, 1950, 1966).

Contudo há evidências de introdução pelo Departamento de Obras Contra a Seca

(DNOCS) (GURGEL; OLIVEIRA, 1987).

Outros congêneres apresentam distribuições geográficas extensas na América do

Sul, demostraram estruturação genética entre clados bacias costeiras e continentais, mas

com baixas distâncias gênica entre grupos (CARVALHO; PILEGGI; MANTELATTO,

2013; VERGAMINI; PILEGGI; MANTELATTO, 2011).

1.3.Região Neotropical (fonte de diversificação biológica) e a Sistemática

Integrativa

A região Neotropical engloba a América do Sul comporta a maior biodiversidade

da terra, e contém cinco dos hot spots de biodiversidade mundiais (MYERS et al., 2000).

Tal diversidade pode explicado pelas características de relevo, em que 50% de sua área

inferior a 250m de altitude (ALBERT; REIS, 2011). Isto pode ter favorecido, maior

exposição da plataforma continental durante as incursões e regressões marinhas

sucessivas em cenários (últimos 120 milhões de anos), sendo estes acontecimentos

influentes na atual diversidade e distribuição das linhagens de organismo aquáticos

continentais (ALBERT; REIS, 2011; VERA-SILVA; CARVALHO; MANTELATTO,

2016).

Esta região apresenta, também, vários indícios de atividade geológica frequente,

que, ao longo do tempo, promoveu permuta da fauna aquática entre bacias hidrográficas

independentes por meio de eventos de capturas de cabeceiras. Assim, aumentam a riqueza

de espécies aquáticas, permitem a mistura de linhagens isoladas, promovendo novas rotas

de dispersão e colonização de populações (MENEZES et al., 2008). Estes dois eventos,

flutuações do nível do mar e capturas de cabeceiras, atuaram na interface de eventos de

vicariância e dispersão, e foram possivelmente os principais eventos responsáveis pela

12

diversificação de peixes neotropicais (ALBERT; CARVALHO, 2011), assim podem

servir de modelo para outras taxa aquáticas como os crustáceos.

Ressaltando a diversidade e a escala de processos históricos e ecológicos

relacionados à sua formação, o entendimento das origens e atuais padrões de distribuição

e diversificação dos organismos aquáticos neotropicais necessita de informações

advindas das mais variadas áreas de concentração de estudo como ecologia,

geomorfologia, geologia paleoclimática e paleoambiental, sistemática filogenética, entre

outras, ou seja, uma abordagem de sistemática integrativa (ALBERT; REIS, 2011). Esta

abordagem multidisciplinar, seguem uma tendência de estudos de biodiversidade e

conservação, na tentativa de entender a história evolutiva e manutenção dos processos

presentes responsáveis pela diversificação (BOWEN, 1999). Mudanças climáticas e

glaciações, assim como eventos de oscilação no nível do mar têm afetado este continente,

criando cenários de isolamento, refúgio, expansão e dispersão, influentes na

diversificação das espécies (ANTONELLI; SANMARTIN, 2011; BEHLING, 2002).

O conceito “sistemática integrativa”, tenta unir abordagens ecológicas,

moleculares e morfológicas na determinação de linhagens evolutivas, e auxiliar a

entendimento dos processos que favorecem a diversificação biológica (DAYRAT, 2005;

PADIAL et al., 2010). Esta abordagem tem sido utilizada no estudo de áreas pouco

conhecidas, na descoberta de espécies crípticas e na avaliação da plasticidade fenotípica

(TAN et al., 2009).

A variação fenotípica é resultado da interação de processos históricos (expressão

gênica) e ecológicos (influencia ambiental) que podem regular a fixação de caracteres

fenotípicos (MULLEN et al., 2009). Processos determinísticos mediados pela seleção

natural e processos estocásticos (deriva gênica) podem favorecer a manutenção ou

eliminar variações de traços fenotípicos (CLEGG; PHILIMORE, 2010). Contudo, esta

relação também é influenciada pelo grau de conectividade entre as populações ou

linhagens, isto é, o fluxo gênico é também modulador da plasticidade fenotípica

(MULLEN et al., 2009). Entretanto, tal variação pode ser gerada por respostas

morfológicas às condições ambientais contemporâneas, ontogenia e/ou dimorfismo

sexual inerente ao táxon, que não necessariamente representa mudanças na frequência de

alelos (PFENING et al., 2010).

Uma das maneiras de verificar a variações fenotípicas, especialmente

morfológicas, são por meio da abstração das variações na forma do corpo, úteis na

avaliação de processos ecológicos e fatores ambientais influentes na diversificação inter

13

e intraespecífica de linhagens. Aspectos ecológicos como composição de dieta,

(WAGNER et al., 2009), pressões de predação (LANGERHANS; DEWITT, 2004),

composição de comunidades, fluxo de água (LANGEHANS, 2008; SAMPAIO;

PAGOTTO; GOULART, 2013), temperatura (SIDLAUSKAS; CHERNOFF;

MACHADO-ALLISON, 2006); oxigênio dissolvido na água (CRISPO; CHAPMAN,

2011), entre outros, já se mostraram influentes quanto a variação da forma.

A distribuição geográfica de uma determinada espécie é regulada em função da

sua ecologia, demografia histórica e padrões de dispersão, que podem ser muitas vezes

elucidados através da biogeografia molecular (AVISE, 2000). Uma ferramenta para

investigar os processos e padrões históricos que regularam a diversificação das linhagens

é a filogeografia (AVISE, 2000). Esta abordagem parece ainda mais interessante quando

utilizada com organismos nas quais as populações tem seu potencial dispersivo

vinculadas ao meio que vivem, e este é o caso dos peixes de água doce (ALBERT; REIS,

2011) bem como crustáceos. Visto que estes organismos, quase que, obrigatoriamente

necessitam da conexão entre as drenagens para que ocorra dispersão (JONES;

JOHNSON, 2009), e assim a distribuição de linhagens, permite inferências sobre eventos

pretéritos de uma determinada região.

Através de uma abordagem sistemática integrativa será possível compreender os

padrões de dispersão, relações filogeograficas dessa espécie no Nordeste do Brasil, frente

as conexões pretéritas entre as bacias, e suas respectivas relações com o clima e

geomorfologia da região, ou eventos antrópicos que promoveram a mistura entre espécies

e linhagens filogenéticas, bem como investigar o plasticidade fenotípica e correlacionar

com os fatores que podem ter influenciado variações na abstração das populações de M.

jelskii.

REFERÊNCIAS

ALBERT, J. S.; REIS, R. E. Introduction to Neotropical freshwaters. Historical

biogeography of neotropical freshwater fishes, p. 3-19, 2011.

ANTONELLI, Alexandre; SANMARTÍN, Isabel. Why are there so many plant species

in the Neotropics?. Taxon, v. 60, n. 2, p. 403-414, 2011.

AVISE, John C. Phylogeography: the history and formation of species. Harvard

university press, 2000.

14

BASTOS, J. A. M.; PAIVA, M. P. Notas sobre o consumo de oxigênio do camarão

‘sossêgo’, Macrobrachium jelskii (Miers, 1877) Chace & Holthuis, 1948. Revista

Brasileira de Biologia, v. 19, n. 4, p. 413-419, 1959.

BEHLING, Hermann. South and southeast Brazilian grasslands during Late Quaternary

times: a synthesis. Palaeogeography, Palaeoclimatology, Palaeoecology, v. 177, n. 1,

p. 19-27, 2002.

BEISSINGER, Steven R.; THOMAS, Betsy Trent; STRAHL, Stuart D. Vocalizations,

food habits, and nesting biology of the slender-billed kite with comparisons to the snail

kite. The Wilson Bulletin, p. 604-616, 1988.

BENETTON, M. L. F. M.; ROSAS, F. C. W.; COLARES, E. P. Aspectos do hábito

alimentar da ariranha (Pteronura brasiliensis) na Amazônia brasileira. Programa y

Resumenes, 4ª Reunión de Trabajo de Especialistas en Mamiferos Acuaticos de

America del Sur, Valdivia, Chile, p. 12-15, 1990.

BOND-BUCKUP, Georgina et al. Global diversity of crabs (Aeglidae: Anomura:

Decapoda) in freshwater. Hydrobiologia, v. 595, n. 1, p. 267-273, 2008.

BOWEN, Brian W. Preserving genes, species, or ecosystems? Healing the fractured

foundations of conservation policy. Molecular ecology, v. 8, n. s1, 1999.

BOWMAN, THOMAS E.; ABELE, LAWRENCE G. Classification of the recent

Crustacea. The biology of Crustacea, v. 1, p. 1-27, 1982.

CARVALHO, Fabrício L.; PILEGGI, Leonardo G.; MANTELATTO, Fernando L.

Molecular data raise the possibility of cryptic species in the Brazilian endemic prawn

Macrobrachium potiuna (Decapoda, Palaemonidae)/Datos moleculares sugieren la

presencia de una especie críptica del camarón endémico brasileño Macrobrachium

potiuna (Decapoda, Palaemonidae). Latin American Journal of Aquatic Research, v.

41, n. 4, p. 707, 2013.

CAVALLO, Ronaldo O.; LAVENS, Patrick; SORGELOOS, Patrick. Reproductive

performance of Macrobrachium rosenbergii females in captivity. Journal of the World

Aquaculture Society, v. 32, n. 1, p. 60-67, 2001.

CLEGG, Sonya M.; PHILLIMORE, Albert B. The influence of gene flow and drift on

genetic and phenotypic divergence in two species of Zosterops in Vanuatu. Philosophical

Transactions of the Royal Society of London B: Biological Sciences, v. 365, n. 1543,

p. 1077-1092, 2010.

15

COELHO, Petrônio Alves; RAMOS-PORTO, Marilena. Camarões de água doce do

Brasil: distribuição geográfica. Revista Brasileira de Zoologia, v. 2, n. 6, p. 405-410,

1985.

COLLINS, Pablo A. Macrobrachium jelskii (Miers, 1877). Crustaceana, v. 73, n. 9, p.

1167-1169, 2000.

CRANDALL, Keith A.; BUHAY, Jennifer E. Global diversity of crayfish (Astacidae,

Cambaridae, and Parastacidae––Decapoda) in freshwater. Hydrobiologia, v. 595, n. 1, p.

295-301, 2008.

CRISPO, Erika; CHAPMAN, Lauren J. Hypoxia drives plastic divergence in cichlid body

shape. Evolutionary Ecology, v. 25, n. 4, p. 949-964, 2011.

CUMBERLIDGE, Neil. Insular species of Afrotropical freshwater crabs (Crustacea

Decapoda: Brachyura: Potamonautidae and Potamidae) with special reference to

Madagascar and the Seychelles. Contributions to Zoology, v. 77, n. 2, 2008.

CUMBERLIDGE, Neil; VON STERNBERG, Richard M.; DANIELS, Savel R. A

revision of the higher taxonomy of the Afrotropical freshwater crabs (Decapoda:

Brachyura) with a discussion of their biogeography. Biological Journal of the Linnean

Society, v. 93, n. 2, p. 399-413, 2008.

CUMBERLIDGE, Neil; NG, PETER KL. Systematics, evolution, and biogeography of

freshwater crabs. In: Decapod crustacean phylogenetics. CRC Press, 2009. p. 491-508.

DANIELS, Savel R. et al. Evolution of Afrotropical freshwater crab lineages obscured

by morphological convergence. Molecular Phylogenetics and Evolution, v. 40, n. 1, p.

227-235, 2006.

DAYRAT, Benoit. Towards integrative taxonomy. Biological journal of the Linnean

society, v. 85, n. 3, p. 407-415, 2005.

DE GRAVE, S.; CAI, Y.; ANKER, A. Global diversity of shrimps (Crustacea: Decapoda:

Caridea) in freshwater. Hydrobiologia, v. 595, n. 1, p. 287-293, 2008.

DE GRAVE, Sammy et al. A classification of living and fossil genera of decapod

crustaceans. Raffles Bulletin of Zoology, p. 1-109, 2009.

DE GRAVE, Sammy; FRANSEN, C. H. J. M. Carideorum catalogus: the recent species

of the Dendrobranchiate, Stenopodidean, Procarididean and Caridean shrimps

(Crustacea: Decapoda). Zoologische Mededelingen, v. 85, p. 195, 2011.

FALCIAI, L.; PALMERINI, E. Larval development of the freshwater shrimp,

Palaemonetes antennarius (H. Milne Edwards, 1837) (Decapoda, Palaemonidae) reared

in the laboratory. Crustaceana, v. 74, n. 11, p. 1315-1333, 2002.

16

GIARETTA, Ariovaldo A.; AGUIAR JR, Odair. A new species of Megaelosia from the

Mantiqueira Range, Southeastern Brazil. Journal of Herpetology, p. 80-83, 1998.

GOLDANI, A.; CARVALHO, G. S.; BICCA-MARQUES, J. C. Distribution patterns of

Neotropical primates (Platyrrhini) based on Parsimony Analysis of

Endemicity. Brazilian Journal of Biology, v. 66, n. 1A, p. 61-74, 2006.

GURGEL, J. J. S.; OLIVEIRA, A. B. Efeitos da introdução de peixes e crustáceos no

semi-árido do nordeste brasileiro. ESAM, 1987.

HADDAD, C. F. B.; ABE, A. S. Anfíbios e répteis. In: Workshop Mata Atlântica e

Campos Sulinos. Conservation International do Brasil. Fundação Biodiversitas,

Fundação SOS Mata Atlântica, Instituto de Pesquisas Ecológicas, Secretarias do

Meio Ambiente de São Paulo e Minas Gerais. Disponível em:< http://www.

conservation. org. br/ma/rp_anfib. htm>. Acesso em: 2 de janeiro de 2017. 1999. p.

2003.

HOLTHUIS, Lipke Bijdeley. The Decapoda of the Siboga Expedition: Pt. 10: the

Palaemonidae Collected by the Siboga and Snellius Expeditions with Remarks on

Other Species: 1: Subfamily Palaemoninae. Brill, 1950.

HOLTHUIS, L. B. A collection of freshwater prawns (Crustacea Decapoda,

Palaemonidae) from Amazonia, Brazil, collected by Dr. G. Marlier. 1966.

JALIHAL, D. R.; SANKOLLI, K. N.; SHENOY, Shakuntala. Evolution of larval

developmental patterns and the process of freshwaterization in the prawn genus

Macrobrachium Bate, 1868 (Decapoda, Palaemonidae). Crustaceana, v. 65, n. 3, p. 365-

376, 1993.

JONES, Carissa P.; JOHNSON, Jerald B. Phylogeography of the livebearer Xenophallus

umbratilis (Teleostei: Poeciliidae): glacial cycles and sea level change predict

diversification of a freshwater tropical fish. Molecular Ecology, v. 18, n. 8, p. 1640-

1653, 2009.

KARGE, Andreas; KLOTZ, Werner. Süßwassergarnelen aus aller Welt [Fresh water

shrimps of the world]. 2. ed. Auflage, (Dähne Verlag) Ettlingen, 2008. 216 p.

KNOWLTON, Robert E.; VARGO, Carol K. The larval morphology of Palaemon

floridanus Chace, 1942 (Decapoda, Palaemonidae) compared with other species of

Palaemon and Palaemonetes. Crustaceana, v. 77, n. 6, p. 683-715, 2004.

LANGEANI, F. et al. Peixes de água doce. Rocha, RM, Boeger WAP. Estado da Arte

e perspectivas para a Zoologia no Brasil. Curitiba, Paraná: Editora da UFPR, 2009.

17

LANGERHANS, R. Brian; DEWITT, Thomas J. Shared and unique features of

evolutionary diversification. The American Naturalist, v. 164, n. 3, p. 335-349, 2004.

LANGERHANS, R. Brian. Predictability of phenotypic differentiation across flow

regimes in fishes. Integrative and Comparative Biology, v. 48, n. 6, p. 750-768, 2008.

LÉVÊQUE, Christian; BALIAN, E. V.; MARTENS, K. An assessment of animal species

diversity in continental waters. In: Aquatic Biodiversity II. Springer Netherlands, 2005.

p. 39-67.

LEVÊQUE, Christian et al. Global diversity of fish (Pisces) in

freshwater. Hydrobiologia, v. 595, n. 1, p. 545-567, 2008.

MAGALHÃES, Célio et al. Exotic species of freshwater decapod crustaceans in the state

of São Paulo, Brazil: records and possible causes of their introduction. Biodiversity and

Conservation, v. 14, n. 8, p. 1929-1945, 2005.

MAGNUSSON, William E.; DA SILVA, Eduardo Vieira; LIMA, Albertina P. Diets of

Amazonian crocodilians. Journal of Herpetology, p. 85-95, 1987.

MEJÍA, Luis M.; ALVAREZ, Fernando; HARTNOLL, Richard G. A new species of

freshwater prawn, Macrobrachium totonacum (Decapoda, Palaemonidae), with

abbreviated development from Mexico. Crustaceana, v. 76, n. 1, p. 77-86, 2003.

MELO, G. A. S. Famílias Atyidae, Palaemonidae e Sergestidae. Manual de

identificação dos Crustacea Decapoda de água doce do Brasil, p. 289-415, 2003.

MENEZES, Naercio A. et al. Biogeography of Glandulocaudinae (Teleostei:

Characiformes: Characidae) revisited: phylogenetic patterns, historical geology and

genetic connectivity. Zootaxa, n. 1726, p. 33-48, 2008.

MIERS, Edward John. On a Collection of Crustacea, Decapoda and Isopoda, Chiefly

from South America: With Descriptions of New Genera and Species.. 1877.

MMA (MINISTÉRIO DO MEIO AMBIENTE). Áreas Prioritárias para Conservação,

Uso Sustentável e Repartição de Benefícios da Biodiversidade Brasileira: Atualização

Portaria MMA n° 9, 23 de Janeiro de 2007.

MULLEN, Lynne M. et al. Adaptive basis of geographic variation: genetic, phenotypic

and environmental differences among beach mouse populations. Proceedings of the

Royal Society of London B: Biological Sciences, v. 276, n. 1674, p. 3809-3818, 2009.

MURPHY, Nicholas P.; AUSTIN, Christopher M. Phylogenetic relationships of the

globally distributed freshwater prawn genus Macrobrachium (Crustacea: Decapoda:

Palaemonidae): biogeography, taxonomy and the convergent evolution of abbreviated

larval development. Zoologica Scripta, v. 34, n. 2, p. 187-197, 2005.

18

MYERS, Norman et al. Biodiversity hotspots for conservation priorities. Nature, v. 403,

n. 6772, p. 853-858, 2000.

NANIWADEKAR, Rohit; VASUDEVAN, Karthikeyan. Patterns in diversity of anurans

along an elevational gradient in the Western Ghats, South India. Journal of

Biogeography, v. 34, n. 5, p. 842-853, 2007.

NOGUEIRA, Cristiano et al. Restricted-range fishes and the conservation of Brazilian

freshwaters. PloS one, v. 5, n. 6, p. e11390, 2010.

PADIAL, José M. et al. The integrative future of taxonomy. Frontiers in zoology, v. 7,

n. 1, p. 16, 2010.

PEREIRA, Guido A. S.; GARCÍA, José V. D. Larval development of Macrobrachium

reyesi Pereira (Decapoda: Palaemonidae), with a discussion on the origin of abbreviated

development in palaemonids. Journal of Crustacean Biology, p. 117-133, 1995.

PFENNIG, David W. et al. Phenotypic plasticity's impacts on diversification and

speciation. Trends in ecology & evolution, v. 25, n. 8, p. 459-467, 2010.

RODRÍGUEZ, G. Decapoda. Aquatic biota of tropical South America, part, v. 1, p.

41-51, 1981.

ROSA, Ricardo S.; GROTH, Fernando. Ictiofauna dos ecossistemas de brejos de altitude

de Pernambuco e Paraíba. Brejos de Altitude em Pernambuco e Paraíba: História

Natural, Ecologia e Conservação. Série Biodiversidade, v. 9, p. 201-210, 2004.

ROSA Ricardo S. et al. Biota aquática: áreas e ações prioritárias para a conservação da

Caatinga. In: SILVA, J. M. C.; TABARELLI, M., et al (Ed.). Biodiversidade da

caatinga: áreas e ações prioritárias para a conservação. Ministério do Meio Ambiente,

Universidade Federal de Pernambuco, Brasil. p.163-171, 2004.

SAMPAIO, Ana Lúcia A.; PAGOTTO, João Paulo A.; GOULART, Erivelto.

Relationships between morphology, diet and spatial distribution: testing the effects of

intra and interspecific morphological variations on the patterns of resource use in two

Neotropical Cichlids. Neotropical Ichthyology, v. 11, n. 2, p. 351-360, 2013.

SHOKITA, Shigemitsu et al. Abbreviated larval development of a fresh-water prawn,

Macrobrachium niphanae Shokita and Takeda (Decapoda: Palaemonidae), from

Thailand. Journal of Crustacean Biology, p. 90-102, 1991.

SIDLAUSKAS, Brian; CHERNOFF, Barry; MACHADO-ALLISON, Antonio.

Geographic and environmental variation in Bryconops sp. cf. melanurus (Ostariophysi:

Characidae) from the Brazilian Pantanal. Ichthyological Research, v. 53, n. 1, p. 24-33,

2006.

19

TAN, Denise SH et al. From ‘cryptic species’ to integrative taxonomy: an iterative

process involving DNA sequences, morphology, and behaviour leads to the resurrection

of Sepsis pyrrhosoma (Sepsidae: Diptera). Zoologica Scripta, v. 39, n. 1, p. 51-61, 2009.

TURCHETTO‐ZOLET, A. C. et al. Phylogeographical patterns shed light on

evolutionary process in South America. Molecular Ecology, v. 22, n. 5, p. 1193-1213,

2012.

VERA-SILVA, Ana Luiza; CARVALHO, Fabrício L.; MANTELATTO, Fernando L.

Distribution and genetic differentiation of Macrobrachium jelskii (Miers, 1877)

(Natantia: Palaemonidae) in Brazil reveal evidence of non-natural introduction and

cryptic allopatric speciation. Journal of Crustacean Biology, v. 36, n. 3, p. 373-383,

2016

VERGAMINI, Fernanda G. et al. Genetic variability of the Amazon river prawn

Macrobrachium amazonicum (Decapoda, Caridea, Palaemonidae). Contributions to

Zoology, v. 80, n. 1, p. 67-83, 2011.

VOGT, Guenter. Abbreviation of larval development and extension of brood care as key

features of the evolution of freshwater Decapoda. Biological Reviews, v. 88, n. 1, p. 81-

116, 2012.

WAGNER, Catherine E. et al. Diet predicts intestine length in Lake Tanganyika’s cichlid

fishes. Functional Ecology, v. 23, n. 6, p. 1122-1131, 2009.

WALKER, Ilse. The biology of streams as part of Amazonian forest ecology. Cellular

and Molecular Life Sciences, v. 43, n. 3, p. 279-287, 1987.

WALKER, Ilse. Ecologia e biologia dos igapós e igarapés. Ciência Hoje, v. 11, n. 64, p.

45-53, 1990.

WOWOR, Daisy et al. Evolution of life history traits in Asian freshwater prawns of the

genus Macrobrachium (Crustacea: Decapoda: Palaemonidae) based on multilocus

molecular phylogenetic analysis. Molecular Phylogenetics and Evolution, v. 52, n. 2,

p. 340-350, 2009.

YEO, D. C. J.; TAN, S. H.; NG, P. K. L. Horseshoe crabs (Phylum Arthropoda:

Subphylum Chelicerata: Class Merostomata), Decapod Crustaceans (Phylum

Arthropoda: Subphylum Crustacea: Order Decapoda). The Singapore Red Data Book:

Threatened Plants and Animals of Singapore. 2nd edition. Nature Society,

Singapore, 2008.

20

2. CAPÍTULO I: INTRA- AND INTERSPECIFIC VARIATION RELATED

TO SHAPE: ECO-EVOLUTIONARY ASPECTS OF FRESHWATER

PRAWN Macrobrachium jelskii (MIERS, 1877) (PALAEMONIDAE:

DECAPODA) IN DRAINAGES IN BRAZILIAN NORTHEAST

Sávio A. S. N. Moraes 1*; Carlos E. R. D. Alencar; Sergio M. Q. Lima 2; Fúlvio A. M.

Freire 1

1 Grupo de Estudos em Ecologia e Fisiologia de Animais Aquáticos, Departamento de

Zoologia e Botânica, Centro de Biociências, Universidade Federal do Rio Grande do

Norte 2 Laboratório de Ictiologia Sistemática Evolutiva, Departamento de Zoologia e Botânica,

Centro de Biociências, Universidade Federal do Rio Grande do Norte * Correspoding author: savioarcanjo@hotmail.com

Status: submetido (Journal of Zoological Systematics and Evolutionary Research)

21

Intra- and interspecific variation related to shape: eco-evolutionary aspects of

freshwater prawn Macrobrachium jelskii (Miers, 1877) (Palaemonidae: Decapoda)

in drainages in Brazilian Northeast

Sávio A. S. N. Moraes 1*; Carlos E. R. D. Alencar; Sergio M. Q. Lima 2; Fúlvio A. M.

Freire 1 1 Grupo de Estudos em Ecologia e Fisiologia de Animais Aquáticos, Departamento de

Zoologia e Botânica, Centro de Biociências, Universidade Federal do Rio Grande do

Norte 2 Laboratório de Ictiologia Sistemática Evolutiva, Departamento de Zoologia e Botânica,

Centro de Biociências, Universidade Federal do Rio Grande do Norte * Correspoding author: savioarcanjo@hotmail.com

Abstract

The present study aims to infer intra- and inter-population shape variations of the

freshwater prawn Macrobrachium jelskii in the basins of hydrographic ecoregions of

Maranho Piauí, Mid-Northeast Caatinga and São Francisco, using geometric

morphometry in three body plans (cephalothorax, abdomen and cheliped). It used

principal component analysis, to verify trends; discriminant function analysis, to test the

sexual dimorphism and hydrodynamics; and canonical analysis, for populational

differences. In regards to sexual dimorphism, females showed cephalothorax and

abdomen more stretched horizontally, which possibly favors gonadal development,

vitellogenesis and egg attachment. For the hydrodynamics factor, no trends were

observed in morphospace. In all of the three body struture plans, no consensus was shown

in morphospace on the population structure of M. jelskii in Northeast Brazil, which

corroborates with the possible introduction of the species in water bodies of the region by

the National Department of Works Against Drought (Departamento Nacional de Obras

Contra as Secas – DNOCS). However, the cluster with the highest cophenetic correlation

coefficient was evidenced to abdomen, an indirect reflection of variations of

vitellogenesis in eggs, modulated by environmental factors, such as salinity, temperature

and rainfall. In spite of this, a past scenario of separation of lineages by sea level

fluctuations cannot be discarded

22

Keywords: phenotypic plasticity, sexual dimorphism, hydrodynamics, agar river prawn,

Palaemonidae.

2.1.INTRODUCTION

To understand nuances between ecology and evolution at various levels, or "eco-

evolutionary dynamics", is to understand influential processes on diversity, communities

and complexity of ecosystems (dynamics and their interactions) (POST; PALKOVACS,

2009). An approach that links the functionality of the species within the environment with

the plasticity of its characters allows to infer adaptive radiations (CALSBEEK; SMITH;

BARDELEBEN, 2007; GRANT, 1986; LOSOS, 1994; SCHLUTER, 2001). Some

examples of this are "eco-evolutionary" indicators of short and/or long time scale, such

as intra-population variations of sexual dimorphism and phenotypic adaptations to

environmental conditions, and inter-population variations, reflecting vicarious and

dispersive processes (HENDRY, 2013).

Sexual dimorphism (SD) is an important pillar for variation in phenotypic

expression in animals (BENÍTEZ et al., 2011; BERNS, 2013; BONDURIANSKY, 2007;

SHINE, 1989), resulting from specific selective pressures of both sexes, reinforcing the

pre-zygotic isolation between evolutionary lineages, and thus representing a great source

of evolutionary diversification (ANDERSSON, 1994; DARWIN, 1871; SHINE, 1989;

SLATKIN, 1984). SD is a common phenotypic variation among decapod crustaceans,

usually expressed in larger body size and more robust chelipeds in males, which are used

in most cases in agonistic encounters (DUFFY & THIEL, 2007; LEE, 1995;

MARIAPPAN; BALASUNDARAM; SCHMITZ, 2000).

Morphological plasticity related to adaptation to environmental conditions are

intra-and inter-population sources of phenotypic variation in widely distributed species,

considering that a wide range of habitats is available (SCHEINER, 1993;

SPAARGAREN, 1999; WHITMAN; AGRAWAL, 2009; WINTERHALTER;

MOUSSEAU, 2007). Thus, it creates a requirement for adjustments to the

physicochemical parameters of the habitat mosaic within the limits of distribution of a

species (MCDOWALL, 2007). It is possible to observe, in several taxa of crustaceans,

variations in morphometric characters affected by different selective regimes (predators,

different resources, rainfall, hydrodynamics, etc.) (DIMMOCK; WILLIAMSON;

MATHER, 2004; SPAARGAREN, 1999; WINTERHALTER; MOUSSEAU, 2007),

23

which may be either a reflection of natural genetic organization (WALDMAN;

GROSSFIELD; WRIGIN, 1988) and, therefore, more related to past events, or to

modulation of gene expression due to external factors and, on the other hand, more related

to contemporary factors (HOLLANDER et al., 2006). Phenotypic plasticity related to

external morphology is common in crustaceans, and is related to sexual dimorphism

(ACCIOLY et al., 2013; ALENCAR et al., 2014; GRANDJEAN et al., 1997; KAPIRIS;

THESSALOU-LEGAKI, 2001; LEDESMA; DER MOLEN; BARON, 2010; SCALINI;

GIBERTINI, 2009; STREISSL; HODL, 2002) and/or environmental factors and isolation

of populations (DIMMOCK; WILLIAMSON; MATHER, 2004; HOPKINS;

THURMAN, 2010; LEDESMA; DER MOLEN; BARON, 2010; NEUFELD; PALMER,

2008; ROSENBERG, 2002; RUFINO; ABELLÓ; YULE, 2006; SILVA et al., 2010;

TORRES; COLLINS; GIRI, 2014; ZIMMERMANN et al., 2012).

To evaluate the changes in phenotypic expression, emphasizing the variation and

co-variation of the external morphology, we can mention a set of techniques with

quantitative approach that abstracts the shape of morphological structures of interest and

preserves its configuration (cartesian coordinates) in the analysis, called geometric

morphometry (ADAMS; ROHLF; SLICE, 2004; MITTEROECKER; GUNZ, 2009). This

set of techniques is characterized by its descriptive precision, recognition of intermediate

shape and gradation of similarity/dissimilarity between the shape and an hypothetical and

experimental extrapolation (ROTH; MERCER, 2000). Recently, the integration of

techniques such as morphometric and/or molecular integrated analyses is being used to

determine whether the differences occur due to past or present factors and also to evaluate

genetic and phenotypic variations in populations and patterns of distribution

(AHMADZADEH et al., 2013; BERBEL-FILHO et al., 2015; DAYRAT, 2005; JANSEN

et al., 2011; McCORMACK; ZELLMER; KNOWLES, 2010; PADIAL; DE LA RIVA,

2009; WARREN; GLOR; TURELLI, 2010). As well, use only one technique to link

ecological and evolutionary aspects of lineages, species or community (ROTH;

MERCER, 2000).

The genus Macrobrachium Spence Bate, 1868 has a pan-tropical distribution in

freshwater environments (VALÊNCIA; CAMPOS, 2007), and its taxonomy is hampered

by both by intra and interpopulational variations, such as strong sexual dimorphism and

the isolation of the drainages they dwell, respectively (HOLTHUIS, 1952; KONAN et

al., 2010; LEE, 1979; SHORT, 2004). Among the species of this genus, Macrobrachium

jelskii (Miers, 1877) is widely distributed, being found in coastal basins in South America

24

(Venezuela to Brazil) and in most basins in Orinoco, Amazon, Mid-Northeastern

Caatinga and Paraná-Paraguai (BASTOS; PAIVA, 1959; COELHO; RAMOS-PORTO,

1985; COLLINS, 2000; HOLTHUIS, 1950, 1966; MAGALHÃES et al., 2005; MELO,

2003). Moreover, there are indications of accidental introduction of specimens of this

species, coming from the Amazon basin in 1939, to northeastern Brazil due to the works

of the National Department of Works Against Drought (Departamento Nacional de Obras

Contra as Secas – DNOCS) to promote fishing and aquaculture in the semiarid (details in

GURGEL; OLIVEIRA, 1987).

This species has an abbreviated larval development, which occurs entirely in

freshwater (GAMBA, 1980, 1984, 1997; MAGALHÃES, 2000; PAIVA; BARRETO,

1960), a trait that also limits their dispersion compared to other species of the same genus.

Taking that in consideration, this species may have had its eco-evolutionary dynamics

modulated by preterit connection between the basins, either by the formation of paleo-

channels that connected the basins that cover this region during the Pleistocene marine

regressions (TURCHETTO-ZOLET et al., 2012), or by neotectonics adjustments that can

result in the capture of springs, which possibly affected the distribution of the continental

aquatic species and promoted mixing between populations, a pattern observed for fishes

by Albert & Reis (2011). After these scattering events, the lineages may have experienced

a long period of isolation, that can result in morphological and molecular differences

between species.

Natural populations often have their fitness tested for environmental variations

(WINDIG; DE KOVEL; DE JONG, 2004). Anthropogenic effects alter the natural

environment at an unprecedented rate (REED; SCHINDLER; WAPLES, 2011) and

freshwater environments have been repressively most impacted (COLLEN et al., 2013),

as with water transfer projects between basins (GRANT et al., 2012; MEADOR, 1992;

PITTOCK; MENG; CHAPAGAIN, 2009). Despite its socio-economic relevance, those

artificial links promote connectivity between geologically isolated basins and their

communities, promoting homogenization of biodiversity, loss of species richness

(BELLAFRONTE et al., 2010; GRANT et al., 2012), modifications of gene flow patterns

(BLANCO et al., 2009; PERES et al., 2012), disruptions in water quality, alteration of

habitats, and the introduction of invasive species (MEADOR, 1992). In the past, there

were numerous efforts by the government to solve the problem of inadequate water supply

in Central Northeast Caatinga, but without success (PITTOCK; MENG; CHAPAGAIN,

2009). An example of interbasin water transfer in evidence is the one on the São Francisco

25

River, from which water will be transferred to the basins of Jaguaribe, Piranhas-Açu,

Apodi-Mossoró and Paraíba do Norte (PITTOCK; MENG; CHAPAGAIN, 2009).

Understanding the eco-evolutionary dynamics of this species, knowing the

scenario of the São Francisco river water transfer process, becomes important as a way to

predict future impacts to populations of aquatic organisms. Thus, the aim of this study is

to describe and infer whether the phenotypic variation (morphological) among

populations of M. jelskii in northeastern Brazil are due to population structure and to

phenotypic plasticity.

2.2.MATERIAL AND METHODS

2.2.1. Sampling

A total of 3,709 specimens of the Macrobachium jelskii prawn was collected. The

samplings occurred between March/2012 and April/2013, performed using various

fishing tackle: sieves, trawls (lenght: 10m, height: 1.5m, stretch mesh netting: 0.5mm),

casting net, creels, following the RAP (Rapid Assesment Program) method, with

evaluation of the tackle that can be used according to the characteristics of each collection

site. Then, the collected animals were labeled and stored in 70% alcohol for subsequent

morphometric analysis. The collections covered the basins of Parnaiba (PNB), Apodi-

Mossoró (APO), Piranhas-Açu (PIR), Jaguaribe (JAG), Paraíba do Norte (PNORT) and

São Francisco (SFR) (Figure 1).

All specimens were identified according to the morphological and meristic

characters of their descriptions in the literature (GARCÍA-DÁVILA; HOLTHUIS, 1959;

MELO, 2003) and sexed, noticing the presence of the male appendage in the second pair

of pleopods (VALENTI, 1998).

For subsequent morphometric analyses, 965 specimens were used, at least 25 of

each sex (male and female) from sampling points distributed in lentic and lotic

environments in each basin (Table 1; Figure 1), to detect possible hydrodynamic

adaptations. Complete morphological structures, free of injuries and occasional damage

to the cephalothorax were used. In addition, only adult specimens were used in order to

avoid allometric ontogenetic effects (COCK, 1966) according to the procedure proposed

by Alencar et al. (2014).

26

2.2.2. Geometric morphometric analysis

The multivariate geometric morphometric set, in this study, creates the definition

of shape and all of its geometrical configurations, except for size, position and orientation

(KLINGENBERG et al., 2012), using anatomical landmarks to obtain shape information

through Procrustes Superimposition (DRYDEN; MARDIA, 1998).

Three plans of body structures were evaluated: lateral of cephalothorax (LC),

lateral of second abdominal somite (LSAS) and external face of cheliped (EFC). The body

plans were obtained by images captured using a Bel Eurekan digital camera (10.0

megapixels) with a Zoom Trinocular LAB-SZ25T stereomicroscope, using height and

position of the body plan standardized from the size range specimens collected. For all

image captures, the body structures were positioned in the central plane (vertical and

horizontal) of the image frame and scaled in millimeters for future obtainment of the size

information. Previous procedures were also carried out to standardize the distance and

zooming on objects, avoiding the Parallax effect (peripheral distortion). In addition, tests

to measure the accuracy of image capture and placement of landmarks were performed

(data not published). For ordering of digitalized images of a same body structure plan in

the same file in TPS format, the software tpsUtil (ROHLF, 2008) was used. To register

the landmarks in each digitalized image, the software tpsDig2 (ROHLF, 2006) was used.

In the LC body plan, 12 landmarks were positioned (Figura 2a). In LSAS 8 landmarks

were positioned (Figure 2b). Finally, in each EFC 12 landmarks were positioned (Figura

2c). The descriptions of landmarks followed the anatomical descriptions defined in

Williams (1984).

The coordinates of landmarks for each body plan were subjected to a Generalized

Procrustes analysis (GPA) (DRYDEN; MARDIA, 1998), a procedure that removes the

information not related to variation due to position, size and rotation (ROHLF; SLICE,

1990) (Figure 2).

Subsequently, a Multivariate Regression (grouped by sex and populations) of the

Procrustes coordinates (shape component) in the centroid size (size component) were

used to analyze the variation of shape in function of the allometric effect (DRAKE;

KLINGENBERG, 2008). The percentage of allometric prediction in variation of shape

was also calculated as a part of the percentage of the total variation of shape that the

regression model recorded, which was computed using the Procrustes distance

(GODALL, 1991; KLINGENBERG; MCINTYRE, 1998). The statistical significance of

27

allometric regressions was tested using a permutation test against the null hypothesis of

allometric independence (GOOD, 2000).

To make a comparison of the variations in shape of each body plan, between the

genders without differences in body size composition of specimens, and also controlling

the static and ontogenetic allometric effects (details in COCK, 1966), an allometric

correction was necessary (ALENCAR et al., 2014; SIDLAUSKAS; MOL; VARI, 2011).

Thus, the residues of multivariate regression of the shape under the centroid size were

used for subsequent inferential statistical analyses and research of variation of morpho-

space for each body plan.

Finally, Principal Component Analysis (PCA), Canonical Variables (CVA) and

Discriminant Function (DFA) were used to evaluate the variation in shape and find

differences between the sexes, lentic and lotic environment, and among populations. A

PCA using a covariance matrix from the residues of the multivariate regression was

performed to produce a morphospace of the main patterns of variation in the data and

trends among groups of interest (JOLLIFFE, 2002). The CVA shows a general view of

the variations between populations (corresponding to each basin) (ALBRECHT, 1980).

The DFA was used to generate the final variations in shape between males and females

and specimens of lentic and lotic environments, regardless of population. In hypothesis

testing in CVA and DFA, the probability values from the permutation test (n = 10,000)

for the Procrustes distance were computed. The Procrustes distance values were preferred

rather than the Mahalanobis distance ones by the fact that the first is the measurement of

absolute amount of shape variation, while the second is a relative measure of variation of

shape (KLINGENBERG; MONTEIRO, 2005). In addition, the percentages of correct

markings of the cross-validation matrix obtained in DFA were computed. For better

visualization of clusters among populations, an analysis of clusters from the residual data

coming from the multivariate regression was used.

The representations of shape variation obtained from the PCA, DFA and CVA

methods were observed by means of deformation grids and wireframe type graphics

(alternative representation of the body structure under study, or consensus) (Figure 1)

using landmarks coordinates.

Generalized Procrustes analysis, multivariate regressions, multivariate analysis of

PCA, CVA and DFA, transformation grids and wireframe graphics were conducted in

MorphoJ 1.02b® software (KLINGENBERG, 2011). Cluster analysis was performed

28

using R software (R DEVELOPMENT CORE TEAM, 2008), using the Geomorph

package (ADAMS; OTAROLA-CASTILLO, 2013).

2.3.RESULTS

The landmarks positioned for abstraction of shape in the analyzed body structures

plans (LC, LSAS and ECF) showed significant differences that demonstrate sexual

dimorphism, variations related to hydrodynamics and isolations by watersheds.

Allometric independedence of shape was observed in each of the structures (LC – p <

0.0001, % allometric prediction = 1.38%; LSAS – p < 0.0001, % allometric prediction =

5.13%; ECF– p < 0.0001, % allometric prediction = 20.86%) (Figure 3). Primarily, by

the relation between the procrustes coordinates and centroid size, it may be noticed sexual

dimorphism based on size (centroid size), in which females in the three body plans are

bigger than males (Figure 3).

The PCA analysis showed similar results for each body structure plan, revealing

variations in morphospace, mainly related to sexual dimorphism, less evident related to

hydrodynamics, and no trend among populations of each river basin (Figures 4 – 6).

According to the evaluation criteria of the PCA, the first five principal components were

investigated for LC (cumulative variation = 73.13%; PC1 = 28.38%, PC2 = 23.46%;

Figure 4). For LSAS the first three principal components were investigated (cumulative

variation = 71.52%; PC1 = 36.94%, PC2 = 19.66%; Figure 5). Finally, for ECF, the first

five principal components were investigated (cumulative variation = 76.42%; PC1 =

28.44%, PC2 = 15.73%; Figure 6).

In the evaluation of shapes between the sexes, regardless of the locations, DFA

indicated significant differences in the shapes for the three body structures (LC, LSAS

and ECF). CL and LSAS more dissimilar (Procrustes distance = 0.0392, p < 0.0001;

Procrustes distance = 0.0389, p < 0.0001; respectively), and ECF more similar (Procrustes

distance = 0.0098, p < 0.0001). All percentages of correct markings in the cross-validation

matrix were above 70% for observation of sexual dimorphism (Table 2). On the observed

deformations for each sex: (1) in LC a vector displacement in landmarks in the dorsal-

posterior and ventral-anterior regions was noticed, with females showing a lengthier

cephalothorax (Figure 7a); (2) in LSAS, females showed a more stretched lower portion

and a constricted upper portion, with the opposite being evidenced for males (Figure 7b);

29

and in ECF, changes in the morpho-space were more subtle, especially in the lower

portion and in the hinge region of the fixed dactyl (Figure 7c).

In DFA, to evaluate the variations of shape related to hydrodynamics, regardless

of population and genders, an equitable similarity between each body plan was observed

(Procrustes distance = LC – 0.0091, LSAS – 0.0083, ECF – 0.0112, p < 0.0001). All

percentages of correct markings in the cross-validation matrix were above 60% (Table 3).

Subtle deformations related to hydrodynamics were observed in lentic and lotic groups:

(1) in LC a subtle vertical displacement of the rostral spine in the distal portion was

observed, which was directed upwards in the lotic group and downwards in the lentic

group (Figure 8a), (2) in LSAS, there were no clear differences in morpho-space (Figure

8b), and in ECF, there were varitions in the morpho-space at the top portion of the palm

and the lower distal portion of the fixed dactyl, with lentic environment specimens

showing slightly thinner ones and lotic environment specimens showing more drawn ones

(Figure 8c).

The CVA identified, for body structure plan, statistical differences between

population groups in each basin. For the LC body plan, the first two CVs accounted for

72.35%, and the calculations of differences of Procustes distances showed significant

differences among all groups (Table 4). The vector displacements of the landmarks in the

regions of the antennal spine (landmark 10) (CV1) and the rostral spine (landmark 1, 2,

3, 11 and 12) (CV2) were the main responsible factors for the differentiation of each

population group. Observing the CV1, the specimens of APO showed a displacement of

landmark 10 directed to the lower direction (CV1+), while the specimens of PIR, PNB

and SFR groups showed a slight displacement to the upper direction (CV1-). In CV2, the

specimens of PNORT, JAG and SFR showed thinner rostral spines (CV2-), while the

PIR, PNB e APO groups tended to show more robust ones (CV2+).

For LSAS, the first three CVs accounted for 81.90%, and the calculations of

differences of Procustes distances showed significant differences among all groups (Table

4). The vector displacements mainly in the landmarks 3 and 7 (CV1) and in the landmarks

4 and 5 (CV2) were the main responsible factors for the subtle variations that showed a

groupment of populations near the consensus shape. However, it was noticed in CV1 that

the specimens of APO, JAG, PNORT and PNB showed a displancement in landmark 3

pointed to the anterior direction, and in landmark 7 to the inferior direction (CV1-), while

specimens of SFR and PIR showed deformations that were inverse to those noticed

previously (CV1+). In CV2, the specimens PNB, PAR, APO and PIR showed

30

displacement of landmark 4 to the posterior region and landmark 5 to the anterior region

(CV2-); JAG and SFR showed displacement of landmark 4 to the anterior region and

landmark 5 to the posterior region (CV2+) (Figure 10).

In ECF, the two CVs accounted for 74.59% and the calculations of differences of

Procustes distances showed significant differences among all groups (Table 4). The

vector displacements of the landmarks 1, 2 and 3, distal margin of the fixed dactyl, show

subtle population differences of shape in the morpho-space. Observing CV1, the

specimens of APO, JAG, PNORT and PNB showed a stretching in landmark 3 and almost

an alignment between landmarks 1, 2 and 3 (CV1-), while specimens of groups SFR and

PIR showed deformations that were inverse to those noticed previously (CV1+). In CV2,

the specimens of PNB showed in the axis CV2- deformations similar to the ones observed

in CV1-. As for the other populations, in the axis CV2+, variations similar to those of the

axis CV1+ were noticed (Figure 11).

Additionally, the cluster that best represented the groupings based in the

procrustes distances was the dendrogram made for the body structure plan of LSAS

(cophenetic correlation coefficient = 0.701) (Figure 12).

2.4.DISCUSSION

The three body plans of M. jelskii showed more evident instraspecific variations

of shape (sexual dimorphism and hydrodynamics) and less evident interspecific variations

of shape (populations). All the comparisons were statistically significant, as expected for

the geometric morphometric tool, which is able to identify subtle differences (BERTIN

et al., 2002). Knowing this, further discussions are based on Procrustes distance values

and variations (vector displacement) of the morphospace.

In LC, females showed larger cephalothorax (distant from the centroid) and tiny

vector retraction of the rostral spine, while males showed more compressed

cephalothoraxes and a subtle stretch of the rostral spine. Variations related to

cephalothorax may be related to gonadal development and selection of defense strategies.

In crustacean species that dwell strictly in freshwater, as M. jelskii, eggs contain lots of

yolk, due to the abridgment of the development in the larval stage. That way, females

reach larger sizes (cephalothorax length), providing a greater internal area for gonadal

development (BECK; COWELL, 1976; PARKER, 1992), in which oocytes of some

31

species of Macrobrachium can grow to 60 times their volume during vitellogenesis,

especially in cases of abbreviated of the larval stage (REVANTHI et al., 2012).

The abbreviation of the larval stage is common in freshwater crustaceans which

obtained independence from coastal environments (e. g. estuaries) by decreasing the

number of larval stages, ecloding in advanced larval stages (zoea and decapodit)

(BAUER, 2011a; CAVALLO; LAVENS; SORGELOOS, 2001; RODRÍGUEZ;

CUESTA, 2011) and, that way, developing an increased production of lipoproteins

composing the yolk (lecithotrophic egg) (MASHIKO, 1983; WILDER;

SUBRAMONIAM; AIDA, 2002), that ends up occupying about ¾ of the total volume of

the egg (MOSSOLIN et al., 2013), and also low fecundity (MASHIKO, 1983; VOGT,

2012). With regards to the subtle stretch of the rostral spine, this may be a consequence

of selection of defensive characters, as males usually explore more the environment for

resources (foraging and searching for susceptible females) and have higher mortality rates

by predation (BAEZA; DÍAZ-VALDÉZ, 2011; NAKASHIMA, 1987). Nakagaki (1999)

in experimental study on predation of Xiphopenaeus kroyeri Heller, 1862 (Sub-Order

Dendrobranchiata), suggested that the shrimps with pronounced rostral spine (more

angled and longer) are avoided and less preyed upon by potential predators. Werner and

Peacor (2003) and Preisser, Bolnick and Benard (2005) add that predation rate is mediated

by some characters of the prey, such as size, speed, cripticity and external morphology

(e.g., defensive spines).

In LSAS, for females there was a stretch of the lower portion of the abdomen and

a constriction for males, and vice versa for the upper portion. This character is highlighted

for the vast majority of prawns of Sub-Order Pleocyemata, in which most species incubate

the eggs until hatching, zoea or decapodit (BURKENROAD, 1963). In Caridea Infra-

Order, the character of incubating eggs is shown in the second abdominal segment, where

the segment pleuron overlaps the pleura of the first and third segments (WILLIAMS,

1984). In caridean shrimp, this characteristic favors sexual dimorphism, where females

tend to have a positive allometric relation between cephalothorax length and width of the

abdomen (AHAMED; OHTOMI, 2014; BAEZA; HEMPHILL; RITSON-WILLIAMS,

2015; MANTEL; DUDGEON, 2005; PASCHOAL; GUIMARÃES; COUTO, 2013;

PRALON; NEGREIROS-FRANSOZO, 2006), and in multivariate morphometric studies,

a discriminatory variable to show sexual dimorphism (DE GRAVE; DIAZ, 2001).

In ECF, specimens showed little variation in morphospace and greater similarity

between the sexes, perhaps a possible evidence of absence or few events of agonistic

32

encounters, corroborating the high densities of specimens collected from both sexes,

forming large groups. Another important fact is that for this species there is no record of

hierarchical groups of dominance among males, together with proof of females reaching

bigger sizes (centroid size) than males. According to Moore (2007) and Bauer (2011b),

species with the standard mentioned above are characterized as "aggregated species" in

which there are high population densities and the copula happens by "pure search" (active

search for receptive females), with no reports of pre or post-copulatory behavior

(guarding of females, fights for partners and cohort behavior).

With regards to hydrodynamics comparison, specimens in both lentic and lotic

environments were more similar in the three body planes, based on little variation in

morpho-space, low values of procrustes distances and of correct markings. This result

may reflect the micro-habitat occupied by the species, always housed in marginal aquatic

vegetation and in association with roots of submerged phanerogams (MELO, 2003). This

habit possibly allows the species to avoid the abiotic hydrodynamics factor, avoiding the

current and unnecessary energy expenditure with swimming. Another fact that should be

emphasized are the seasonal cycles of drought and rain that can provide drastic changes

in the speed of the river currents, where lentic environments can become lotic in periods

of high rainfall, with exceptions for the rivers São Francisco and Parnaíba, both of

perennial regime (AB’SÁBER, 1974; ROSA et al., 2003).

Moreover, Gurgel and Oliveira (1987) provide a hypothetical scenario of

introduction of this species in 1939 along with M. amazonicum (Heller, 1862), M.

acanthurus (Wiegmann, 1836) and other 39 species of fish in the weirs, rivers and brooks

in Brazilian Northeast by DNOCS, with the objective of encouraging subsistence fishing

among the settlements located near weirs. However, the same authors state that the

species M. jelskii was already native to the Brazilian Northeast basins, and the matrices

introduced were coming from the Amazon basin. Phylogenetic studies of this kind

covering populations of Brazilian continental and coastal basins show low genetic

variability (VERA-SILVA; CARVALHO; MANTELATTO, 2016). In the present study,

this can be evidenced in the low procustes distance related to lentic and lontic

environments, which is likely an indication of a possible founder effect caused by human

action, that can be a scenario of introduction of a small portion of the population (matrix),

resulting in low genetic differentiation and, consecutively, few fenotypical characters

abstracted by morphometric geometry technique.

33

Among the watersheds, there was not a clear consensus between the patterns of

similarities and dissimilarities among the populations among the planes of body structure,

but in the LSAS plan, were viewed comparisons peer-to-peer that obtained the highest

procrustes distance values and highest cophenetic correlation coefficient in the cluster

analysis. Such a structure, based on the quantification of shape, may reflect characteristics

related to the plasticity of the larval stage abbreviation modulated by environmental

factors such as salinity, temperature and rainfall, as evidenced for gender (JALIHAL;

SANKOLLI; SHENOY, 1993; MAGALHÃES; WALKER, 1988 – varying between 1 to

11 larval stages) and for species (GAMBA, 1980; 1984; 1997; MAGALHÃES, 2000;

PAIVA; BARRETO, 1960– larval period length, 8 to 15 days).

Vogt points out that such plasticity of the larval stage abbreviation, concomitantly

to changes in vitellogenesis, in larval development and parental in care, are responsible

for the conquest of freshwater and terrestrial environment, with independence of coastal

(estuaries and coastal lagoons) and marine environments. The shape settings can

indirectly represent egg size or amount of yolk in the populations studied, in which basins

with lower river and rainwater input (PNORT, PIR and APO), would show females

producing more effective eggs (more yolk and greater total volume - females with wider

abdominal pleuron, stretched horizontally), and most river and rainwater input (PNB e

SFR) or prerennial passages (JAG) would present less effective eggs (less yolk and less

total volume, females with a narrow abdominal pleuron, horizontally compressed) also

highlighting the condition of perennial regime of the rivers Parnaíba and São Francisco,

which can provide an environment without large seasonal variations in environmental

factors. Variations in egg size are reported for the species M. nipponense (De Haan, 1849)

in different populations, but having salinity as a modulator (MASHIKO; NUMACHI,

2000).

Despite the evidences of unnatural introduction of this species in northeastern

Brazil, the structure of the populations, based on the quantification of the shape, can also

be a reflection of neotectonic arrangements (TURCHETTO-ZOLET et al., 2012). The

first scenario is the arrangement of spring captures of the basins of rivers Orinoco (type

locality of M. jelskii) and Amazonas, dated 30-40 million years ago (LUNDBERG et al.,

1998). The second scenario depicts the possible connectivity between the basins and is

related to episodes of marine ingression that provide connectivity of the basins of rivers

Amazonas, Parnaíba, de la Plata and São Francisco, dated 12-20 million years ago

(BLOOM; LOVEJOY, 2011; LIMA; RIBEIRO, 2011; LOVEJOY; BERMINGHAM;

34

MARTIN, 1998; RAMOS; ALEMAN, 2000), which may be a reason for the greater

similarity of shape and the shortest procrustes distance among populations of the basins

of Parnaíba and São Francisco. Finally, there is evidence, in northeastern Brazil, that can

confirm the existence of paleo-channels such as valleys or failures in sedimentological

deposits that portray a Pleistocene link between the waterways of Baturité-Urauçuba

compartments (Parnaíba Basin - PNB) and especially Jaguaribe-Potiguar (Basins of

Jaguaribe - JAG, Apodi-Mossoró - APO, Piranhas-Açu - PIR) (BRITO NEVES; DOS

SANTOS; VAN SCHMUS, 2000; CABY; ARTHAUD; ARCHANJO, 1995;

CARNEIRO; HAMZA; ALMEIDA, 1989; PEULVAST et al., 2008). The latter scenario

may indirectly explain the grouping by similarity of shape in most basins composing the

Mid-Northeast Caatinga Ecoregion.

This information can provide products of these plastic phenotypes and provide

possible signs of past events of increase in sea level and of marine regression. Aspects of

eco-evolutionary dynamics on the morphology (shape) provide evidence about sexual

dimorphism, origin of natural distribution of species and population variations. These

aspects have not been investigated for all taxa of crustaceans and its wide range of eco-

evolutionary indicators of short and long time-scale, especially in the tropical region of

semiarid regime. Thus, interpretation of the direction and of the phenotypic plasticity

degree can give erroneous results, in which differences in body shape are generally not

assigned to a single natural selective force (natural and sexual selection), but to artificial

processes involved (anthropic introduction). This study exemplifies how the investigation

of body variations can be correlated to the knowledge of the biology of the species and

also give subsidies to formulate new questions about evolutionary aspects and speculation

about future impacts of the interbasin transfer of the São Francisco River on the biological

heritage of the semiarid region. The Ministry of National Integration reports that the

environmental impact of the transfer of water between basins will be inexpressible

(PITTOCK; MENG; CHAPAGAIN, 2009), promoting a great exchange between aquatic

fauna and evolutionary lineages that diversified independently by dispersive and vicariant

processes. This possibly means an unpredictable and unrecoverable loss of intraspecific

diversity, evolutionary potential and information about the history of shrimp lineages in

the Mid-Northeast

Further investigations about populational, ecological, behavioral, physiological

(tolerance to salinity, correlating with marine incursion events) and genetical (use of more

35

sensitive markers for population differences) aspects can contribute to a deeper evaluation

of the overall status of the species to along its geographic distribution.

Acknowledgements

The authors thank the Conselho Nacional de Desenvolvimento Cientifico e Tecnológico

(National Scientific Development Council, CNPq #552086/2011-8) for the financing of

the research project and for the scholarships granted (Sávio ASN Moraes - CAPES), and

the LISE and GEEFAA members for the field and lab support. All fieldwork was

conducted in accordance with state and federal environmental laws (License collection

SISBIO-IBAMA #28314-1). The authors declare no conflicts of interest.

REFERENCES

AB’SÁBER, A. N. O domínio morfoclimático semi-árido das caatingas brasileiras

Geomorfológia. São Paulo, JGEOG, USP, v. 43, 1974.

ACCIOLY, INGRID V. et al. Sexual dimorphism in Litopenaeus vannamei (Decapoda)

identified by geometric morphometrics. Pan-American Journal of Aquatic Sciences, v.

8, n. 4, p. 276-281, 2013.

ADAMS, Dean C.; OTÁROLA‐CASTILLO, Erik. geomorph: an R package for the

collection and analysis of geometric morphometric shape data. Methods in Ecology and

Evolution, v. 4, n. 4, p. 393-399, 2013.

ADAMS, Dean C.; ROHLF, F. James; SLICE, Dennis E. Geometric morphometrics: ten

years of progress following the ‘revolution’. Italian Journal of Zoology, v. 71, n. 1, p.

5-16, 2004.

AHAMED, F.; OHTOMI, J. Relative growth and sexual maturity of the pandalid shrimp

Plesionika izumiae (Decapoda, Caridea) in Kagoshima Bay, southern

Japan. Crustaceana, v. 87, n. 13, p. 1567-1577, 2014.

AHMADZADEH, Faraham et al. Cryptic speciation patterns in Iranian rock lizards

uncovered by integrative taxonomy. PloS one, v. 8, n. 12, p. e80563, 2013.

ALBERT, J. S.; REIS, R. E. Introduction to Neotropical freshwaters. Historical

biogeography of neotropical freshwater fishes, p. 3-19, 2011.

ALBRECHT, Gene H. Multivariate analysis and the study of form, with special reference

to canonical variate analysis. American Zoologist, p. 679-693, 1980.

36

ALENCAR, C. E. R. D. et al. Sexual shape dimorphism of the mangrove crab Ucides

cordatus (Linnaeus, 1763) (Decapoda, Ucididae) accessed through geometric

morphometric. The Scientific World Journal, v. 2014, 2014.

ANDERSSON, Malte B. Sexual selection. Princeton University Press, 1994.

BAEZA, J. Antonio; DÍAZ‐VALDÉS, Marta. The symbiotic shrimp Ascidonia

flavomaculata lives solitarily in the tunicate Ascidia mentula: implications for its mating

system. Invertebrate Biology, v. 130, n. 4, p. 351-361, 2011.

BAEZA, J. Antonio; HEMPHILL, Carrie A.; RITSON-WILLIAMS, Raphael. The sexual

and mating system of the shrimp Odontonia katoi (Palaemonidae, Pontoniinae), a

symbiotic guest of the ascidian Polycarpa aurata in the coral triangle. PloS one, v. 10, n.

3, p. e0121120, 2015.

BASTOS, J. A. M.; PAIVA, M. P. Notas sobre o consumo de oxigênio do camarão

‘sossêgo’, Macrobrachium jelskii (Miers, 1877) Chace & Holthuis, 1948. Revista

Brasileira de Biologia, v. 19, n. 4, p. 413-419, 1959.

BAUER R. T. Amphidromy and migrations of freshwater shrimps. II. Delivery of

hatching larvae to the sea, return juvenile upstream migration, and human impacts. In:

Asakura A. (Ed.). New Frontiers in Crustacean Biology, Crustaceana Monographs,

Brill, Leiden, 2011a. p.157–168.

BAUER R. T. Chemical communication in decapods shrimps: the influence ofmating and

social systems on the relative importance of olfactory and contact pheromones. In:

BREITHAUPT, T.; THIEL, M. (Eds.). Chemical Communication in Crustaceans,

Springer Science Business Media LCC, New York, 2011b. p.277-295.

BECK, J. Thomas; COWELL, Bruce C. Life history and ecology of the freshwater

caridean shrimp, Palaemonetes paludosus (Gibbes). American Midland Naturalist, p.

52-65, 1976.

BELLAFRONTE, Elisangela et al. Cytogenetic identification of invasive fish species

following connections between hydrographic basins. Hydrobiologia, v. 649, n. 1, p. 347-

354, 2010.

BENÍTEZ, Hugo A. et al. Geometric perspectives of sexual dimorphism in the wing shape

of Lepidoptera: the case of Synneuria sp.(Lepidoptera: Geometridae). J. Entomol. Res.

Soc, v. 13, n. 1, p. 53-60, 2011.

BERBEL-FILHO, Waldir M. et al. Inter-and intra-basin phenotypic variation in two

riverine cichlids from northeastern Brazil: potential eco-evolutionary damages of São

Francisco interbasin water transfer. Hydrobiologia, v. 766, n. 1, p. 43-56, 2015.

37

BERNS, Chelsea M. The evolution of sexual dimorphism: understanding mechanisms of

sexual shape differences. Sexual Dimorphism, p. 1-16, 2013.

BERTIN, Angeline et al. Quantification of sexual dimorphism in Asellus aquaticus

(Crustacea: Isopoda) using outline approaches. Biological Journal of the Linnean

Society, v. 77, n. 4, p. 523-533, 2002.

BLANCO, Daniel Rodrigues et al. Characterization of invasive fish species in a river

transposition region: evolutionary chromosome studies in the genus Hoplias

(Characiformes, Erythrinidae). Reviews in Fish Biology and Fisheries, v. 20, n. 1, p. 1-

8, 2009.

BLOOM, Devin. D.; LOVEJOY, Nathan R. The biogeography of marine incursions in

South America. In: Albert, J.S.; Reis, R.E. (Eds.). Historical Biogeography of

Neotropical Freshwater Fishes. University of California Press, Berkeley, 2011 p.137-

144.

BONDURIANSKY, Russell. The evolution of condition-dependent sexual

dimorphism. The American Naturalist, v. 169, n. 1, p. 9-19, 2007.

BRITO NEVES, Benjamin B.; DOS SANTOS, Edilton J.; VAN SCHMUS, William R.

Tectonic history of Borborema Province, Northeastern Brazil. In: Cordani, U.G, Thomaz

Filho, A.; Campos, D.A. (Eds.). Tectonic Evolution of South America. 31st

International Geological Congress, Rio de Janeiro, 2000. p.151-182

BURKENROAD, Martin D. The evolution of the Eucarida, (Crustacea, Eumalacostraca),

in relation to the fossil record. Tulane Studies in Geology and Paleontology, v. 2, n. 1,

1963.

CABY, Renaud; ARTHAUD, Michel H.; ARCHANJO, Carlos J. Lithostratigraphy and

petrostructural characterization of supracrustal units in the Brasiliano Belt of Northeast

Brazil: geodynamic implications. Journal of South American Earth Sciences, v. 8, n.

3-4, p. 235-246, 1995.

CALSBEEK, Ryan; SMITH, Thomas B.; BARDELEBEN, Carolyne. Intraspecific

variation in Anolis sagrei mirrors the adaptive radiation of Greater Antillean

anoles. Biological Journal of the Linnean Society, v. 90, n. 2, p. 189-199, 2007.

CARNEIRO, Celso D. R.; HAMZA, Valiya M.; DE ALMEIDA, Fernando F. M.

Ativação tectônica, fluxo geotérmico e sismicidade no Nordeste Oriental

brasileiro. Revista Brasileira de Geociências, v. 19, n. 3, p. 310-322, 1989.

38

CAVALLO, Ronaldo O.; LAVENS, Patrick; SORGELOOS, Patrick. Reproductive

performance of Macrobrachium rosenbergii females in captivity. Journal of the World

Aquaculture Society, v. 32, n. 1, p. 60-67, 2001.

COCK, A. G. Genetical aspects of metrical growth and form in animals. The Quarterly

Review of Biology, v. 41, n. 2, p. 131-190, 1966.

COELHO, Petrônio A.; RAMOS-PORTO, Marilena. Camarões de água doce do Brasil:

distribuição geográfica. Revista Brasileira de Zoologia, v. 2, n. 6, p. 405-410, 1985.

COLLEN, Ben et al. Global patterns of freshwater species diversity, threat and

endemism. Global Ecology and Biogeography, v. 23, n. 1, p. 40-51, 2013.

COLLINS, Pablo A. Macrobrachium jelskii (Miers, 1877). Crustaceana, v. 73, n. 9, p.

1167-1169, 2000.

DARWIN, Charles. The descent of man, and selection in relation to sex, v. 2, 1871.

DAYRAT, Benoit. Towards integrative taxonomy. Biological journal of the Linnean

society, v. 85, n. 3, p. 407-415, 2005.

DE GRAVE, S.; DIAZ, D. Morphometric comparison between Mediterranean and

Atlantic populations of Pontophilus norvegicus (Decapoda, Crangonidae).

Hydrobiologia, p. 179-186, 2001.

DIMMOCK, Amanda; WILLIAMSON, I.; MATHER, P. B. The influence of

environment on the morphology of Macrobrachium australiense (Decapoda:

Palaemonidae). Aquaculture International, v. 12, n. 4, p. 435-456, 2004.

DRAKE, Abby G.; KLINGENBERG, Christian P. The pace of morphological change:

historical transformation of skull shape in St Bernard dogs. Proceedings of the Royal

Society of London B: Biological Sciences, v. 275, n. 1630, p. 71-76, 2008.

DRYDEN, Ian L.; MARDIA, Kanti V. Statistical analysis of shape. Wiley, 1998.

DUFF, J. E.; THIEL, M. Evolutionary ecology of social and sexual systems:

crustaceans as model organisms. Oxford University Press on Demand, 2007.

GAMBA, A. L. Desarrollo larval abreviado del camarón de agua dulce Macrobrachium

jelskii (Miers, 1877). Primeras Jornadas Científicas, Universidad Simón Bolívar.

Caracas, Venezuela, p. 169-190, 1980.

GAMBA, A. L. Different egg-associated and larval development characteristics of

Macrobrachium jelskii and Macrobrachium amazonicum (Arthropoda: Crustacea) in a

Venezuelan continental lagoon. International Journal of Invertebrate Reproduction

and Development, v. 7, n. 3, p. 135-142, 1984.

39

GAMBA, A. L. Biología reproductiva de Macrobrachium jelskii (Miers, 1877) y

Macrobrachium amazonicum (Heller, 1862) en Venezuela (Crustacea, Decapoda,

Palaemonidae). Acta Cientifica Venezolana, v. 48, n. 1, p. 19-26, 1997.

GARCÍA-DÁVILA, Carmen R.; MAGALHÃES, Célio. Revisão taxonômica dos

camarões de água doce (Crustacea: Decapoda: Palaemonidae, Sergestidae) da Amazônia

Peruana. Acta Amazonica, v. 33, n. 4, p. 663-686, 2003.

GOOD, Phillip. Permutation tests: a practical guide to resampling methods for

testing hypotheses. Springer Science & Business Media, 2000.

GOODALL, Colin. Procrustes methods in the statistical analysis of shape. Journal of the

Royal Statistical Society. Series B (Methodological), p. 285-339, 1991.

GRANDJEAN, F. et al. Morphometry, sexual dimorphism and size at maturity of the

white-clawed crayfish Austropotamobius pallipes pallipes (Lereboullet) from a wild

French population at Deux-Sèvres (Decapoda, Astacidea), Crustaceana, v. 70, n. 1, p.

31-44, 1997.

GRANT, Evan H. C. et al. Interbasin water transfer, riverine connectivity, and spatial

controls on fish biodiversity. PLoS One, v. 7, n. 3, p. e34170, 2012.

GRANT, Peter R. Ecology and evolution of Darwin's finches. Princeton University

Press, 1986.

GURGEL, J. J. S.; OLIVEIRA, A. B. Efeitos da introdução de peixes e crustáceos no

semi-árido do nordeste brasileiro. ESAM, 1987.

HENDRY, A. P. Key questions in the genetics and genomics of eco-evolutionary

dynamics. Heredity, v. 111, n. 6, p. 456-466, 2013.

HOLTHUIS, Lipke Bijdeley. The Decapoda of the Siboga Expedition: Pt. 10: the

Palaemonidae Collected by the Siboga and Snellius Expeditions with Remarks on

Other Species: 1: Subfamily Palaemoninae. Brill, 1950.

HOLTHUIS, Lipke Bijdeley. A general revision of the Palaemonidae (crustacea

Decapod Natantia) of the Americas. II. The subfamily Palaemonidae. 1952.

HOLTHUIS, Lipke B. The Crustacea Decapoda of Suriname (Dutch Guiana). EJ

Brill, 1959.

HOLTHUIS, L. B. A collection of freshwater prawns (Crustacea Decapoda,

Palaemonidae) from Amazonia, Brazil, collected by Dr. G. Marlier. 1966.

HOPKINS, Melanie J.; THURMAN, Carl L. The geographic structure of morphological

variation in eight species of fiddler crabs (Ocypodidae: genus Uca) from the eastern

40

United States and Mexico. Biological Journal of the Linnean Society, v. 100, n. 1, p.

248-270, 2010.

HOLLANDER, Johan et al. Phenotypic plasticity in two marine snails: constraints

superseding life history. Journal of evolutionary biology, v. 19, n. 6, p. 1861-1872,

2006.

JALIHAL, D. R.; SANKOLLI, K. N.; SHENOY, Shakuntala. Evolution of larval

developmental patterns and the process of freshwaterization in the prawn genus

Macrobrachium Bate, 1868 (Decapoda, Palaemonidae). Crustaceana, v. 65, n. 3, p. 365-

376, 1993.

JANSEN, Martin et al. Integrative inventory of Bolivia’s lowland anurans reveals hidden

diversity. Zoologica Scripta, v. 40, n. 6, p. 567-583, 2011.

JOLLIFFE, Ian. Principal component analysis. John Wiley & Sons, Ltd, 2002.

KAPIRIS, Kostas; THESSALOU-LEGAKI, Maria. Sex-related variability of rostrum

morphometry of Aristeus antennatus (Decapoda: Aristeidae) from the Ionian Sea (Eastern

Mediterranean, Greece). Hydrobiologia, v. 449, p.123–130, 2001.

Klingenberg C. P., Duttke S., Whelan S. & Kim M. (2012) Developmental plasticity,

morphological variation and evolvability: a multilevel analysis of morphometric

integration in the shape of compound leaves. Journal of Evolutionary Biology, 25, 115-

129.

KLINGENBERG, Christian Peter; MCINTYRE, Grant S. Geometric morphometrics of

developmental instability: analyzing patterns of fluctuating asymmetry with Procrustes

methods. Evolution, p. 1363-1375, 1998.

KLINGENBERG, Christian Peter; MONTEIRO, Leandro R. Distances and directions in

multidimensional shape spaces: implications for morphometric applications. Systematic

Biology, v. 54, n. 4, p. 678-688, 2005.

KLINGENBERG, Christian Peter. MorphoJ: an integrated software package for

geometric morphometrics. Molecular ecology resources, v. 11, n. 2, p. 353-357, 2011.

KONAN, Koffi Mexmin et al. Morphometric variation among male populations of

freshwater shrimp Macrobrachium vollenhovenii Herklots, 1851 from Côte d’Ivoire

Rivers. Fisheries Research, v. 103, n. 1, p. 1-8, 2010.

LEDESMA, Federico M.; VAN DER MOLEN, Silvina; BARÓN, Pedro J. Sex

identification of Carcinus maenas by analysis of carapace geometrical

morphometry. Journal of Sea Research, v. 63, n. 3, p. 213-216, 2010.

41

LEE, C. L.; FIELDER, D. R. A mass migration of the freshwater prawn, Macrobrachium

australiense Holthuis, 1950 (Decapoda, Palaemonidae). Crustaceana, v. 37, n. 2, p. 219-

222, 1979.

LEE, S. Yl. Cheliped size and structure: the evolution of a multi-functional decapod

organ. Journal of Experimental Marine Biology and Ecology, v. 193, n. 1-2, p. 161-

176, 1995.

LIMA, Flávio C. T.; RIBEIRO, Alexandre C. (2011) Continental–scale tectonic controls

of biogeography and ecology. In: ALBERT J.S.; REIS R.E. (Eds.). Historical

Biogeography of Neotropical Freshwater Fishes, University of California Press,

Berkeley, 2011. p.145-164.

LOSOS, Jonathan B. Integrative approaches to evolutionary ecology: Anolis lizards as

model systems. Annual Review of Ecology and Systematics, v. 25, n. 1, p. 467-493,

1994.

LOVEJOY, Nathan R.; BERMINGHAM, Eldredge; MARTIN, Andrew P. Marine

incursion into South America. Nature, v. 396, n. 6710, p. 421-422, 1998.

LUNDBERG, G. J. et al. Phylogeny and Classification of Neotropical Fishes. In:

MALABARBA, L. R. et al. (Eds.). The stage for Neotropical fish diversification: a

history of tropical South America river, Edipuers, Porto Alegre, 1998. p.13-48.

MAGALHÃES, Célio et al. Exotic species of freshwater decapod crustaceans in the state

of São Paulo, Brazil: records and possible causes of their introduction. Biodiversity and

Conservation, v. 14, n. 8, p. 1929-1945, 2005.

MAGALHÃES, Célio; WALKER, Ilse. Larval development and ecological distribution

of central Amazonian palaemonid shrimps (Decapoda, Caridea). Crustaceana, v. 55, n.

3, p. 279-292, 1988.

MAGALHÃES, Célio. Abbreviated larval development of Macrobrachium jelskii

(Miers, 1877) (Crustacea: Decapoda: Palaemonidae) from the Rio Solimões floodplain,

Brazil, reared in the laboratory. Nauplius, v.8, n.1, p. 1-14, 2000.

MANTEL, Sukhmani Kaur; DUDGEON, David. Reproduction and sexual dimorphism

of the palaemonid shrimp Macrobrachium hainanense in Hong Kong streams. Journal of

Crustacean Biology, v. 25, n. 3, p. 450-459, 2005.

MARIAPPAN, Pitchaimuthu; BALASUNDARAM, Chellam; SCHMITZ, Barbara.

Decapod crustacean chelipeds: an overview. Journal of biosciences, v. 25, n. 3, p. 301-

313, 2000.

42

MCCORMACK, John E.; ZELLMER, Amanda J.; KNOWLES, L. Lacey. Does niche

divergence accompany allopatric divergence in Aphelocoma jays as predicted under

ecological speciation?: insights from tests with niche models. Evolution, v. 64, n. 5, p.

1231-1244, 2010.

MCDOWALL, R. M. On amphidromy, a distinct form of diadromy in aquatic

organisms. Fish and fisheries, v. 8, n. 1, p. 1-13, 2007.

MEADOR, Michael R. Inter-basin water transfer: ecological concerns. Fisheries, v. 17,

n. 2, p. 17-22, 1992.

MELO, G. A. S. Famílias Atyidae, Palaemonidae e Sergestidae. Manual de

identificação dos Crustacea Decapoda de água doce do Brasil, p. 289-415, 2003.

MITTEROECKER, Philipp; GUNZ, Philipp. Advances in geometric

morphometrics. Evolutionary Biology, v. 36, n. 2, p. 235-247, 2009.

MOORE, P. A. Agonistic behavior in freshwater crayfish – the influence of intrinsic and

extrinsic factors on aggressive encounters and dominance. In: DUFFY, E.J.; THIEL, M.

(Eds.). Evolutionary ecology of social and sexual systems – crustaceans as model

organisms, Harvard University Press, New York, 2007. p.90-114.

MOSSOLIN, Emerson Contreira et al. Population and reproductive features of the

freshwater shrimp Macrobrachium jelskii (Miers, 1877) from São Paulo State,

Brazil. Acta Scientiarum. Biological Sciences, v. 35, n. 3, p. 429-436, 2013.

NAKAGAKI J. M. Estudo da predação sobre camarões peneídeos (Crustacea,

Decapoda). PhD Thesis, Universidade Estadual Paulista, Botucatu, 1999.

NAKASHIMA, Yasuhiro. Reproductive strategies in a partially protandrous shrimp,

Athanas kominatoensis (Decapoda: Alpheidae): sex change as the best of a bad situation

for subordinates. Journal of Ethology, v. 5, n. 2, p. 145-159, 1987.

NEUFELD, Christopher J.; PALMER, A. Richard. Precisely proportioned: intertidal

barnacles alter penis form to suit coastal wave action. Proceedings of the Royal Society

of London B: Biological Sciences, v. 275, n. 1638, p. 1081-1087, 2008.

PADIAL, José M.; DE LA RIVA, Ignacio. Integrative taxonomy reveals cryptic

Amazonian species of Pristimantis (Anura: Strabomantidae). Zoological Journal of the

Linnean Society, v. 155, n. 1, p. 97-122, 2009.

PAIVA M. P.; BARRETO V. A. Notas sobre a biologia do camarão ‘sossego’,

Macrobrachium jelskii (Miers, 1877) numa pequena bacia potamográfica do nordeste

brasileiro. Revista Brasileira de Biologia, v. 20, n. 2, p. 121-129, 1960.

43

PALKOVACS, Eric P.; POST, David M. Experimental evidence that phenotypic

divergence in predators drives community divergence in prey. Ecology, v. 90, n. 2, p.

300-305, 2009.

PARKER, G. A. The evolution of sexual size dimorphism in fish. Journal of Fish

Biology, v. 41, n. sB, p. 1-20, 1992.

PASCHOAL, Lucas RP; GUIMARÃES, Fernanda J.; COUTO, Erminda CG. Relative

growth and sexual maturity of the freshwater shrimp Palaemon pandaliformis (Crustacea,

Palaemonidae) in northeastern of Brazil (Canavieiras, Bahia). Iheringia. Série Zoologia,

v. 103, n. 1, p. 31-36, 2013.

PELLETIER, Fanie; GARANT, Dany; HENDRY, A. P. Eco-evolutionary dynamics.

Philosophical Transactions of the Royal Society B: Biological Sciences, v. 364, p.

1483-1489, 2009.

PERES, Wellington Adriano Moreira et al. Invasion, dispersion and hybridization of fish

associated to river transposition: karyotypic evidence in Astyanax “bimaculatus

group”(Characiformes: Characidae). Reviews in Fish Biology and Fisheries, v. 22, n. 2,

p. 519-526, 2012.

PEULVAST, Jean-Pierre et al. Low post-Cenomanian denudation depths across the

Brazilian Northeast: implications for long-term landscape evolution at a transform

continental margin. Global and Planetary Change, v. 62, n. 1, p. 39-60, 2008.

PITTOCK, J.; MENG, J.; CHAPAGAIN, A. K. Interbasin Water Transfers and Water

Scarcity in a Changing World — A Solution or a Pipedream? A Discussion Paper in

a Burning Issue. WWF Germany, Frankfurt, 2009.

PRALON, B. G. N.; NEGREIROS-FRANSOZO, M. L. Population biology of Palaemon

(Palaeander) northropi Rankin, 1898 (Crustacea, Decapoda, Palaemonidae) in a tropical

South American estuary. Acta Limnologica Brasiliensia, v. 18, n. 1, p. 77-87, 2006.

PREISSER, Evan L.; BOLNICK, Daniel I.; BENARD, Michael F. Scared to death? The

effects of intimidation and consumption in predator–prey interactions. Ecology, v. 86, n.

2, p. 501-509, 2005.

R DEVELOPMENT CORE TEAM. R: A language and environment for statistical

computing. R Foundation for Statistical Computing, Vienna, 2008.

RAMOS, V. A.; ALEMAN, A. Tectonic Evolution of the Andes. In: Cordani, U. et al.

(Eds.). Tectonic Evolution of South America, 31st International Geological Congress,

Rio de Janeiro, 2000. p.635-685.

44

REED, Thomas E.; SCHINDLER, Daniel E.; WAPLES, Robin S. Interacting effects of

phenotypic plasticity and evolution on population persistence in a changing

climate. Conservation Biology, v. 25, n. 1, p. 56-63, 2011.

REVANTHI, Peranandam et al. Vitellogenesis during the ovarian development in

freshwater female prawn Macrobrachium rosenbergii (De Man). International Journal

of Aquatic Science, v. 3, n. 2, p. 13-27, 2012.

RODRÍGUEZ, Antonio; CUESTA, José A. Morphology of larval and first juvenile stages

of the kangaroo shrimp Dugastella valentina (Crustacea, Decapoda, Caridea), a

freshwater atyid with abbreviated development and parental care. Zootaxa, v. 2867, p.

43-58, 2011.

ROHLF, F. James; SLICE, Dennis. Extensions of the Procrustes method for the optimal

superimposition of landmarks. Systematic Biology, v. 39, n. 1, p. 40-59, 1990.

ROHLF, F. James. tpsDig, software program. version 2.10. Department of Ecology and

Evolution, State University of New York at Stony Brook, 2006.

ROHLF, F. James. tpsUtil, file utility program. version 1.40. Department of Ecology

and Evolution, State University of New York at Stony Brook, 2008.

ROSA, RICARDO S. et al. Diversidade, padrões de distribuição e conservação dos peixes

da Caatinga. In: LEAL, I.R.; TABARELLI, M.; SILVA, J.M.C. (Eds.). Ecologia e

conservação da Caatinga, Editora Universitária, Recife, 2003. p. 135-180.

ROSENBERG, Michael S. Fiddler crab claw shape variation: a geometric morphometric

analysis across the genus Uca (Crustacea: Brachyura: Ocypodidae). Biological Journal

of the Linnean Society, v. 75, n. 2, p. 147-162, 2002.

RUFINO, Marta M.; ABELLÓ, Pere; YULE, Andrew B. Geographic and gender shape

differences in the carapace of Liocarcinus depurator (Brachyura: Portunidae) using

geometric morphometrics and the influence of a digitizing method. Journal of Zoology,

v. 269, n. 4, p. 458-465, 2006.

SCALICI, M.; GIBERTINI, G. Sexual dimorphism and ontogenetic variation in the

carapace of A. pallipes (Lereboullet, 1858). Italian Journal of Zoology, v. 76, n. 2, p.

179-188, 2009.

SCHEINER, Samuel M. Genetics and evolution of phenotypic plasticity. Annual review

of ecology and systematics, v. 24, n. 1, p. 35-68, 1993.

SCHLUTER, Dolph. Ecology and the origin of species. Trends in ecology & evolution,

v. 16, n. 7, p. 372-380, 2001.

45

SHINE, Richard. Ecological causes for the evolution of sexual dimorphism: a review of

the evidence. The Quarterly Review of Biology, v. 64, n. 4, p. 419-461, 1989.

SHORT, J. W. A revision of Australian river prawns, Macrobrachium (Crustacea:

Decapoda: Palaemonidae). Hydrobiologia, v. 525, n. 1-3, p. 1-100, 2004.

SIDLAUSKAS, Brian L.; MOL, Jan H.; VARI, Richard P. Dealing with allometry in

linear and geometric morphometrics: a taxonomic case study in the Leporinus

cylindriformis group (Characiformes: Anostomidae) with description of a new species

from Suriname. Zoological Journal of the Linnean Society, v. 162, n. 1, p. 103-130,

2011.

SILVA, Inês C. et al. Population differentiation of the shore crab Carcinus maenas

(Brachyura: Portunidae) on the southwest English coast based on genetic and

morphometric analyses. Scientia Marina, v. 74, n. 3, p. 435-444, 2010.

SLATKIN, Montgomery. Ecological causes of sexual dimorphism. Evolution, p. 622-

630, 1984.

SPAARGAREN, D. H. Shape and hydrodynamic properties in relation to size in marine

macro-Crustacea. Crustaceana, v. 72, n. 2, p. 203-214, 1999.

STREISSL, Franz; HÖDL, Walter. Growth, morphometrics, size at maturity, sexual

dimorphism and condition index of Austropotamobius torrentium

Schrank. Hydrobiologia, v. 477, n. 1, p. 201-208, 2002.

TORRES, María Victoria; COLLINS, Pablo Agustín; GIRI, Federico. Morphological

variation of freshwater crabs Zilchiopsis collastinensis and Trichodactylus borellianus

(Decapoda, Trichodactylidae) among localities from the middle Paraná River basin

during different hydrological periods. ZooKeys, n. 457, p. 171, 2014.

TURCHETTO‐ZOLET, A. C. et al. Phylogeographical patterns shed light on

evolutionary process in South America. Molecular Ecology, v. 22, n. 5, p. 1193-

1213, 2012.

VALENCIA, Diego M.; CAMPOS, Martha R. Freshwater prawns of the genus

Macrobrachium Bate, 1868 (Crustacea: Decapoda: palaemonidae) of

Colombia. Zootaxa, v. 1456, p. 1-44, 2007.

VERA-SILVA, Ana Luiza; CARVALHO, Fabrício L.; MANTELATTO, Fernando L.

Distribution and genetic differentiation of Macrobrachium jelskii (Miers, 1877)

(Natantia: Palaemonidae) in Brazil reveal evidence of non-natural introduction and

cryptic allopatric speciation. Journal of Crustacean Biology, v. 36, n. 3, p. 373-383,

2016.

46

VOGT, Guenter. Abbreviation of larval development and extension of brood care as key

features of the evolution of freshwater Decapoda. Biological Reviews, v. 88, n. 1, p. 81-

116, 2012.

WALDMAN, John R.; GROSSFIELD, Joseph; WIRGIN, Isaac. Review of stock

discrimination techniques for striped bass. North American Journal of Fisheries

Management, v. 8, n. 4, p. 410-425, 1988.

WARREN, Dan L.; GLOR, Richard E.; TURELLI, Michael. ENMTools: a toolbox for

comparative studies of environmental niche models. Ecography, v. 33, n. 3, p. 607-611,

2010.

WERNER, Earl E.; PEACOR, Scott D. A review of trait‐mediated indirect interactions

in ecological communities. Ecology, v. 84, n. 5, p. 1083-1100, 2003.

WHITMAN, D. W.; AGRAWAL, A. A. What is phenotypic plasticity and why is it

important? In: WHITMAN, D.W.; ANANTHAKRISHNAN, T.N. (Eds.) Phenotypic

Plasticity of Insects: Mechanisms and Consequences, Scientific Publishers, Enfield,

2009. p. 1-63.

WILDERM. N., SUBRAMONIAM, T.; AIDA K. Yolk proteins of Crustacea. In:

RAIKHEL, A. S.; SAPPINGTON, T. W. (Eds.). Reproductive Biology of Invertebrates

Vol XIIA Progress in Vitellogenesis, Science Publishers, Enfield, 2002. p. 131-174.

Williams, A. B. Shrimps, lobsters and crabs of the Atlantic coast of the eastern

United States, Maine to Florida. Smithsonian Institution Press, Washington, 1984.

WINDIG, JACK. J., DE KOVEL, C. G. F.; DE JONG, G. Genetics and mechanics of

plasticity. In: DEWITT, T.J.; SCHEINER, S.M. (Eds.). Phenotypic Plasticity:

Functional and Conceptual Approaches, Oxford University Press, Oxford, 2004. p. 31-

49

WINTERHALTER, Wade E.; MOUSSEAU, Timothy A. Patterns of phenotypic and

genetic variation for the plasticity of diapause incidence. Evolution, v. 61, n. 7, p. 1520-

1531, 2007.

ZIMMERMANN, Gabrielle et al. Geometric morphometrics of carapace of

Macrobrachium australe (Crustacea: Palaemonidae) from Reunion Island. Acta

Zoologica, v. 93, n. 4, p. 492-500, 2012.

47

TABLES

Table 1 Selected locations in ecoregions Maranho Piauí, Mid-Northeast Caatinga and São Francisco to assess the abstraction of form prawn Macrobrachium jelskii (Miers, 1877) with description about the river/stream, basin and hydrodynamics. Long - Longitude; Lat - Latitude; N - abundance (males - M and females - F); n – number corresponding to the voucher deposited in the carcinological collection (GEEFAA-UFRN).

Description of sample area Basin Ambient Long Lat n N Apodi river downstream of the barrage of Santa Cruz, RN. Apodi-Mossoró Lotic -37.772 -5.6582 114 F(30) M(29)

Rio do Carmo downstream of Upanema, RN. Apodi-Mossoró Lotic -37.291 -5.5411 115 F(28) M(28)

Reservoir on the river Umbuzeiro, CE. Jaguaribe Lentic -40.125 -6.6019 118 F(29) M(29)

Umbunzeiro river downstream of the barragem of São Nicolau, CE. Jaguaribe Lotic -40.08 -6.6802 120 F(28) M(30)

Jaguaribe river, CE. Jaguaribe Lotic -39.91 -6.542 122 F(30) M(30)

Orós reservoir, CE. Jaguaribe Lentic -38.913 -6.2386 124 F(30) M(30)

Jucá stream, CE. Jaguaribe Lotic -40.134 -6.3486 131 F(30) M(29)

Paraíba river, PB. Paraíba do Norte Lotic -35.999 -7.5292 133 M(22)

Epitácio Pessoa reservoir, PB. Paraíba do Norte Lentic -36.123 -7.4866 135 F(30) M(18)

Piranhas river, RN. Piranhas-Açu Lotic -37.355 -6.3779 139 F(26) M(30)

Downstream of Carnaúba barrage, RN. Piranhas-Açu Lentic -37.149 -6.6291 140 F(29) M(27)

Mel stream, PE. São Francisco Lentic -37.371 -8.4173 150 F(30) M(28)

Pajeú river downstream of the Jazido barrage, PE. São Francisco Lotic -38.245 -8.0005 151 F(29) M(13)

São Francisco river, PE. São Francisco Lotic -40.578 -9.4533 155 F(30) M(28)

Varzinha reservoir, PE. São Francisco Lentic -38.12 -8.033 186 F(30) M(30)

Piauí river, PI. Parnaíba Lotic -42.236 -8.3668 880 F(31) M(17)

Piauí river on the Jenipapo reservoir, PI Parnaíba Lotic -42.165 -8.4538 881 F(29) M(29)

Canindé river downstream of barrage of Pedra Rodada, PI. Parnaíba Lotic -41.991 -7.975 882 F(29) M(28)

States: RN – Rio Grande do Norte, CE – Ceará, PB – Paraíba, PE – Pernambuco, PI – Piauí.

48

Table 2 Morphological descriptions of the landmarks of specimens of Macrobrachium jelskii (Miers, 1877) to the body plans: lateral cephalothorax (LC), lateral of second abdominal somite (LSAS) and external face of cheliped (EFC).

Landmark Descriptions

LC

1 Distal margin of rostral spine

2 Distal margin of adrostral carena

3 Proximal margin of adrostral carena

4 Intersection between dorsal margin and posterior margin

5 Maximum curvature of posterior margin

6 Intersection posterior margin and ventral margin

7 Maximum curvature of the transverse plane of the brachial region

8 Intersection between ventral margin and anterior margin

9 Depression below the antennal spine in the coronal plane

10 Rostral spine apex

11 Orbital curvature

12 Distal margin of the last inferior rostral tooth

LSAS

1 Intersection of anterior margin and dorsal margin

2 Intersection between dorsal margin and posterior margin

3 Depression in the anterior coronal plane constriction

4 Depression in the posterior coronal plane constriction

5 Maximum anterior curvature in the inferior margin of the pleura

6 Intersection of anterior margin and ventral margin

7 Intersection between ventral margin and posterior margin

8 Maximum posterior curvature in the inferior margin of the pleura

EFC

1 Fixed finger apex

2 Posterior depression to fixed finger apex

3 Maximum curvature in the ventral margin of the distal portion of fixed finger

4 Maximum medial curvature between dorsal margin of fixed dactyl and anterior margin of palm

5 Intersection of anterior margin and dorsal margin

6 Dorsal point in the transversal plane of the palm

7 Maximum curvature between the dorsal margin and posterior margin

8 Point at the posterior margin in the medial line

9 Maximum curvature between the posterior margin and ventral margin

10 Central point in the transversal plane of the palm

11 Ventral point in the sagittal plane to the articulation of fixed dactyl

12 Ventral point in the transversal plane of fixed dactyl

49

Table 3 Statistical results of the discriminant function analysis and cross-validation matrix for the hypothesis of sexual differences (M - male, F - female) in the species Macrobrachium jelskii (Miers, 1877) to the body plans: lateral carapace (LC), lateral of second abdominal somite (LSAS) and external face of cheliped (EFC). Pcr – Procrustes distance, %AC – percentual assimilation correct of cross-validation matrix. Values in bold indicate statistical significance (p <0.05).

LC

Statistic Cross-validation Matrix

Pcr 0.0392 F M Total %CA

Pcr (p-value) <0.0001 F 459 57 516 88.95

T-square 1534.090 M 52 397 449 88.42

T-square (p-value) <0.0001

LSAS

Pcr 0.0389 F M Total %CA

Pcr (p-value) <0.0001 F 387 104 491 78.82

T-square 763.2458 M 69 401 470 85.32

T-square (p-value) <0.0001

EFC

Pcr 0.0098 F M Total %CA

Pcr (p-value) <0.0001 F 364 97 461 78.96

T-square 522.1589 M 119 324 443 73.14

T-square (p-value) <0.0001

50

Table 4 Statistical results of the discriminant function analysis and cross-validation matrix for the hypothesis of hydrodynamic differences (LENT - lentic, LOT - lotic) in the species Macrobrachium jelskii (Miers, 1877) to the body plans: lateral carapace (LC), lateral of second abdominal somite (LSAS) and external face of cheliped (EFC). Pcr – Procrustes distance, %AC – percentual assimilation correct of cross-validation matrix. Values in bold indicate statistical significance (p <0.05).

LC

Statistic Cross-validation Matrix

Pcr 0.0091 LENT LOT Total %CA

Pcr (p-value) 0.0001 LENT 227 113 340 66.76

T-square 195.0673 LOT 223 402 625 64.32

T-square (p-value) <0.0001

LSAS

Pcr 0.0083 LENT LOT Total %CA

Pcr (p-value) 0.0115 LENT 209 103 339 61.65

T-square 101.6071 LOT 244 378 622 60.77

T-square (p-value) <0.0001

EFC

Pcr 0.0112 LENT LOT Total %CA

Pcr (p-value) <0.0001 LENT 215 111 326 65.95

T-square 356.6289 LOT 138 440 578 76.12

T-square (p-value) <0.0001

51

Table 5 Statistical results of the canonical variate analysis to the body plans (lateral carapace - LC, lateral of second abdominal somite - LSAS and external face of cheliped - EFC) between populations of prawn Macrobrachium jelskii (Miers, 1877) (APO - Apodi-Mossoró, JAG - Jaguaribe, RIP - Piranhas-Açu, GNP - Parnaíba, PNORT - North Paraiba, SFR - San Francisco). CVs - axis of CVA, Eigenvalues CumVar (%) - Cumulative Variance Percentage of CVs, Pcr – Procrustes distance. Values in bold indicate statistical significance (p <0.05).

LC

CVs Eig % Var %

CumVar p-

value/Pcr APO JAG PIR PNB PNORT SFR

1 0.554 46.95 46.95 APO 0.019 0.0234 0.0174 0.0191 0.0158

2 0.300 25.40 72.35 JAG <0.0001 0.0293 0.0211 0.0194 0.0124

3 0.159 13.46 85.81 PIR <0.0001 <0.0001 0.0175 0.0259 0.0213

4 0.121 10.23 96.04 PNB <0.0001 <0.0001 <0.0001 0.0221 0.0111

5 0.047 3.96 100.00 PNORT <0.0001 <0.0001 <0.0001 <0.0001 0.0164

SFR <0.0001 <0.0001 <0.0001 <0.0001 <0.0001

LSAS

APO JAG PIR PNB PNORT SFR

1 0.142 36.57 36.57 APO 0.0165 0.0218 0.0176 0.0272 0.0179

2 0.103 26.61 63.19 JAG 0.0024 0.0229 0.0112 0.0201 0.0098

3 0.073 18.71 81.90 PIR 0.0002 <0.0001 0.0213 0.0276 0.0196

4 0.041 10.68 92.58 PNB 0.0026 0.0265 <0.0001 0.0213 0.0116

5 0.029 7.42 100.00 PNORT <0.0001 0.0014 <0.0001 0.0006 0.0207

SFR 0.0012 0.0455 0.0003 0.0327 0.0011

EFC

APO JAG PIR PNB PNORT SFR

1 0.465 44.59 44.59 APO 0.0089 0.0216 0.0093 0.0085 0.0145

2 0.313 30.00 74.59 JAG <0.0001 0.0158 0.0099 0.0096 0.0082

3 0.136 13.02 87.61 PIR <0.0001 <0.0001 0.0192 0.022 0.0103

4 0.083 7.95 95.56 PNB <0.0001 <0.0001 <0.0001 0.0099 0.0117

5 0.046 4.44 100.00 PNORT <0.0001 <0.0001 <0.0001 <0.0001 0.0135

SFR <0.0001 <0.0001 <0.0001 <0.0001 <0.0001

52

FIGURES

Fig. 1 Sample locations of the prawn Macrobrachium jelskii (Miers, 1877) with representations of the basins, ecoregions (Proposed by Albert & Reis 2011) and hydrodynamic regimes. Symbol "X" inside circle represent the locations selected for abstraction of form.

53

Fig. 2 Macrobrachium jelskii (Miers, 1877). Representation of landmarks in each body structure plan, adjusting Procrustes and graphics like 'wireframe' from landmarks coordinates. (a) lateral of the cephalotorax - LC, (b) the lateral of the second abdominal somite - LSAS, (c) the external face of cheliped - EFC.

54

Fig. 3 Multivariate regression of the form (scores regression in procrustes coordenate) by size (centroid size) highlighting the shape variation in centroid sizes. (a) lateral of the cephalotorax - LC, (b) the lateral of the second abdominal somite - LSAS, (c) the external face of cheliped - EFC.

55

Fig. 4 Principal components analysis of the shape to the lateral plane lateral of the cephalotorax (LC) of prawn Macrobrachium jelskii (Miers, 1877), (a) sexual dimorphism (b) hydrodynamics, (c) population variations and (d) deforming grids for each principal component.

56

Fig. 5 Principal components analysis of the shape to the lateral of the second abdominal somite (LSAS) of prawn Macrobrachium jelskii (Miers, 1877) (a) sexual dimorphism (b) hydrodynamics, (c) population variations and (d) deforming grids for each principal component.

57

Fig. 6 Principal component analysis of the variation in shape to the external face of cheliped (FEQ) of prawn Macrobrachium jelskii (Miers, 1877) (a) sexually dimorphic (b) hydrodynamic (c) population variations and (d) deforming grids for each principal component.

58

Fig. 7 Comparison of body shape and frequencies from discriminant function analysis for the hypothesis of sexual diferences (males and females) in the morphological struture of (a) lateral of the cephalotorax - LC, (b) the lateral of the second abdominal somite - LSAS, (c) the external face of cheliped - EFC.

59

Fig. 8 Comparison of body shape and frequencies from discriminant function analysis for the hypothesis of hydrodinamic diferences (lentic and lotic) in the morphological struture of (a) lateral of the cephalotorax - LC, (b) the lateral of the second abdominal somite - LSAS, (c) the external face of cheliped - EFC.

60

Fig. 9 Scatterplot of shape canonical variables analysis and deforming grids for each axis of canonical variable (CV) of the lateral of the cephalotorax (LC) between populations (APO - Apodi-Mossoró, JAG - Jaguaribe, PIR - Piranhas-Açu, PNB- Parnaíba, PNORT – Paraíba do Norte, SFR - São Francisco) of prawn Macrobrachium jelskii (Miers, 1877). Consensus - Moderate form from Procrustes adjustment.

61

Fig. 10 Scatterplot of shape canonical variables analysis and deforming grids for each axis of canonical variable (CV) of the lateral of the second abdominal somite (LSAS) between populations (APO - Apodi-Mossoró, JAG - Jaguaribe, PIR - Piranhas-Açu, PNB- Parnaíba, PNORT – Paraíba do Norte, SFR - São Francisco) of prawn Macrobrachium

jelskii (Miers, 1877). Consensus - Moderate form from Procrustes adjustment.

62

Fig. 11 Scatterplot of shape canonical variables analysis and deforming grids for each axis of canonical variable (CV) of the external face of cheliped (EFC) between populations (APO - Apodi-Mossoró, JAG - Jaguaribe, PIR - Piranhas-Açu, PNB- Parnaíba, PNORT – Paraíba do Norte, SFR - São Francisco) of prawn Macrobrachium

jelskii (Miers, 1877). Consensus - Moderate form from Procrustes adjustment.

63

Fig. 12 Dendogram resulting from cluster analysis with procrustes distance values between populations (APO - Apodi-Mossoró, JAG - Jaguaribe, PIR - Piranhas-Açu, PNB - Parnaíba, PNORT – Paraíba do Norte, SFR - São Francisco) showing of shape struture of populations for (a) lateral of the cephalotorax - LC, (b) the lateral of the second abdominal somite - LSAS, (c) the external face of cheliped - EFC. CCC - cophenetic correlation coefficient.

64

3. CAPÍTULO II: Evidência genética de introdução do camarão

Macrobrachium jelskii (Miers, 1877) (Caridea: Palaemonidae) nas bacias do

Nordeste brasileiro e a implicação de pseudogenes mitocondriais em estudos

moleculares de crustáceos

Sávio A. S. N. Moraes1*; Ghennie T. R. Rey2,3; Sergio M. Q. Lima4; Fúlvio A. M.

Freire1

1Grupo de Estudos em Ecologia e Fisiologia de Animais Aquáticos, Departamento de

Zoologia e Botânica, Centro de Biociências, Universidade Federal do Rio Grande do

Norte, Rio Grande do Norte, Brasil 2Laboratório de Biodiversidade Molecular, Departamento de Genética, Instituto de

Biologia, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brasil 3Departamento de Ciencias Biológicas, Universidad de Caldas, Manizales, Colombia 4Laboratório de Ictiologia Sistemática Evolutiva, Departamento de Zoologia e Botânica,

Centro de Biociências, Universidade Federal do Rio Grande do Norte, Rio Grande do

Norte, Brasil

Autor correspondente: fulvio@cb.com.br

65

Evidência genética de introdução do camarão Macrobrachium jelskii (Miers, 1877)

(Caridea: Palaemonidae) nas bacias do Nordeste brasileiro e a implicação de

pseudogenes mitocondriais em estudos moleculares de crustáceos

Sávio A. S. N. Moraes1*; Ghennie T. R. Rey2,3; Sergio M. Q. Lima4; Fúlvio A. M.

Freire1

1Grupo de Estudos em Ecologia e Fisiologia de Animais Aquáticos, Departamento de

Zoologia e Botânica, Centro de Biociências, Universidade Federal do Rio Grande do

Norte, Rio Grande do Norte, Brasil 2Laboratório de Biodiversidade Molecular, Departamento de Genética, Instituto de

Biologia, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brasil 3Departamento de Ciencias Biológicas, Universidad de Caldas, Manizales, Colombia 4Laboratório de Ictiologia Sistemática Evolutiva, Departamento de Zoologia e Botânica,

Centro de Biociências, Universidade Federal do Rio Grande do Norte, Rio Grande do

Norte, Brasil

Autor correspondente: fulvio@cb.com.br

Resumo

Macrobrachium jelskii é uma espécie de ampla distribuição na América do Sul, contudo

há evidências de introdução desta espécie em corpos d’água, principalmente no Nordeste

do Brasil. O presente visou sanar os questionamentos sobre a naturalidade das ocorrências

do M. jelskii no Nordeste brasileiro. Foram extraídas, amplificadas e sequenciadas

amostras das bacias de Apodi-Mossoró, Jaguaribe, Piranhas-Açú, Paraíba do Norte, São

Francisco e Parnaíba, pertencentes a três ecorregiões distintas. A inferência filogenética

bayesiana revelou monofiletismo entre as linhagens da espécie M. jelskii, com baixa

divergência genética. As estimativas de estruturação populacional indicam uma baixa

diversidade haplotípica e diversidade nucleotídica média, corroborando a hipótese de

introdução não-natural por ações do Departamento de Obras Contra a Seca. Nos

eletroferogramas obtidos com os iniciadores universais para o gene COI foram

observados alguns picos duplos e muito ruído, provavelmente resultado da co-

amplificação de pseudogenes mitocondriais. Ressalta-se a importância de iniciadores

66

específicos e cuidado em analisar dados de crustáceos, que já apresentam casos de co-

amplificação documentado.

Palavras-chaves: camarão-sossego, Decapoda, NuMts, distribuição geográfica,

Caatinga semiárida.

3.1.INTRODUÇÃO

Os camarões de água doce do gênero Macrobrachium Spence Bate, 1868 tem

distribuição espacial pan-tropical (DE GRAVE; CAI; ANKER, 2008; VALÊNCIA;

CAMPOS, 2007). Das espécies que possuem ampla distribuição geográfica, podemos

citar a espécie Macrobrachium jelskii. Aespécie foi descrita, inicialmente, como

Palaemon jelskii por Miers (1877), coletado pelo naturalista Konstanty Jelski em 1965 na

localidade-tipo no rio Oyapock (Oiapoque), Guiana Francesa e, encontrado em simpatria

com M. amazonicum. Uma ampla gama da literatura defende a distribuição natural de M.

jelskii, nas bacias do rio Amazonas e Orinoco (BASTOS; PAIVA, 1959; COLLINS,

2000; HOLTHUIS, 1950, 1966). Porém, algumas literaturas são muito abrangentes

quanto à distribuição citando a América do Sul como distribuição natural (COELHO;

RAMOS-PORTO, 1985; MAGALHÃES et al., 2005; MELO, 2003; RODRÍGUEZ,

1981).

Muitas espécies congêneres, que apresentam distribuições geográficas extensas na

América do Sul, como M. jelskii, demostraram estruturação genética entre clados bacias

costeiras e continentais, mas com baixas distâncias gênica entre grupos (CARVALHO;

PILEGGI; MANTELATTO, 2013; VERGAMINI; PILEGGI; MANTELATTO, 2011).

Todavia, algumas espécies com ampla distribuição geográfica levam ao questionamento

sobre a ocorrência natural em algumas áreas, como a espécie M. amazonicum (Heller,

1862), devido as ações governamentais de transferência de espécimes de peixes e

crustáceos. Gurgel e Oliveira (1987) afirmam que entre 1933 e 1985 o Departamento de

Obras Contra a Seca (DNOCS) introduziu M. amazonicum (Heller, 1862), M. acanthurus

(Wiegmann, 1836), M. jelskii e outras 39 espécies de peixes nos açudes, rios e riachos do

nordeste brasileiro, para incentivar a atividade de pesca comercial e de subsistência das

comunidades do semiárido. Relatam ainda, que ao capturarem as matrizes de M.

amazonicum perceberam que foram ineficientes em triar os espécimes de M. jelskii que

67

co-habitavam o mesmo habitat, sendo estes introduzidos juntamente com o camarão-

canela. No entanto, os mesmos autores afirmaram que os camarões M. jelskii já era nativa

das bacias do Nordeste brasileiro. Mas, nenhum estudo prévio ou material referencial é

citado, e, portanto, sua ocorrência prévia inconclusiva.

Excetuando-se os indícios de introdução não-natural, as relações evolutivas de

organismos de água doce podem ser reflexo de conexões pretéritas entre bacias, por

paleo-canais nas regressões do nível do mar durante o Pleistoceno (TURCHETTO-

ZOLET et al., 2012), ou aos ajustes neotectônicos (e. g. captura de cabeceiras) (ALBERT;

REIS, 2011). Estudos dos crustáceos continentais, no Nordeste brasileiro, podem elucidar

se a ocorrência de algumas espécies é natural ou resultado da intervenção antrópica. Com

isso, pode-se validar o estado da arte da diversidade das bacias do nordeste brasileiro que

representam um vale no conhecimento biológicos e eco-evolutivo. Deste modo, é possível

entender os processos que possam ter influenciado a diversidade biológica em uma escala

de tempo recente (e. i. composição de comunidades), como uma escala de tempo

geológica (i. e. linhagens evolutivas), devido a eminente transposição de águas da bacia

do rio São Francisco para as bacias do Nordeste Médio-Oriental: dos rios Jaguaribe,

Piranhas-Açu, Apodi-Mossoró e Paraíba do Norte (GRANT et al., 2012; MEADOR,

1992; PITTOCK; MENG; CHAPAGAIN, 2009). Com isso, linhagens isoladas podem ter

seu fluxo gênico reestabelecido, (BLANCO et al., 2009; PERES et al., 2012), o que pode

resultar na perda de adaptações locais, e, consequente, a perda da diversidade

(BELLAFRONTE et al., 2010; GRANT et al., 2012).

Abordagens utilizando dados moleculares tem progredido consideravelmente, e

contribuído para a compreensão de processos de dispersão, vicariância e especiação

inerentes a diversificação de linhagens evolutivas, possibilitando o desenvolvimento de

métodos e técnicas para caracterizar geneticamente os taxa (FREELAND, 2005;

TENEVA, 2009). Como marcador molecular mitocondrial (mtDNA), podemos destacar

o gene Citocromo Oxidase I (COI), caracterizado pelo amplo polimorfismo

intraespecífico, elevada taxa de mutação e herança uniparental, utilizado em diversos

estudos, incluindo filogeografia, reconstrução de história demográfica e diversificação

(LEITE, 2012).

Apesar da utilização do versátil do gene mitocondrial COI em uma miríade de

resoluções filogenéticas e filogeográficas, dados genéticos devem ser manuseados e

inspecionados com cuidado, ressaltando presença de pseudogenes no processo de

68

amplificação e sequenciamento. Também conhecidos como DNA mitocondrial nuclear

(NuMts), estes caracterizam-se por serem cópias não funcionais de sequências

mitocondriais incorporadas ao genoma nuclear (BALDO et al., 2011; BENSASSON et

al., 2001; KIM; LEE; JU, 2013; LEITE, 2012; LOPEZ et al., 1994).

Esta transferência de genes mitocondriais ao DNA nuclear, em procariontes, pode

ocorrer através de transferência direta ou mediada por RNAs (viral) (D'ERRICO;

GADALETA; SACCONE, 2004; FRÉZAL; LEBLOIS, 2008; SONG et al., 2008;

WILLIAMS; KNOWLTON, 2001). No caso de eucariontes, pode ocorrer durante a

reprodução, em que pode haver uma falha na eliminação das mitocôndrias paternas

durante a fecundação (i. e. introgressão), havendo a formação do zigoto com mitocôndrias

maternas e paternas (HAZKANI-COVO; ZELLER; MARTIN, 2010). Quando

transferidos para o núcleo, o gene mitocondrial perde sua função original, e torna-se um

pseudogene, passando a acumular mutações (GAZIEV; SHAIKHAEV, 2010;

STRUGNELL; LINDGREN, 2007).

Os pseudogenes são difíceis de serem identificados pelas semelhanças estruturais

com o gene original, mas podem não ter códon de terminação, íntros ou regiões controle,

e assim não traduzem proteínas funcionais (D'ERRICO; GADALETA; SACCONE,

2004; GERSTEIN; ZHENG, 2006). Estes ocorrem em maior frequência em procariotos,

originados por erros no processo de transcrição, mas podem ser detectados em vários

grupos de eucariotos (ARTHOFER et al., 2010; BENSASSON et al., 2001; DEN TEX et

al., 2010; RICHLY; LEISTER, 2004; SUNNUCKS; HALES, 1996; TIMMIS et al.,

2004).

A integração de uma cópia de um gene mitocondrial ao genoma nuclear é evidente

em mais de 70 espécies de crustáceos, dentre eles decápodes dos gêneros Austinograea

Hessler & Martin, 1989 (KIM; LEE; JU, 2013), Cardisoma Latreille in Latreille, Le

Peletier, Serville & Guérin, 1828 e Geryon Krøyer, 1837 (SCHUBART, 2009), Cherax

Erichson, 1846 (NGUYEN; MURPHY; AUSTIN, 2002), Orconectes Cope, 1872 (SONG

et al., 2008), Alpheus Fabricius, 1798 (WILLIAMS; KNOWLTON 2001; WILLIAMS et

al., 2001), Lysmata Risso, 1816 (BAEZA; FUENTES, 2013) e Macrobrachium (LIU;

CAI; TZENG, 2007). Apesar de apenas um trabalho reportar tal fenômeno, existe uma

gama expressiva de estudos filogenéticos e filogeográficos com camarões do gênero

Macrobrachium (GUERRA et al., 2014; MACIEL et al., 2011; PILEGGI;

MANTELATTO, 2010; ROSSI; MANTELATTO, 2013; VERGAMINI; PILEGGI;

69

MANTELATTO, 2011) que possivelmente tenham se deparado com isto ou não tenham

atentado para esta singularidade.

Deste modo, o presente estudo visou entender a estruturação genética, verficou a

distribuição geográfica do M. jelskii no Nordeste brasileiro é natural ou foi um evento de

introdução por ação antrópica. Além disso, reportou a presença de NuMts e suas

implicações aos estudos que utilizem dados moleculares.

3.2.MATERIAL E MÉTODOS

3.2.1. Coleta de dados

Foram amostrados exemplares de M. jelskii entre os meses de março de 2012 e

abril de 2013, realizadas com o uso de vários apetrechos de pesca: peneiras, redes de

arrasto (10m de comprimento; 1,5m de altura; 0,5 distância entre nós), tarrafa, covos,

seguindo o método RAP (Rapid Assesment Program), com avaliação dos apetrechos que

podem ser empregados de acordo com as características de cada local de coleta. Para as

análises moleculares foram utilizados tecidos (músculo) fixados em álcool 96%, de

preferencialmente dez (10) exemplares de cada bacia. As coletas abrangeram as bacias

do rio Parnaíba (PNB) da ecorregião do Maranhão-Piauí, do rio Apodi-Mossoró (APO),

Piranhas-Açú (PIR), Jaguaribe (JAG), Paraíba do Norte (PNORT), da ecorregião do

Nordeste Médio-Oriental; e São Francisco (SFR) da ecorregião homônima (Figura 1).

Todos os espécimes foram identificados de acordo com os caracteres

morfológicos e merísticos de suas descrições na literatura (GARCÍA-DÁVILA;

MAGALHÃES, 2003; HOLTHUIS, 1959; MELO, 2003).

3.2.2. Extração, amplificação e verificação das sequências de DNA

A sequência mitocondrial do gene Citocromo Oxidase Sub-unidade I (COI) foi

obtida através do protocolo de extração com cloreto de sódio (modificado de MILLER;

DYKES; POLESKY, 1988). Um fragmento de tecido muscular de aproximadamente 20

mg foi homogeneizado em 500μL de tampão de lise (Tris HC 50mM, EDTA 50mM, SDS

1%, NaCl 50mM, pH 8,0) com 60μg de proteinase K e incubado a 55°C, durante no

mínimo três horas até a digestão completa do tecido. Após isso, os restos celulares foram

70

estratificados pela centrifugação a 14.000rpm (12.000g) por 15min. Para a precipitação

das proteínas, pela menor solubilidade em altas concentrações salinas, foi adicionado ao

sobrenadante 300μL de NaCl (5M) seguido de centrifugação a 14.000rpm durante 15min.

O material extraído, 500μL do sobrenadante, foi transferido a um novo tubo,

adicionando 500μL isopropanol absoluto gelado e, armazenado durante duas horas a -

20°C para a otimização do processo de precipitação. Após isso, foi homogeneizado foi

centrifugado a 14.000rpm por 15min completando a precipitação do material. Em

seguida, para diminuição da salinidade, o pellet de DNA formado foi lavado duas vezes

com 750μL de etanol 70% (v/v) gelado e centrifugado a 14.000rpm por 5min.

Subsequentemente, o pellet foi seco a 15°C por 15min a vácuo (Concentrator plus,

Eppendorf) e ressuspendido em 50μL de água destilada. O material genético foi

quantificado em nanofotômetro (Implen®) e todas as amostras foram normalizadas para

uma concentração aproximada de 30ng/μL e armazenados a -20°C.

A amplificação e identificação das sequências dos marcadores mitocondriais

podem ser prejudicadas pela co-amplificação ou amplificação preferencial de cópias de

regiões mitocondriais dentro do genoma nuclear (NuMts Nuclear Mitochondrial DNA

sequence), fenômeno comum em crustáceos (BUHAY, 2009; SCHUBART, 2009;

WILLIAMS; KNOWLTON, 2001). Assim, foi realizada uma análise preliminar para

avaliar a qualidade das sequências obtidas com dois pares de iniciadores para o fragmento

do extremo 3ˈ do gene mitocondrial da citocromo oxidase I (COI).

Para esta avaliação, foram usados os iniciadores universais COIf e COIa

desenvolvidos por Palumbi e Benzie (1991) e os iniciadores COL8 e COH1b

desenvolvidos por Schubart (2009) especificamente para decápodes (Tabela 1). Para às

análises foram empregados nove indivíduos de localidades diferentes (CRT2329,

CRT2343, CRT2365, CRT2402, CRT2410, CRT2431, CRT2438, CRT2465 e

CRT2517). As reações de amplificação continham aproximadamente 30 ng de gDNA, 1

U de enzima GoTaq Flexi DNA polimerase, 3 μL de tampão Green GoTaq Flexi (5X),

0,2 mM de cada dNTP, 2,5 mM de MgCl2 para as amplificações com COL8/COH1b ou

2,0 mM de MgCl2 para as amplificações com COIf/COIa, e 0,3 μM de cada iniciador em

um volume final de 15 μL. Os parâmetros de termociclagem para as amplificações foram:

um ciclo inicial de desnaturação a 95 °C por 5 minutos, seguido por 35 ciclos de 1 minuto

de desnaturação a 95 °C, anelamento de 40 segundos a 48 °C para COL8/COH1b ou 64

°C para COIf/COIa, e extensão durante 45 segundos a 72 °C, seguidos de uma extensão

71

final de 5 minutos a 72 °C. Os produtos de PCR que continham mais de 40 ng/μL de DNA

foram purificados através do uso de esferas magnéticas com o kit de purificação de

produtos de PCR Agencourt® AMPure® na plataforma epMotion® 5075 (Eppendorf). Os

sequenciamentos foram realizados no sequenciador automático ABI3500 (Applied

Biosystems), do Laboratório de Biodiversidade Molecular da Universidade Federal do

Rio de Janeiro (LBDM/UFRJ) e a edição dos eletroferogramas foi feita no programa

SeqMan II 4.0. Adicionalmente, uma análise do número de nucleotídeos diferentes entre

as sequências obtidas com os dois pares de iniciadores de cada indivíduo, realizada com

o programa Mega 7 (TAMURA et al., 2007).

Com o intuito de determinar se estavam sendo co-amplificados NuMts com os

iniciadores universais e se a sequência obtida com os iniciadores específicos para

decápodes representava a sequência de origem mitocondrial, foi desenhado um iniciador

específico (COI_MA_R) para os camarões do género Macrobrachium (Tabela 1). O

iniciador foi desenvolvido a partir do alinhamento dos genomas mitocondriais de três

espécies do género disponíveis no GenBank (M. nipponense - NC015073, M. lanchesteri

- NC012217 e M. rosenbergii - NC006880), e encontra-se ancorado no extremo 3ˈ

conservado do gene. As reações de amplificação para os iniciadores COIf / COI_MA_R

foram feitas da maneira descrita anteriormente, porém, empregando 2.5 mM de MgCl2

nas reações, uma temperatura de anelamento de 55 °C por 40 segundos, e uma extensão

de 1 minuto a 72 °C nos 35 ciclos. Posteriormente, as sequências obtidas com

COI_MA_R foram semelhantes a aquelas obtidas com os iniciadores COL8/COH1b,

indicando que estas representam mais provavelmente as sequências de origem

mitocondrial e que as sequências recuperadas com os iniciadores universais podem ser

consideradas como de origem nuclear.

Para a visualização da superestimação de linhagens filogenéticas propiciadas pelo

uso de NuMts em reconstruções filogenéticas, foi utilizado o método de filogenia

Neighbor-Joining utilizando o modelo de substituição de caracteres “Hasegama-Kishino-

Yano” (HKY), indicado pelos os valores dos critérios de AIC (Critério Akaike) e BIC

(Critério Bayesiano), e com 1000 ‘bootstrap’ permutações. Os prováveis dados com

NuMts foram retirados do manuscrito (VERA-SILVA; CARVALHO; MANTELATTO,

2016). Os ‘outgroup’ utilizados estão detalhados na Tabela 2.

72

3.2.3. Inferência filogenética e estruturação genética

Após a edição, as sequências foram alinhadas utilizando o algoritmo Clustal W

presente no programa Mega 7 e inspecionados visualmente e editados, quando necessário.

O Modelo de Verossimilhança da corrida foi ajustado utilizando o programa jModeltest

0.1.1 (POSADA, 2008) os valores dos critérios de AIC e BIC para cada modelo de

substituição de caracteres “Hasegama-Kishino-Yano” (HKY). E para determinação da

burn-in de 10% foi utilizado o Tracer 1.6 (RAMBAUT et al., 2013).

Para representação das relações filogenéticas (genealogia) dos grupos

populacionais e congêneres foi utilizado inferência Bayesiana (mcmc = 10000000)

Análise filogenética por Inferência Bayesiana foi realizada usando o programa BEAST

v. 1.7 (DRUMMOND et al., 2012) com os seguintes parâmetros: sítios = modelo de

substituição de nucleotídeos; relógio molecular = relógio relaxado com distribuição log-

normal; taxa de mutação = 0,014% por MA (KNOWLTON; WEIGHT, 1998). As

sequências de ‘outgroup’ e de M. jelskii (localidade Pereira Barreto, São Paulo, Brasil)

de Citocromo Oxidase subunidade I foram obtidas no GenBank (National Center for

Biotechnology Information, http://www.ncbi.nlm.nih.gov). Os ‘outgroup’ utilizados

estão detalhados na Tabela 2.

Para estimar a variabilidade intraespecífica, os índices de diversidade haplotípica

(h) e nucleotídica (p), com sua variância e desvio padrão, foram obtidos usando o

programa DnaSP 5.1 I (LIBRADO; ROZAS, 2009). E para verificar diferenças entre as

populações/haplótipo foi uma utilizada uma AMOVA (Análise Molecular de Variância)

(Arlequin software v. 3.5; EXCOFFIER; LISCHER, 2010).

3.3.RESULTADOS

Foram extraídos sequencias de 9 exemplares da bacia hidrográfica do Apodi-

Mossoró (Santa Cruz - RN), 10 da bacia Jaguaribe (Orós – CE e Saboeiro – CE), 10 da

bacia Piranhas-Açú (Bonito de Santa Fé – PB e Aparecida – RN), 9 da bacia Paraíba do

Norte (Barra de Santana – PB e Boqueirão – PB), 10 da bacia São Francisco (Buíque –

PE e Ouricuri – PE), e 9 exemplares da bacia do Parnaíba (São João do Piauí – PI) (Tabela

2).

73

Nos eletroferogramas obtidos com os iniciadores universais para o gene (COIf e

COIa) foram observados alguns picos duplos (sobreposição do sinal de fluorescência de

dois nucleotídeos no mesmo sítio) e muito ruído (background) (Figura 2). Já os

eletroferogramas obtidos com os iniciadores específicos para decápodes (COL8/COH1b)

exibiram picos bem definidos com pouco background e não apresentaram sinais de picos

duplos. Os eletroferogramas obtidos com o iniciador COI_MA_R apresentaram pouco

background e não exibiram sinais de picos duplos, enquanto que os eletroferogramas

obtidos com o iniciador COIf apresentaram uma qualidade moderada. Em adição, a

análise do número de nucleotídeos diferentes entre as sequências obtidas com os dois

pares de iniciadores de cada indivíduo revelou que as sequências apresentavam entre 20

e 35 nucleotídeos diferentes, porém nenhuma das sequências exibia códons de parada ou

indels.

A inferência filogenética bayesiana revelou basicamente três clados. O clado I

demostra um grupo polifilético agrupando linhagens de Macrobrachium carcinus

(Linnaeus, 1758) com uma linhagem do M. americanum Spence Bate, 1868, uma relação

monofilética entre as linhagens de M. crenulatum Holthuis, 1950 e M. olfersii

(Wiegmann, 1836), e por fim, um agrupamento monofilético entre as linhagens de M.

heterochirus (Wiegmann, 1836), M. brasiliense (Heller, 1862), M. acanthurus

(Wiegmann, 1836) e Cryphiops caementarius. O clado II mostrou um parafiletismo entre

as linhagens M. jelskii e linhagens de M. ferreirai Kensley & Walker, 1982 e M. borellii

(Nobili, 1896). O clado III mostrou monofiletismo entre as linhagens M. amazonicum

(Figura 2). Sendo possível ratificar também que os exemplares amostrados da espécie

Macrobrachium jelskii representam um clado monofilético suportando as linhagens como

realmente uma única espécie (Figura 3).

As estimativas de estruturação populacional indicam uma baixa diversidade

haplotípica (H = 0,095 ± 0,050) e uma baixa diversidade nucleotídica média (π = 0,0044

± 0,0019) (Tabela 3). Evidenciando diferenças estatísticas apenas nas comparações par-

a-par com as linhagens de bacia do Paraná (Barreto - SP) (p < 0,05). Há um haplótipo

compartilhado entre todas as localidades de cada bacia do Nordeste brasileiro, contudo

apenas um haplótipo exclusivo referente a bacia do rio Paraná-Paraguai.

74

3.4.DISCUSSÃO

Marginalmente ao foco do presente estudo, a inclusão de uma linhagem da espécie

Cryphiops caementarius a um clado de representantes do gênero Macrobrachium ressalta

a questão do parafiletismo do gênero Macrobrachium, representado no clado I, já relatado

por outras abordagens metodológicas e outros marcadores moleculares (CARVALHO;

PILEGGI; MANTELATTO, 2013; MURPHY; AUSTIN, 2005; PEREIRA, 1997;

PILEGGI; MANTELATTO, 2010; PILLEGGI et al., 2014; ROSSI; MANTELATTO,

2013).

O cenário de baixa diversidade haplotípica e baixa diversidade nucleotídica

possivelmente representa o reflexo de um recente episódio de gargalo populacional frente

a uma pressão seletiva ou um cenário de efeito fundador (HARTL, 2008). Casos de

variação genética reduzida podem significar que a população passou por um vale

adaptativo, onde ocorreu a redução drástica do tamanho efetivo populacional. Isto pode

ser causado por diversos fatores, como desastre natural, descontrole no equilíbrio

“bottom-up”, sobreexplotação, perda de habitat e diminuição nas taxas de migração

devido a uma barreira geográfica (RIDLEY, 2006). Isto também pode ser observado em

populações que migraram para um novo habitat (ABDELKRIM et al. 2005) ou em

espécies que foram introduzidas por atividade antrópica (DLUGOSCH; PARKER, 2008;

NOVAK; MACK, 2005; SHIRK et al., 2014; WARES; HUGHES; GROSBERG, 2005).

Geralmente, em espécies que tiveram apenas um evento de introdução não-natural é

observado uma baixa diversidade gênica, em que ocorre o transporte de exemplares de

apenas uma localidade fonte, levando apenas uma pequena parcela do patrimônio

genético da espécie, e introduzido em uma nova área que não possui interligação com o

local de origem (HANDLEY et al., 2011). O presente estudo sugere uma forte evidência

genética de introdução por atividade antrópica devido à baixa diversidade genética

apresentada. O fato citado por Gurgel e Oliveira (1987) de que a espécie já era encontrada

no Nordeste brasileiro, pode ser resultado de erro taxonômico, e/ou, em um cenário

especulativo, a espécie que era nativa foi extinta por exclusão competitiva (BØHN;

AMUNDSEN; SPARROW, 2008) e/ou pela adição de predadores como peixes da espécie

do gênero Cichla Bloch & Schneider, 1801.

O compartilhamento de haplótipo com linhagens de M. jelskii da Bacia do Paraná-

Paraguai pode ser reflexo do transporte da corvina Plagioscion squamosissimus (Heckel,

75

1840) entre os anos 1966 e 1973 (TORLONI et al., 1993), oriundos de reservatórios do

Nordeste do Brasil, uma das espécies que foram introduzidas pelo DNOCS. O segundo

haplótipo, pode representar um evento de introdução acidental não documentado

proveniente da bacia Amazônica ou Orinoco, baseado nos históricos de introdução

ocorridos em reservatórios brasileiros (COLLEN et al., 2003; GURGEL & OLIVEIRA,

1987; TORLONI et al., 1993).

Tais evidências apresentadas anteriormente somadas ao fato de que M. jelskii é

uma das poucas espécies que não dependem de águas salobras ou estuários para completar

seu ciclo de vida, em que as larvas necessitam da salinidade para completar seu

crescimento e metamorfose (HOLTHUIS, 1952). Esses atributos da espécie

provavelmente, contribuíram para a aclimatação de M. jelskii ao clima semiárido da

região, onde a grande maioria dos rios é intermitente e passam por extensos períodos

empoçados e sem continuidade com suas respectivas desembocaduras e estuários (ROSA

et al., 2003). A característica que pode ter reforçado isto, é a abreviação do estágio larval

da espécie, em que, evolutivamente, foi fixado um encurtamento do número de estágio

larvais, resultando em três estágios larvais (2 zoea e 1 pos-zoea), com menor número de

prole, ovos maiores (1,59 – 2,39mm de diâmetro) e grande quantidade de vitelo

(GAMBA, 1980, 1984, 1997; MAGALHÃES, 2000; PAIVA; BARRETO, 1960;

SOARES; OSHIRO; TOLEDO, 2015). Fato contrastante frente às demais espécies de

Macrobrachium, que tem em média de dez estágios larvais, prole grande, ovos pequenos

(0,40 – 1,20mm de diâmetro) e menor quantidade de vitelo (JALIHAL; SANKOLLI;

SHENOY, 1993).

Contudo, um estudo molecular recente, utilizando a região mitocondrial COI, para

entender o padrão de distribuição geográfica de M. jelskii, relatou dois clados, um

representado por uma linhagem Amazônica (Bacias Amazônica, Parnaíba, Piranhas-Açú,

São Francisco, Atlântico Leste e Paraná-Paraguai), e outro clado, representada por uma

linhagem Costeira (somente as bacias do Atlântico Leste), considerando a bacia

Amazônica como fonte (VERA-SILVA; CARVALHO; MANTELATTO, 2016).

Baseado no tempo de divergência e na provável distribuição natural da espécie, os autores

sugerem alguns cenários biogeográficos para explicar a origem dos clados Costeiro e

Amazônico. O primeiro cenário considera a capacidade limitada de M. jelskii de tolerar

ambientes salinos (HOLTHUIS, 1980), sendo o clado Costeiro formado pela dispersão

larval, sugerindo uma provável colonização do tipo ‘stepping-stone’, padrão evidenciado

76

geralmente para espécies estuarinas (HASTINGS; HARRISON, 1994). Todavia, não há

nenhum estudo sobre respostas fisiológicas desta espécie a um gradiente de salinidade. O

segundo cenário é baseado em mudanças climáticas datadas do Plioceno (2-5 Ma) que

teriam causado a confluência dos rios costeiros formando a partir da regressão do nível

do mar por flutuações da temperatura (DWYER; CHANDLER, 2008; PELLEGRINO et

al., 2005). Para o clado Amazônico, devido as estimativas de relógio molecular

demostrando baixa divergência genética, não foi descartada a introdução por atividade

humana, já relatada anteriormente.

As sequências utilizadas por Vera-Silva, Carvalho e Mantelatto (2016) não

puderam ser utilizadas para o presente trabalho, devido a inconsistências nas etapas de

alinhamento e construção da árvore filogenética. Em análise preliminar as linhagens

encontradas neste estudo não se agruparam com as linhagens encontradas no presente

estudo (Figura 3). No presente estudo, a presença de picos duplos no eletroferogramas,

quando são usados os iniciadores universais, sugere a amplificação de diferentes

sequências e, por conseguinte, a co-amplificação, provavelmente, de NuMts (BUHAY,

2009). Por isso, ressaltamos a importância que uma das formas de evitar a co-

amplificação de NuMts é a otimização de iniciadores táxon específicos, já afirmado por

Schubart (2009). Os iniciadores universais COIf/COIa já foram usados em diversos

estudos populacionais e filogenéticos de espécies de camarões do gênero Macrobrachium

(GUERRA et al., 2014; LIU; CAI; TZENG, 2007; MACIEL et al., 2011; PILEGGI;

MANTELATTO, 2010; ROSSI; MANTELATTO, 2013; VERGAMINI; PILEGGI;

MANTELATTO, 2011). Porém, somente um trabalho reportou dificuldades nas

amplificações com esses iniciadores (LIU; CAI; TZENG, 2007).

O fato de que as sequências apresentaram entre 20 e 35 nucleotídeos diferentes,

mas, nenhuma das sequências exibia códons de parada ou indels, sugere um caso de

introgressão. Isto ocorre durante a reprodução, em que pode haver uma falha na

eliminação das mitocôndrias paternas durante a fecundação, havendo a formação do

zigoto com mitocôndrias maternas e paternas (HAZKANI-COVO; ZELLER; MARTIN,

2010). E assim, especula-se que este fenômeno pode ser mais recorrente em crustáceos,

pela característica atípica (não possuem flagelo e imóveis) (MEDINA; RODRÍGUEZ,

1992; TALBOT; SUMMER, 1978) do gameta masculino, tem mitocôndrias localizadas

na zona central próximo à cromatina (DUPRÉ; BARROS, 2011). Provavelmente, no

77

momento da fecundação ocorre alguma anomalia e as mitocôndrias paternas são

transferidas, passando a ser não-funcionais e, portanto, acabam por acumular mutações.

Sabendo que o grau de similaridade entre NuMts e suas contrapartes mitocondriais

varia amplamente, a presença inadvertida de NuMts, em estudos relacionados à evolução

de populações e espécies, pode levar a inferências e reconstruções filogenéticas e

filogeográficas incorretas (SONG et al., 2008). Por exemplo, os NuMts podem

superestimar ou superestimar o número de espécies (SONG et al., 2008) e podem

inclusive incrementar, artificialmente, o nível de diferenciação inferido entre populações

(HLAING et al., 2009). Um exemplo disto, é demostrado em uma compilação de dados

com presença de NuMts, que mostra um viés no número de linhagens filogenéticas

evidenciadas, com dados de gafanhoto dos gêneros Schistocerca Stål, 1873, Calliptamus

Serville, 1831 e Acrida Linnaeus, 1758 relataram uma superestimação de 17 espécies,

sugerindo evidências de 13 espécies crípticas, e com dados de lagostim Orconectes,

relatados 25 espécies, sugerindo mais de 21 espécies crípticas (SONG et al., 2008). O que

foi, possivelmene, evidenciado na reconstrução filogenética utilizando o método de

Neighbor-Joining (Figura 3).

Os indícios, baseados em dados genéticos e dados secundários de ocorrência,

apontam para a introdução não-natural desta espécie no Nordeste brasileiro, mas

assumindo um posicionamento conservador, deve-se investir em marcadores mais

variáveis, ou até uma abordagem multilocus.

Eventos geológicos e climáticos pretéritos aparentam ser menos explicativos

evolutivamente sobre a estruturação genética desta espécie, excetuando assim, eventos

como arranjos neotectônicos (TURCHETTO-ZOLET et al., 2012), captura de cabeceiras

entre 30-40 Ma (LUNDBERG et al., 1998), incursões marinha (confluência das bacias

dos rios Amazonas, Parnaíba, da Plata e São Francisco, datado de 12-20 Ma) (BLOOM;

LOVEJOY, 2011; LIMA; RIBEIRO, 2011; LOVEJOY; BERMINGHAM; MARTIN,

1998; RAMOS; ALEMAN, 2000) e paleo-canais ligação Pleistocênica entre os cursos

d’água dos compartimentos Baturité-Urauçuba (Bacia do Parnaíba) e Jaguaribe-Potiguar

(Bacias Jaguaribe, Apodi-Mossoró e Piranhas-Açú) (BRITO NEVES; DOS SANTOS;

VAN SCHMUS, 2000; CABY; ARTHAUD; ARCHANJO, 1995; CARNEIRO;

HAMZA; ALMEIDA, 1989; PEULVAST et al., 2008). E juntamente com a baixa

diversidade haplotípica e nucleotídica, corroborando com os dados de variação de forma

(abstração da forma de estruturas morfológicas) em que as variações interpopulacionais

78

(diferenças relativas entre bacias hidrográficas) eram menos evidentes que as variações

intrapopulacionais (dimorfismo sexual e variações relacionadas ao hidrodinamismo)

(MORAES et al., submetido). Além disso, Berbel-Filho et al. (2015) para duas espécies

de Ciclidae Bonaparte, 1835 evidenciou uma rede de haplótipos que representa um

cenário de diferenciação incipiente (moderada divergência genética), com algumas

linhagens únicas para as bacias do Apodi- Mossoró, Jaguaribe e Piranhas-Açú.

Considerando a amostragem similar (mesmas bacias hidrográficas) e um panorama geral

de eventos dispersivos e vicariantes influentes em taxa aquáticos, era esperado um padrão

de estruturação genética semelhante ao encontrado por Berbel-Filho et al. (2015).

Agradecimentos

Os autores agradecem ao Conselho Nacional de Desenvolvimento Científico e

Tecnológico (CNPq # 552086 / 2011-8) pelo financiamento do projeto de pesquisa e pelas

bolsas concedidas (Sávio ASN Moraes - CAPES). Aos membros do GEEFAA e LISE no

suporte de atividade de campo e de laboratório. Todo o trabalho de campo foi conduzido

de acordo com as leis ambientais estaduais e federais (Licença de coleta SISBIO-IBAMA

# 28314-1). Ao Prof. Antônio M. Solé-Cava e ao Laboratório de Biodiversidade

Molecular (LBDM UFRJ) pelos procedimentos de extração e sequenciamento. Os

autores declaram não haver conflitos de interesse.

REFERÊNCIAS

ABDELKRIM, Jawad et al. Importance of assessing population genetic structure before

eradication of invasive species: examples from insular Norway rat

populations. Conservation Biology, v. 19, n. 5, p. 1509-1518, 2005.

ALBERT, J. S.; REIS, R. E. Introduction to Neotropical freshwaters. Historical

biogeography of neotropical freshwater fishes, p. 3-19, 2011.

ARTHOFER, Wolfgang et al. Mitochondrial phylogenies in the light of pseudogenes and

Wolbachia: re-assessment of a bark beetle dataset. ZooKeys, v. 56, p. 269, 2010.

BAEZA, J. Antonio; FUENTES, M. Soledad. Exploring phylogenetic informativeness

and nuclear copies of mitochondrial DNA (numts) in three commonly used mitochondrial

genes: mitochondrial phylogeny of peppermint, cleaner, and semi‐terrestrial shrimps

79

(Caridea: Lysmata, Exhippolysmata, and Merguia). Zoological Journal of the Linnean

Society, v. 168, n. 4, p. 699-722, 2013.

BALDO, Laura et al. Nuclear–Mitochondrial sequences as witnesses of past

interbreeding and population diversity in the jumping bristletail

Mesomachilis. Molecular biology and evolution, v. 28, n. 1, p. 195-210, 2011.

BASTOS, J. A. M.; PAIVA, M. P. Notas sobre o consumo de oxigênio do camarão

‘sossêgo’, Macrobrachium jelskii (Miers, 1877) Chace & Holthuis, 1948. Revista

Brasileira de Biologia, v. 19, n. 4, p. 413-419, 1959.

BELLAFRONTE, Elisangela et al. Cytogenetic identification of invasive fish species

following connections between hydrographic basins. Hydrobiologia, v. 649, n. 1, p. 347-

354, 2010.

BENSASSON, Douda et al. Mitochondrial pseudogenes: evolution's misplaced

witnesses. Trends in ecology & evolution, v. 16, n. 6, p. 314-321, 2001.

BERBEL-FILHO, Waldir M. et al. Inter-and intra-basin phenotypic variation in two

riverine cichlids from northeastern Brazil: potential eco-evolutionary damages of São

Francisco interbasin water transfer. Hydrobiologia, v. 766, n. 1, p. 43-56, 2015.

BLANCO, Daniel Rodrigues et al. Characterization of invasive fish species in a river

transposition region: evolutionary chromosome studies in the genus Hoplias

(Characiformes, Erythrinidae). Reviews in Fish Biology and Fisheries, v. 20, n. 1, p. 1-

8, 2009.

BLOOM, Devin. D.; LOVEJOY, Nathan R. The biogeography of marine incursions in

South America. In: Albert, J.S.; Reis, R.E. (Eds.). Historical Biogeography of

Neotropical Freshwater Fishes. University of California Press, Berkeley, 2011 p.137-

144.

BØHN, Thomas; AMUNDSEN, Per-Arne; SPARROW, Ashley. Competitive exclusion

after invasion?. Biological Invasions, v. 10, n. 3, p. 359-368, 2008.

BRITO NEVES, Benjamin B.; DOS SANTOS, Edilton J.; VAN SCHMUS, William R.

Tectonic history of Borborema Province, Northeastern Brazil. In: Cordani, U.G, Thomaz

Filho, A.; Campos, D.A. (Eds.). Tectonic Evolution of South America. 31st

International Geological Congress, Rio de Janeiro, 2000. p.151-182

BUHAY, Jennifer E. “COI-like” sequences are becoming problematic in molecular

systematic and DNA barcoding studies. Journal of Crustacean Biology, v. 29, n. 1, p.

96-110, 2009.

80

CABY, Renaud; ARTHAUD, Michel H.; ARCHANJO, Carlos J. Lithostratigraphy and

petrostructural characterization of supracrustal units in the Brasiliano Belt of Northeast

Brazil: geodynamic implications. Journal of South American Earth Sciences, v. 8, n.

3-4, p. 235-246, 1995.

CARNEIRO, Celso D. R.; HAMZA, Valiya M.; DE ALMEIDA, Fernando F. M.

Ativação tectônica, fluxo geotérmico e sismicidade no Nordeste Oriental

brasileiro. Revista Brasileira de Geociências, v. 19, n. 3, p. 310-322, 1989.

DE CARVALHO, Fabrício L.; PILEGGI, Leonardo G.; MANTELATTO, Fernando L.

Molecular data raise the possibility of cryptic species in the Brazilian endemic prawn

Macrobrachium potiuna (Decapoda, Palaemonidae)/Datos moleculares sugieren la

presencia de una especie críptica del camarón endémico brasileño Macrobrachium

potiuna (Decapoda, Palaemonidae). Latin American Journal of Aquatic Research, v.

41, n. 4, p. 707, 2013.

COELHO, Petrônio A.; RAMOS-PORTO, Marilena. Camarões de água doce do Brasil:

distribuição geográfica. Revista Brasileira de Zoologia, v. 2, n. 6, p. 405-410, 1985.

COLLINS, Pablo A. Macrobrachium jelskii (Miers, 1877). Crustaceana, v. 73, n. 9, p.

1167-1169, 2000.

D'ERRICO, Ilenia; GADALETA, Gemma; SACCONE, Cecilia. Pseudogenes in

metazoa: origin and features. Briefings in functional genomics & proteomics, v. 3, n.

2, p. 157-167, 2004.

DE GRAVE, S.; CAI, Y.; ANKER, A. Global diversity of shrimps (Crustacea: Decapoda:

Caridea) in freshwater. Hydrobiologia, v. 595, n. 1, p. 287-293, 2008.

DEN TEX, Robert-Jan et al. Nuclear copies of mitochondrial genes: another problem for

ancient DNA. Genetica, v. 138, n. 9-10, p. 979-984, 2010.

DLUGOSCH, K. M.; PARKER, I. M. Founding events in species invasions: genetic

variation, adaptive evolution, and the role of multiple introductions. Molecular ecology,

v. 17, n. 1, p. 431-449, 2008.

DUPRÉ, Enrique M.; BARROS, Claudio. In vitro fertilization of the rock shrimp,

Rhynchocinetes typus (Decapoda, Caridea): a review. Biological research, v. 44, n. 2, p.

125-133, 2011.

DRUMMOND, Alexei J. et al. Bayesian phylogenetics with BEAUti and the BEAST

1.7. Molecular biology and evolution, v. 29, n. 8, p. 1969-1973, 2012.

81

DWYER, Gary S.; CHANDLER, Mark A. Mid-Pliocene sea level and continental ice

volume based on coupled benthic Mg/Ca palaeotemperatures and oxygen

isotopes. Philosophical Transactions of the Royal Society of London A:

Mathematical, Physical and Engineering Sciences, v. 367, n. 1886, p. 157-168, 2008.

EXCOFFIER, Laurent; LISCHER, Heidi EL. Arlequin suite ver 3.5: a new series of

programs to perform population genetics analyses under Linux and Windows. Molecular

ecology resources, v. 10, n. 3, p. 564-567, 2010.

FREELAND, J. R. Molecular Ecology. Chichester: John Wiley & Sons, Ltd, 2005.

FRÉZAL, Lise; LEBLOIS, Raphael. Four years of DNA barcoding: current advances and

prospects. Infection, Genetics and Evolution, v. 8, n. 5, p. 727-736, 2009.

GAMBA, A. L. Desarrollo larval abreviado del camarón de agua dulce Macrobrachium

jelskii (Miers, 1877). Primeras Jornadas Científicas, Universidad Simón Bolívar.

Caracas, Venezuela, p. 169-190, 1980.

GAMBA, A. L. Different egg-associated and larval development characteristics of

Macrobrachium jelskii and Macrobrachium amazonicum (Arthropoda: Crustacea) in a

Venezuelan continental lagoon. International Journal of Invertebrate Reproduction

and Development, v. 7, n. 3, p. 135-142, 1984.

GAMBA, A. L. Biología reproductiva de Macrobrachium jelskii (Miers, 1877) y

Macrobrachium amazonicum (Heller, 1862) en Venezuela (Crustacea, Decapoda,

Palaemonidae). Acta Cientifica Venezolana, v. 48, n. 1, p. 19-26, 1997.

GAZIEV, A. I.; SHAIKHAEV, G. O. Nuclear mitochondrial pseudogenes. Molecular

Biology, v. 44, n. 3, p. 358-368, 2010.

GERSTEIN, M.; ZHENG, D. The real life of pseudogenes. Scientific American, v. 295,

n. 2, p. 48-55, 2006.

GRANT, Evan H. C. et al. Interbasin water transfer, riverine connectivity, and spatial

controls on fish biodiversity. PLoS One, v. 7, n. 3, p. e34170, 2012.

GUERRA, A. L. et al. Genetic variability and phylogenetic aspects in species of the genus

Macrobrachium. Genetics and Molecular Research, p. 3646-3655, 2014.

GURGEL, J. J. S.; OLIVEIRA, A. B. Efeitos da introdução de peixes e crustáceos no

semi-árido do nordeste brasileiro. ESAM, 1987.

HANDLEY, L.-J. Lawson et al. Ecological genetics of invasive alien

species. BioControl, v. 56, n. 4, p. 409, 2011.

82

HARTL, D. L. Princípios de Genética de População. 3ª ed. Ribeirão Preto: FUNPEC

Editora, 2008, 217 p.

HASTINGS, Alan; HARRISON, Susan. Metapopulation dynamics and genetics. Annual

review of Ecology and Systematics, v. 25, n. 1, p. 167-188, 1994.

HAZKANI-COVO, Einat; ZELLER, Raymond M.; MARTIN, William. Molecular

poltergeists: mitochondrial DNA copies (numts) in sequenced nuclear genomes. PLoS

Genet, v. 6, n. 2, p. e1000834, 2010.

HEBERT, Paul DN; RATNASINGHAM, Sujeevan; DE WAARD, Jeremy R. Barcoding

animal life: cytochrome c oxidase subunit 1 divergences among closely related

species. Proceedings of the Royal Society of London B: Biological Sciences, v. 270, n.

Suppl 1, p. S96-S99, 2003.

HLAING, Thaung et al. Mitochondrial pseudogenes in the nuclear genome of Aedes

aegypti mosquitoes: implications for past and future population genetic studies. Bmc

Genetics, v. 10, n. 1, p. 11, 2009.

HOLTHUIS, Lipke Bijdeley. The Decapoda of the Siboga Expedition: Pt. 10: the

Palaemonidae Collected by the Siboga and Snellius Expeditions with Remarks on

Other Species: 1: Subfamily Palaemoninae. Brill, 1950.

HOLTHUIS, Lipke Bijdeley. A general revision of the Palaemonidae (crustacea

Decapod Natantia) of the Americas. II. The subfamily Palaemonidae. 1952.

HOLTHUIS, L. B. A collection of freshwater prawns (Crustacea Decapoda,

Palaemonidae) from Amazonia, Brazil, collected by Dr. G. Marlier. 1966.

HOLTHUIS, Lipke Bijdeley et al. FAO species catalogue. Volume 1-Shrimps and

prawns of the world. An annotated catalogue of species of interest to fisheries. 1980.

JALIHAL, D. R.; SANKOLLI, K. N.; SHENOY, Shakuntala. Evolution of larval

developmental patterns and the process of freshwaterization in the prawn genus

Macrobrachium Bate, 1868 (Decapoda, Palaemonidae). Crustaceana, v. 65, n. 3, p. 365-

376, 1993.

KIM, Se‐Joo; LEE, Kyeong Yong; JU, Se‐Jong. Nuclear mitochondrial pseudogenes in

Austinograea alayseae hydrothermal vent crabs (Crustacea: Bythograeidae): effects on

DNA barcoding. Molecular ecology resources, v. 13, n. 5, p. 781-787, 2013.

KNOWLTON, Nancy; WEIGT, Lee A. New dates and new rates for divergence across

the Isthmus of Panama. Proceedings of the Royal Society of London B: Biological

Sciences, v. 265, n. 1412, p. 2257-2263, 1998.

83

LEITE, Luis Anderson Ribeiro. Mitochondrial pseudogenes in insect DNA barcoding:

differing points of view on the same issue. Biota Neotropica, v. 12, n. 3, p. 301-308,

2012.

LIMA, Flávio C. T.; RIBEIRO, Alexandre C. (2011) Continental–scale tectonic controls

of biogeography and ecology. In: ALBERT J.S.; REIS R.E. (Eds.). Historical

Biogeography of Neotropical Freshwater Fishes, University of California Press,

Berkeley, 2011. p.145-164.

LIU, Min-Yun; CAI, Yi-Xiong; TZENG, Chyng-Shyan. Molecular systematics of the

freshwater prawn genus Macrobrachium Bate, 1868 (Crustacea: Decapoda:

Palaemonidae) inferred from mtDNA sequences, with emphasis on East Asian

species. Zoological Studies-Taipei-, v. 46, n. 3, p. 272, 2007.

LOPEZ, Jose V. et al. Numt, a recent transfer and tandem amplification of mitochondrial

DNA to the nuclear genome of the domestic cat. Journal of Molecular evolution, v. 39,

n. 2, p. 174-190, 1994.

LIBRADO, Pablo; ROZAS, Julio. DnaSP v5: a software for comprehensive analysis of

DNA polymorphism data. Bioinformatics, v. 25, n. 11, p. 1451-1452, 2009.

LOVEJOY, Nathan R.; BERMINGHAM, Eldredge; MARTIN, Andrew P. Marine

incursion into South America. Nature, v. 396, n. 6710, p. 421-422, 1998.

LUNDBERG, G. J. et al. Phylogeny and Classification of Neotropical Fishes. In:

MALABARBA, L. R. et al. (Eds.). The stage for Neotropical fish diversification: a

history of tropical South America river, Edipuers, Porto Alegre, 1998. p.13-48.

MACIEL, Cristiana R. et al. Occurrence of the Indo-Pacific freshwater prawn

Macrobrachium equidens Dana 1852 (Decapoda, Palaemonidae) on the coast of Brazilian

Amazonia, with notes on its reproductive biology. Anais da Academia Brasileira de

Ciências, v. 83, n. 2, p. 533-544, 2011.

MAGALHÃES, Célio. Abbreviated larval development of Macrobrachium jelskii

(Miers, 1877) (Crustacea: Decapoda: Palaemonidae) from the Rio Solimões floodplain,

Brazil, reared in the laboratory. Nauplius, v.8, n.1, p. 1-14, 2000.

MAGALHÃES, Célio et al. Exotic species of freshwater decapod crustaceans in the state

of São Paulo, Brazil: records and possible causes of their introduction. Biodiversity and

Conservation, v. 14, n. 8, p. 1929-1945, 2005.

MEADOR, Michael R. Inter-basin water transfer: ecological concerns. Fisheries, v. 17,

n. 2, p. 17-22, 1992.

84

MEDINA, Antonio; RODRIGUEZ, Antonio. Structural changes in sperm from the

fiddler crab, Uca tangeri (Crustacea, Brachyura), during the acrosome

reaction. Molecular reproduction and development, v. 33, n. 2, p. 195-201, 1992.

MELO, G. A. S. Famílias Atyidae, Palaemonidae e Sergestidae. Manual de

identificação dos Crustacea Decapoda de água doce do Brasil, p. 289-415, 2003.

MIERS, E. J. On a Collection of Crustacea, Decapoda and Isopoda, Chiefly from

South America: With Descriptions of New Genera and Species..., 1877.

MILLER, S. A.; DYKES, D. D.; POLESKY, H. F. A simple salting out procedure for

extracting DNA from human nucleated cells. Nucleic acids res, v. 16, p. 1215, 1988.

MURPHY, Nicholas P.; AUSTIN, Christopher M. Phylogenetic relationships of the

globally distributed freshwater prawn genus Macrobrachium (Crustacea: Decapoda:

Palaemonidae): biogeography, taxonomy and the convergent evolution of abbreviated

larval development. Zoologica Scripta, v. 34, n. 2, p. 187-197, 2005.

NGUYEN, Thuy TT; MURPHY, Nicholas Paul; AUSTIN, Christopher M. Amplification

of multiple copies of mitochondrial Cytochrome b gene fragments in the Australian

freshwater crayfish, Cherax destructor Clark (Parastacidae: Decapoda). Animal

genetics, v. 33, n. 4, p. 304-308, 2002.

NOVAK, S. J.; MACK, R. N. Genetic bottlenecks in alien plant species: influence of

mating systems and introduction dynamics. In: SAX, D. F., STACHOWICZ, J. J,

GAINES, S. D. (Eds.). Species Invasions: Insights into Ecology, Evolution, and

Biogeography. Sinauer Associates: Sunderland, MA, 2005. p. 201–228.

PAIVA M. P.; BARRETO V. A. Notas sobre a biologia do camarão ‘sossego’,

Macrobrachium jelskii (Miers, 1877) numa pequena bacia potamográfica do nordeste

brasileiro. Revista Brasileira de Biologia, v. 20, n. 2, p. 121-129, 1960.

PELLEGRINO, Katia et al. Phylogeography and species limits in the Gymnodactylus

darwinii complex (Gekkonidae, Squamata): genetic structure coincides with river systems

in the Brazilian Atlantic Forest. Biological Journal of the Linnean Society, v. 85, n. 1,

p. 13-26, 2005.

PELLEGRINO, Katia CM et al. Molecular phylogeny, biogeography and insights into

the origin of parthenogenesis in the Neotropical genus Leposoma (Squamata:

Gymnophthalmidae): Ancient links between the Atlantic Forest and

Amazonia. Molecular Phylogenetics and Evolution, v. 61, n. 2, p. 446-459, 2011.

85

PEREIRA, G. A cladistic analysis of the freshwater shrimps of the family Palaemonidae

(Crustacea, Decapoda, Caridea). Acta Biologica Venezuelica, v. 17, n. 1, p. 1-69, 1997.

PERES, Wellington Adriano Moreira et al. Invasion, dispersion and hybridization of fish

associated to river transposition: karyotypic evidence in Astyanax “bimaculatus group”

(Characiformes: Characidae). Reviews in Fish Biology and Fisheries, v. 22, n. 2, p. 519-

526, 2012.

PEULVAST, Jean-Pierre et al. Low post-Cenomanian denudation depths across the

Brazilian Northeast: implications for long-term landscape evolution at a transform

continental margin. Global and Planetary Change, v. 62, n. 1, p. 39-60, 2008.

PILEGGI, Leonardo G.; MANTELATTO, Fernando L. Molecular phylogeny of the

freshwater prawn genus Macrobrachium (Decapoda, Palaemonidae), with emphasis on

the relationships among selected American species. Invertebrate Systematics, v. 24, n.

2, p. 194-208, 2010.

PILEGGI, Leonardo et al. Molecular perspective on the American transisthmian species

of Macrobrachium (Caridea, Palaemonidae). Zookeys, v. 457, p. 109, 2014.

PITTOCK, J.; MENG, J.; CHAPAGAIN, A. K. Interbasin Water Transfers and Water

Scarcity in a Changing World — A Solution or a Pipedream? A Discussion Paper in

a Burning Issue. WWF Germany, Frankfurt, 2009.

POSADA, David; CRANDALL, Keith A.. . Modeltest: testing the model of DNA

substitution. Bioinformatics, v. 14, n. 9, p. 817-818, 1998.

RAMBAUT, A. et al. Tracer v. 1.6. Institute of Evolutionary Biology, University of

Edinburgh. 2014.

RAMOS, V. A.; ALEMAN, A. Tectonic Evolution of the Andes. In: Cordani, U. et al.

(Eds.). Tectonic Evolution of South America, 31st International Geological Congress,

Rio de Janeiro, 2000. p.635-685.

RIDLEY, M. Evolução. Artmed, Porto Alegre, RS, 2006, 752p.

RICHLY, Erik; LEISTER, Dario. NUMTs in sequenced eukaryotic genomes. Molecular

biology and evolution, v. 21, n. 6, p. 1081-1084, 2004.

ROBERTSON, Charles. Heterotropic bees. Ecology, v. 6, n. 4, p. 412-436, 1925.

RODRÍGUEZ, G. Decapoda. Aquatic biota of tropical South America, v. 1, p. 41-51,

1981.

86

ROSSI, Natalia; MANTELATTO, Fernando Luis. Molecular analysis of the freshwater

prawn Macrobrachium olfersii (Decapoda, Palaemonidae) supports the existence of a

single species throughout its distribution. PLoS One, v. 8, n. 1, p. e54698, 2013.

SCHUBART, C. D. Mitochondrial DNA and Decapod phylogenies: the importance of

pseudogenes and primer optimization. In: MARTIN, J. W. et al (Ed.). Decapod

crustacean phylogenetics: Crustacean Issue 18, 2009.

SHIRK, R. Y. et al. Patterns of genetic diversity reveal multiple introductions and

recurrent founder effects during range expansion in invasive populations of Geranium

carolinianum (Geraniaceae). Heredity, v. 112, n. 5, p. 497-507, 2014.

SOARES, Marcelo R. da S.; OSHIRO, Lídia MY; TOLEDO, Júlio C. Reproductive

biology of the shrimp Macrobrachium jelskii (Crustacea, Decapoda, Palaemonidae) in

São Francisco River, Minas Gerais, Brazil. Iheringia. Série Zoologia, v. 105, n. 3, p.

307-315, 2015.

SONG, Hojun et al. Many species in one: DNA barcoding overestimates the number of

species when nuclear mitochondrial pseudogenes are coamplified. Proceedings of the

National Academy of Sciences, v. 105, n. 36, p. 13486-13491, 2008.

STRUGNELL, Jan M.; LINDGREN, Annie R. A barcode of life database for the

Cephalopoda? Considerations and concerns. Reviews in Fish Biology and Fisheries, v.

17, n. 2-3, p. 337-344, 2007.

SUNNUCKS, Paul; HALES, Dinah F. Numerous transposed sequences of mitochondrial

cytochrome oxidase I-II in aphids of the genus Sitobion (Hemiptera:

Aphididae). Molecular Biology and Evolution, v. 13, n. 3, p. 510-524, 1996.

TALBOT, Prudence; SUMMERS, R. G. The structure of sperm from Panulirus, the spiny

lobster, with special regard to the acrosome. Journal of ultrastructure research, v. 64,

n. 3, p. 341-351, 1978.

TAMURA, Koichiro et al. MEGA4: molecular evolutionary genetics analysis (MEGA)

software version 7.0. Molecular biology and evolution, v. 24, n. 8, p. 1596-1599, 2007.

TENEVA, A. Molecular markers in animal genome analysis. Biotechnology in animal

husbandry, v. 25, n. 5-6-2, p. 1267-1284, 2009.

TIMMIS, Jeremy N. et al. Endosymbiotic gene transfer: organelle genomes forge

eukaryotic chromosomes. Nature Reviews Genetics, v. 5, n. 2, p. 123-135, 2004.

87

TORLONI, C. E. C. et al. Produção pesqueira e composição das capturas em

reservatórios sob concessão da CESP nos rios Tietê, Paraná e Grande, no período

de 1986 a 1991. CESP, São Paulo, 1993.

TURCHETTO‐ZOLET, A. C. et al. Phylogeographical patterns shed light on

evolutionary process in South America. Molecular Ecology, v. 22, n. 5, p. 1193-

1213, 2012.

VALENCIA, Diego M.; CAMPOS, Martha R. Freshwater prawns of the genus

Macrobrachium Bate, 1868 (Crustacea: Decapoda: palaemonidae) of

Colombia. Zootaxa, v. 1456, p. 1-44, 2007.

VERA-SILVA, Ana Luiza; CARVALHO, Fabrício L.; MANTELATTO, Fernando L.

Distribution and genetic differentiation of Macrobrachium jelskii (Miers, 1877)

(Natantia: Palaemonidae) in Brazil reveal evidence of non-natural introduction and

cryptic allopatric speciation. Journal of Crustacean Biology, v. 36, n. 3, p. 373-383,

2016.

VERGAMINI, Fernanda G. et al. Genetic variability of the Amazon river prawn

Macrobrachium amazonicum (Decapoda, Caridea, Palaemonidae). Contributions to

Zoology, v. 80, n. 1, p. 67-83, 2011.

VILLALOBOS-HIRIART, JOSE LUIS; CANTÚ, A.; LIRA-FERNÁNDEZ, ENRIQUE.

Los crustáceos de agua dulce de México. Revista de la Sociedad Mexicana de Historia

Natural, v. 44, p. 267-290, 1993.

WARES, J. P., HUGHES, A. R.; GROSBERG, R. K. Mechanisms that drive evolutionary

change: insights from species introductions and invasions. In: SAX, D.F.,

STACHOWICZ, J.J., GAINES, S.D. (Eds.). Species invasions: insights into ecology,

evolution, and biogeography. Sinauer, Sunderland, 2005, p. 229–257.

WILLIAMS, S. T.; KNOWLTON, N. Mitochondrial pseudogenes are pervasive and

often insidious in the snapping shrimp genus Alpheus. Molecular Biology and

Evolution, v. 18, n. 8, p. 1484-1493, 2001.

WILLIAMS, S. T. et al. Evidence for three major clades within the snapping shrimp

genus Alpheus inferred from nuclear and mitochondrial gene sequence data. Molecular

phylogenetics and evolution, v. 20, n. 3, p. 375-389, 2001.

WILLIAMS, S. T. et al. The Marine Indo-West Pacific Break: Contrasting the Resolving

Power of Mitochondrial and Nuclear Genes1. Integrative and Comparative Biology, v.

42, n. 5, p. 941-952, 2002.

88

TABELAS

Tabela 1 Iniciadores utilizados para extração e verificação de co-amplificação.

Iniciador Sequência (5ˈ3ˈ) Ta Referência

COL8 GAYCAAATACCTTTATTTGT 48 Schubart, 2009

COH1b TGTATARGCRTCTGGRTARTC

COIf CCTGCAGGAGGAGGAGACCC 64 Palumbi & Benzie,

1991 COIa AGTATAAGCGTCTGGGTAGTC

COI_MA_R RTTAGCTGTTAGGGGGATTTCT 55 Presente estudo

89

Tabela 2 Descrição das espécies utilizadas com seus respectivos, ID/NºGenBank (identificação no presente estudo ou número de identificação no banco

de dados de Nucleotídeos do NLM/NCBI - National Center for Biotechnology Information), Localidade (Munícipio, Estado, País), Coord Geo

(coordenadas geográficas, somente para as localidades do presente estudo) e Referência (literatura na qual a sequência foi obtida e utilizada em

inferências filogenéticas). RN – Rio Grande do Norte, CE – Ceará, PB – Paraíba, PE – Pernambuco, PI – Piauí.

Espécie ID/N°GenBank Localidade Coord Geo Referência M. jelskii CRT2312-CRT2340 Santa Cruz, RN, Brasil 05°39'29,5''S / 37°46'17,5''O Presente estudo M. jelskii CRT2343-CRT2348 Orós, CE, Brasil 06°14'18,8''S / 38°54'45,3''O Presente estudo M. jelskii CRT2361-CRT2365 Saboeiro, CE, Brasil 06°32'31,1''S / 39°54'37,5''O Presente estudo M. jelskii CRT2401-CRT2405 Bonito de Santa Fé, PB, Brasil 07°16'12,7''S / 38°30'34,1''O Presente estudo M. jelskii CRT2406-CRT2410 Aparecida, RN, Brasil 06°47'07,0''S / 38°05'09,6''O Presente estudo M. jelskii CRT2468-CRT2472 Barra de Santana, PB, Brasil 07°31'45"S / 35°59'55,3"O Presente estudo M. jelskii CRT2461-CRT2465 Boqueirão, PB, Brasil 07°29'11,9''S / 36°07'24,5"O Presente estudo M. jelskii CRT2431-CRT2435 Buíque, PE, Brasil 08°25' / 2,4''S / 37°22'14,6''O Presente estudo M. jelskii CRT2436-CRT2440 Ouricuri, PE, Brasil 08°13'48,3"S / 39°53'47,4"O Presente estudo M. jelskii CRT2517-CRT2521 São João de Piauí, PI, Brasil 08°22'00,3"S / 42°14'10,1"O Presente estudo M. jelskii CRT2522-CRT2526 São João de Piauí, PI, Brasil 08°27'13,8"S / 42°09'53,2"O Presente estudo M. jelskii CRT2527-CRT2531 Conceição do Canindé, PI, Brasil 07°58'30,1"S / 41°59'26,5"O Presente estudo M. jelskii GU929469 Pereira Barreto, SP, Brasil --- Vergamini et al. (2011) M. jelskii HM352484 Pereira Barreto, SP, Brasil --- Pileggi & Mantelatto (2010) M. jelskii HAP1 Pereira Barreto, SP, Brasil --- LBDM - UFRJ M. amazonicum GU929542 Itacoatiara, Brasil --- Vergamini et al. (2011) M. amazonicum GU929500 Santana, Brasil --- Vergamini et al. (2011) M. amazonicum GU929471 Abaetetuba, Brasil --- Vergamini et al. (2011) M. amazonicum GU929489 Belém, Brasil --- Vergamini et al. (2011) M. amazonicum GU929492 Santa Bárbara, Brasil --- Vergamini et al. (2011)

90

M. amazonicum GU929479 Aquiraz, Brasil --- Vergamini et al. (2011) M. amazonicum GU929538 Miguelópolis, Brasil --- Vergamini et al. (2011) M. amazonicum GU929505 Sertãozinho, Brasil --- Vergamini et al. (2011) M. amazonicum GU929532 Avaré, Brasil --- Vergamini et al. (2011) M. amazonicum GU929515 Aquidauana, Brasil --- Vergamini et al. (2011) M. amazonicum GU929524 Miranda, Brasil --- Vergamini et al. (2011) M. ferreirai HM352483 Manaus, Brasil --- Pileggi & Mantelatto (2010) M. borelli GU929467 Buenos Aires, Argentina --- Vergamini et al. (2011) M. heterochirus HM352494 Ilha de São Sebastião, Brasil --- Pileggi & Mantelatto (2010) M. brasiliense GU929468 Serra Azul, Brasil --- Vergamini et al. (2011) M. brasiliense HM352482 Serra Azul, Brasil --- Pileggi & Mantelatto (2010) M. acanthurus GU929470 Ilha de São Sebastião, Brasil --- Vergamini et al. (2011) M. carcinus GU929553 Santana, Brasil --- Vergamini et al. (2011) M. carcinus HM352491 Isla Margarita, Venezuela --- Pileggi & Mantelatto (2010) M. carcinus HM352492 Rio São Francisco, Brasil --- Pileggi & Mantelatto (2010) M. carcinus HM352493 Ilha do Careiro, Brasil --- Pileggi & Mantelatto (2010) M. americanum GU929552 Pacifico Sul, Costa Rica --- Vergamini et al. (2011) M. crenulatum GU929555 Isla Margarita, Venezuela --- Vergamini et al. (2011) M. olfersii GU929554 Ilha de São Sebastião, Brasil --- Vergamini et al. (2011) M. olfersii HM352496 Ilha de São Sebastião, Brasil --- Pileggi & Mantelatto (2010) C. caementarius HM352495 4ª região, Chile --- Pileggi & Mantelatto (2010)

91

Tabela 3 Diversidade genética da sequência Citocromo Oxidase Sub-unidade I. N (número de indíviduos); NH (número de haplótipos observados);

H (diversidade haplotípica); π (diversidade nucleotídica média); SD (desvio padrão). Estados: RN – Rio Grande do Norte, CE – Ceará, PB –

Paraíba, PE – Pernambuco, PI – Piauí.

Região Hidrográfica Bacia Hidrográfica Localidade N NH H (SD) π (SD) Nordeste Médio-Oriental Apodi-Mossoró Santa Cruz – RN 9 1 - - Jaguaribe Orós – CE 5 1 - - Saboeiro – CE 5 1 - - Piranhas Açu Bonito de Santa Fé – PB 5 1 - - Aparecida – RN 5 1 - - Paraíba do Norte Barra de Santana – PB 4 1 - - Boqueirão – PB 5 1 - - São Francisco São Francisco Buíque – PE 5 1 - - Ouricuri – PE 5 1 - - Maranhão-Piauí Parnaíba São João de Piauí – PI 9 1 - - Paraná Paraná-Paraguai Perreira Barreto – SP 2 2 - - Total 58 2 0.095(0.050) 0.0044(0.0019)

92

FIGURAS

Fig. 1 Representação da amostragem no Nordeste brasileiro (a); e destaque nas bacias,

distribuídas nas ecorregiões sugeridas por (Albert & Reis 2011) (b).

93

94

Fig. 2 Electroferogramas do indivíduo CRT2329 obtidos com os iniciadores universais (COIa/COIf), os iniciadores específicos para decápodes (COL8/COH1b) e o iniciador específico para Macrobrachium (COIMAR). As caixas ressaltam alguns dos sítios onde foram observados picos duplos nos eletroferogramas obtidos com os iniciadores universais.

95

Fig. 3 Árvore filogenética proveniente do método de reconstrução Neighbor-Joining gerada a partir das sequências de citocromo b. Números próximos aos nós indicam a probabilidade a posteriori de suporte de veracidade do clado. Nesta árvore foram utilizadas sequências provenientes do manuscrito Vera-Silva et al. (2016), com possíveis evidências de NuMts para Macrobrachium jelskii (Miers, 1877).

96

Fig. 4 Árvore filogenética proveniente da inferência Bayesiana gerada a partir das sequências de citocromo b. Números próximos aos nós indicam a probabilidade a

posteriori de suporte de veracidade do clado. Barras em azul claro indicam tempo de divergência. Caixa sombreada representa a linhagem correspondente a espécie Macrobrachium jelskii (Miers, 1877).